Search

Macrophomina phaseolina is the most devastating and emerging threat to groundnut production in India. An increase in average temperature and inconsistent rainfalls resulting from changing climatic conditions are strongly believed to aggravate the disease and cause severe yield losses. The present study aims to conduct a holistic survey to assess the prevalence and incidence of dry root rot of groundnut in major groundnut growing regions of Southern India, viz., Andhra Pradesh, Telangana, Karnataka, and Tamil Nadu. Furthermore, the pathogenic variability was determined using different assays such as morphological, cultural, pathogenic, and molecular assays. Results indicate that disease incidence in surveyed locations ranged from 8.06 to 20.61%. Both temperature and rainfall played a major role in increasing the disease incidence. The pathogenic variability of M. phaseolina isolates differed significantly, based on the percent disease incidence induced on cultivars of JL-24 groundnut and K-6 groundnut. Morphological variations in terms of growth pattern, culture color, sclerotia number, and sclerotia size were observed. The molecular characterization of M. phaseolina isolates done by ITS rDNA region using ITS1 and ITS4 primers yielded approximately 600 bp PCR amplicons, sequenced and deposited in GenBank (NCBI). Molecular variability analysis using SSR primers indicated the genetic variation among the isolates collected from different states. The present investigation revealed significant variations in pathogenic variability among isolates of M. phaseolina and these may be considered important in disease management and the development of resistant cultivars against groundnut dry root rot disease. [ABSTRACT FROM AUTHOR]

Celery (Apium graveolens var. dulce) is affected by several plant diseases, such as Fusarium oxysporum f. sp. apii (Foa). Four Foa races have been found in the US. The goals of this study were to determine which races are present in Costa Rica and to quantify the tolerance of the imported commercial cultivars of celery produced in the country. Isolates from 125 symptomatic celery plants from three different geographical locations were analyzed, 65 of which were selected for phylogenetic analysis. All isolates presented a short sequence of five nucleotides that differentiates Foa race 3 in the IGS rDNA region. Three different haplotypes closely related to race 3 were found, which were highly virulent, produced great losses, and affected all cultivars (resistant to races 2 and 4) of imported commercial celery. Additionally, five different cultivars of celery were evaluated against seven pathogen isolates identified as race 3 in greenhouse conditions. Two of the cultivars showed significantly less chlorosis, wilting, mortality, and higher fresh weight. Most of the Foa isolates significantly increased chlorosis, wilting, and mortality compared to non-inoculated control. Celery producers in Costa Rica lack access to seeds resistant to the Foa race 3 present in the country. [ABSTRACT FROM AUTHOR]

Even if the Romanian market has been overrun in recent years by non-indigenous hybrids, the high degree of adaptability of the Romanian varieties helps them to persist in the struggle for survival. The demands of organic consumption have determined a segment of the country's population to refocus on the consumption of indigenous apples or originating from other areas, but grown for a very long time in our country. The interest for these varieties with tasty fruits and special flavors led us to make a microbiological and molecular assessment. Molecular variability was investigated using ISSR (Inter Single Sequence Repeats) and SCoT (Start Codon Targeted) markers. The microbiological methodology is based on techniques for the isolation and determination of mesophilic bacteria, molds, yeasts, the presence of faecal bacteria and Escherichia coli, Salmonella and Shigella species. Escherichia coli was observed in some samples and enterococci were highlighted in only one sample. The results indicate a variation of the microbial groups in the varieties analyzed and the absence of species that can disturb serious the digestive tract (for example Salmonella and Shigella). [ABSTRACT FROM AUTHOR]

Background: Maintaining genetic diversity is of the most essential principle for a long-term conservation of plant genetic resources and could play a crucial role in their management. The genus Aegilops is one important member of wheat germplasm, and there are evidences that novel genes of this genus' species can be studied/utilized as ideal sources for the wheat cultivar improvement. The objective of this study was to dissect the genetic diversity and population structure among a set of Iranian Aegilops using two gene-based molecular markers. Methods and results: This study investigated the level of genetic diversity among 157 Aegilops accessions consisting of Ae. tauschii Coss. (DD genome), Ae. crassa Boiss. (DDMM genome), and Ae. cylindrica Host. (CCDD genome) belonging to NPGBI using two sets of CBDP and SCoT markers. The SCoT and CBDP primers yielded 171 and 174 fragments, out of which 145 (90.23%) and 167 (97.66%) fragments were polymorphic, respectively. The average of polymorphism information content (PIC)/ marker index (MI)/resolving power (Rp) for SCoT and CBDP markers were 0.32/3.59/16.03 and 0.29/3.01/16.26, respectively. Results of AMOVA revealed the genetic variability within species was greater than the variation observed among them (SCoT: 88% vs. 12%; CBDP: 72% vs. 28%; SCoT + CBDP: 80% vs. 20%). Based on the information obtained from both markers, the higher level of genetic diversity was found in Ae. tauschii as compared to other species. The grouping patterns obtained by Neighbor-joining algorithms, principal coordinate analysis (PCoA), and Bayesian-model-based structure were consistent with each other and resulted in grouping all studied accessions according to their genomic constitutions. Conclusion: The results of this study revealed a high level of genetic diversity among Iranian Aegilops germplasm. Moreover, SCoT and CBDP marker systems were efficient in deciphering DNA polymorphism and classification of Aegilops germplasm. [ABSTRACT FROM AUTHOR]

Rhizoctonia solani is becoming an emerging menace in rice-based vegetable-growing areas of West Bengal, India. From the survey of 2 consecutive years (2016–17 and 2017–18), thirty-eight isolates were obtained from different hosts of rice-vegetable-based cropping systems of West Bengal. Morphological, and pathogenic variability of all the isolates were studied. Correlation studies between pathogenicity and morpho-cultural characters indicated the weight of sclerotia and growth rate to be significant characteristics related to virulence of the R. solani. Molecular variability of the thirty isolates was studied by sequencing of rDNA-ITS region. Sequence analyses of the rDNA-ITS region indicated AG1-IA (21 isolates) as predominant followed by AG1-ID (8 isolates). One isolate (Krc9) was identified as Ceratobasidium oryzae-sativae. The occurrence of subgroup AG1-IA is being reported first time from crucifers in West Bengal. [ABSTRACT FROM AUTHOR]

Common valerian (Valeriana officinalis L.) is an important medicinal plant revealing sedative, hypotensive, anti-spasmodic and anxiolytic activity. The purpose of the study was to determine the intraspecific variability of the common valerian growing wild in Poland and the 'Lubelski' landrace, as to their developmental traits, chemical composition and selected genetic parameters. Both wild-growing populations (19) and the landrace (1) were evaluated under ex situ conditions. Observations of the underground organs parameters, both developmental and chemical (according to the European Pharmacopoeia) were carried out in the first year of the plant's development, while the characteristics of the aboveground organs, followed by the sowing value of seeds (according to the International Seed Testing Association)—in the second year. The genetic analyses were performed using the NGS-DArT-seq method. Results indicate the presence of five different gene pools covering the regions of population's origin, with a gene flow within and between them. A high level of developmental and chemical variabilities among the wild-growing populations was noticed, however without a clear relation to the region of the origin. The mass of underground organs ranged from 107.4 to 403.6 g FW × plant−1 with the content of sesquiterpenic acids at the level of 0.004–0.094%. Population no 18 was distinguished by the highest content of sesquiterpenic acids and the relatively high mass of underground organs, followed by the admixture of the gene pool, typical for the 'Lubelski' landrace. Unlike the 'Lubelski' landrace, the wild-growing populations were characterized by a high amount of an essential oils (3.90 to 10.04 mL/kg), which may be promising from the perspective of their potential use. In turn, the sowing value of the seeds obtained from the populations, expressed as the germinability, was rather low (25.25–62.25%). [ABSTRACT FROM AUTHOR]

Garlic common latent virus (GarCLV, Carlavirus), in co-infection, often worsens the severity of other Allium viruses on the garlic (Allium sativum Linnaeus). The nucleotide (nt) and amino acid (aa) sequences of the TGB and CP genes were analysed to get the first deep insight into the genomic variations and population structure of GarCLV. Global recombinant-free isolates were clustered into three clades in both the nt-based phylogenetic trees of TGB and CP. The clade 3 isolates shared low similarity percentages among themselves, as well as to the clade 1 and 2 isolates. Most major aa changes in the CP were observed on its 5' and 3' ends. Clade 2 obtained the lowest S, η, k, and π values for both the TGB and CP, which indicated low variations among its isolates. Both TGB and CP have undergone a negative selection, with CP being under stronger negative pressure than TGB. Neutrality tests estimated the non-significant negative values to all clades for TGB and CP, except Tajima's D for clade 2 of the TGB. The results of the Ks*, Kst*, Z*, and Snn tests suggested that all three phylogroups were divergent to each other for both TGB and CP. The high Fst on all the clade comparisons for both TGB and CP showed a large gene flow among three clades.

A survey was conducted to know the incidence of viruses in apricot growing in the Srinagar and Shopian regions of Jammu and Kashmir during May 2015. A total of 52 leaf samples were obtained and virus infection was confirmed using nucleic acid spot hybridization (NASH) and reverse transcription-polymerase chain reaction (RT-PCR). The infectivity of cherry virus A (CVA) and prunus necrotic ringspot virus (PNRSV) was found to be 44% and 98% by NASH and 36% and 77% by RT-PCR, respectively. Based on the sequence variability of RdRp, CVA isolates found globally have been grouped into six phylogroups (Group 1–6), whereas PNRSV isolates from India have been divided into three phylogroups (Group 1, Group 2A and Group 2B) based on coat protein gene. Our findings prove that PNRSV and CVA are the two significant viruses of apricot, with PNRSV being the leading cause of apricot necrosis in old orchards. [ABSTRACT FROM AUTHOR]

An experiment was conducted at RARI, Durgapura, SKNAU, Jobner during kharif 2020 to analyze the genetic diversity of the 12 Macrophomina phaseolina isolates by using simple sequence repeat (SSR) markers. The SSR primers were tested for amplification of genomic DNA of Macrophomia phaseolina isolates. Total five primers of MB series were screened against twelve Macrophomia phaseolina isolates. All primes amplified scorable banding pattern. Level of polymorphism for SSR analysis ranged between 60–85.7%. The similarity matrix indicated that 12 isolates exhibited 42.82–100% similarity coefficient. The SSR analysis shows high molecular variability among the isolates grouped into five major clusters A, B, C, D and E. In the similarity matrix Mp-DPR was found to have higher value of similarity coefficient (1), whereas Mp-JSM was found to have lower value if similarity coefficient (0.42).

Garlic common latent virus (GarCLV, Carlavirus), in co-infection, often worsens the severity of other Allium viruses on the garlic (Allium sativum Linnaeus). The nucleotide (nt) and amino acid (aa) sequences of the TGB and CP genes were analysed to get the first deep insight into the genomic variations and population structure of GarCLV. Global recombinant-free isolates were clustered into three clades in both the nt-based phylogenetic trees of TGB and CP. The clade 3 isolates shared low similarity percentages among themselves, as well as to the clade 1 and 2 isolates. Most major aa changes in the CP were observed on its 5' and 3' ends. Clade 2 obtained the lowest S, η, k, and π values for both the TGB and CP, which indicated low variations among its isolates. Both TGB and CP have undergone a negative selection, with CP being under stronger negative pressure than TGB. Neutrality tests estimated the non-significant negative values to all clades for TGB and CP, except Tajima's D for clade 2 of the TGB. The results of the Ks*, Kst*, Z*, and Snn tests suggested that all three phylogroups were divergent to each other for both TGB and CP. The high Fst on all the clade comparisons for both TGB and CP showed a large gene flow among three clades. [ABSTRACT FROM AUTHOR]

Curcuma caesia Roxb. belonging to Zingiberaceae family is a rhizomatous perennial herb consisting of bluish black rhizome and having vast medicinal and pharmaceutical applications. It is considered as an endangered medicinal plant and native to India. The aim of this study is to assess the molecular diversity among the high rhizome essential oil yielding lines of C. caesia (> 1.5% w/w). The molecular diversity analysis was done by using 45 simple sequence repeat markers amongst the 78 high essential oil yielding lines of C. caesia. The overall percentage of polymorphism amongst the lines was found to be 53%. AMOVA analysis showed 20% and 80% variations among and within the population respectively. Dendrogram constructed using Unweighted Pair Group with Arithmetic Mean (UPGMA) for those high essential oil yielding lines sorted into five major clusters according to their different geographical locations. These five clusters were confirmed using principle component analysis (PCA), based on the Jaccard's similarity coefficient. The results revealed that these microsatellite markers could be used as successful tool to differentiate the genetic makeup of the crop. Molecular diversity of C. caesia has not been studied till now. So, this is the first scientific report on molecular diversity analysis which may help in the further crop improvement programme and germplasm conservation also. [ABSTRACT FROM AUTHOR]

Among the wild relatives of wheat, Triticum urartu Tumanian ex Gandilyan is of interest to wheat breeders. Numerous works have focussed on its utilization for enrichment of the genetic variation of cultivated genotypes. In the present study, the genetic diversity and population structure in 85 accessions of T. urartu were investigated using start codon targeted (SCoT) polymorphism and CAAT-box derived polymorphism (CBDP) markers. Nineteen SCoT primers and fifteen CBDP primers amplified 185 and 141 polymorphic fragments with an average of 9.74 and 9.40 fragments per primer, respectively. The polymorphic information content (PIC) for the SCoT and CBDP primers ranged from 0.41 to 0.50 and 0.40 to 0.49, with the resolving power (Rp) ranging from 21.61 to 3.97 and 13.08 to 28.02, respectively. Neighbour-joining (NJ) based clustering grouped 72 accessions into two main clusters based on the two sets of markers and the combined data. Genetic relationships inferred from STRUCTURE analysis was matched with cluster analysis and principal coordinate analysis (PCoA), indicating that the accessions were grouped into two major clades and the grouping patterns were not correlated with the geographic origins. The results from this study revealed that Iranian T. urartu, especially Kerend-e-Gharb and Sisakht-Pataveh populations, can be interesting for wheat improvement. Hence, conservation of this region is recommended.

In order to study the current situation of Citrus psorosis virus (CPsV) in Tunisia, field surveys were conducted in commercial orchards in Cap Bon region and 575 citrus trees were sampled. As determined by DAS-ELISA, the CPsV incidence in Tunisia was high, and ranged between 20 and 47%, according to geographical location, citrus species and varieties. cDNA encompassing the full-length RNA3 from Tunisian isolates was synthesized by RT-PCR using specific primers and two isolates were cloned and sequenced. Full length sequences of the coat protein (CP) gene were obtained and deposited in GenBank. Based on CP gene sequences, phylogenetic clustering of isolates revealed two populations, one includes isolates from Spain, Morocco and New Zealand and the other includes those from Tunisia, Spain, Italy, Mexico and Egypt. Genetic haplotype network provided evidence of the existence of two distinct clusters with an ambiguous origin. Selective neutrality test was significantly positive, suggesting a balancing selection of CPsV CP gene.

Genetic diversity in safflower blight pathogen (Alternaria carthami) was analyzed using 20 isolates collected from major safflower growing regions of Maharashtra state in India. Experiment was conducted at Department of Agricultural Bioatechnology, College of Agriculture, Latur, VNMKV, Parbhani (M.S.). Genomic DNA extracted from each isolates of Alternaria carthami was subjected to polymerase chain reaction using 20 random decamer primers from OPA series. Only 08 of the 20 RAPD primers were selected based on repeatability. Result revealed that 100 per cent polymorphism were found. The dendrogram analysis revealed two clusters, Cluster I comprised twelve isolates viz., Ac-1, Ac-8, Ac-4, Ac-5, Ac-7, Ac-11, Ac-18, Ac-15, Ac-17, Ac-9, Ac-20 and Ac-19 with similarity coefficient of 77 per cent. Cluster II comprised of eight isolates viz., Ac-2, Ac-3, Ac-6, Ac-13, Ac-12, Ac-14, Ac-10 and Ac-16 with similarity coefficient of 76 per cent.

Grapevine fanleaf virus (GFLV) is one of the main causes of grapevine fanleaf degeneration disease (GFDD) and is present in almost all areas where grapevine is cultivated. In this work, we ascertained the presence and spread of GFLV in different commercial vineyards in four Sicilian provinces (Italy), and its genetic structure and molecular variability were studied. In detail, a total of 617 grapevine samples of 11 autochthonous grapevine cultivars were collected in 20 commercial vineyards. Preliminary screening by serological (DAS-ELISA) and molecular (RT-PCR) analyses for ArMV (arabis mosaic virus) and GFLV detection were conducted. Results obtained showed the absence of ArMV in all the samples analyzed, while 48 out of 617 samples gave positive results to GFLV, for a total of 9 out of 11 cultivars analyzed. Phylogenetic analyses carried out on the GFLV-CP gene of 18 Sicilian GFLV sequences selected in this study showed a certain degree of variability among the Sicilian isolates, suggesting a different origin, probably as a consequence of the continuous interchange of GFLV-infected propagating material with other Italian regions or viticultural areas located in other countries.

Rodents are a very diverse group with large chromosome variability. One of the most species rich linage in the Neotropics is the Sigmodontinae. Among them, the tribe Abrotrichini was recently defined and its taxonomy and phylogeny were mostly elucidated through molecular and morphological evidence. Meanwhile, chromosome data were only secondarily used because of fragmentary information. In this contribution, we conduct a chromosome characterization of Abrothrix hirta, A. olivacea, A. andina, and Paynomys macronyx, review the cytogenetic background of the tribe, and contrast it with molecular data. Chromosomes were analyzed by conventional and differential techniques. All Abrothrix species presented 2n = 52/FNa = 56, with a high similarity in the banding patterns reflecting a conserved karyotype, which does not coincide with its high molecular variability. In turn, P. macronyx have 2n = 54/FNa = 58–59, varying due to a heteromorphic pair of autosomes. In addition, in this last species, different morphologies of the X chromosome and the presence of B chromosomes were detected. Heterochromatin was involved in these variants. The telomeric probe in P. macronyx marks terminal regions of all chromosomes. B chromosomes generated strong telomeric signals. The Ag-NORs banding revealed the same patterns in Abrothrix and Paynomys. Cytogenetic data support phylogenetic relationships previously proposed and suggest that the specious genus Abrothrix could have retained the ancestral karyotype of the subfamily. In the tribe, the relatively conserved chromosome complement contrasts with its high molecular variability. This indicates decoupling between the rates of chromosomal and molecular divergence, as observed in other rodent lineages. In abrotrichines, chromosome evolution was slower. [ABSTRACT FROM AUTHOR]

Among the wild relatives of wheat, Triticum urartu Tumanian ex Gandilyan is of interest to wheat breeders. Numerous works have focussed on its utilization for enrichment of the genetic variation of cultivated genotypes. In the present study, the genetic diversity and population structure in 85 accessions of T. urartu were investigated using start codon targeted (SCoT) polymorphism and CAAT-box derived polymorphism (CBDP) markers. Nineteen SCoT primers and fifteen CBDP primers amplified 185 and 141 polymorphic fragments with an average of 9.74 and 9.40 fragments per primer, respectively. The polymorphic information content (PIC) for the SCoT and CBDP primers ranged from 0.41 to 0.50 and 0.40 to 0.49, with the resolving power (Rp) ranging from 21.61 to 3.97 and 13.08 to 28.02, respectively. Neighbour-joining (NJ) based clustering grouped 72 accessions into two main clusters based on the two sets of markers and the combined data. Genetic relationships inferred from STRUCTURE analysis was matched with cluster analysis and principal coordinate analysis (PCoA), indicating that the accessions were grouped into two major clades and the grouping patterns were not correlated with the geographic origins. The results from this study revealed that Iranian T. urartu, especially Kerend-e-Gharb and Sisakht-Pataveh populations, can be interesting for wheat improvement. Hence, conservation of this region is recommended. [ABSTRACT FROM AUTHOR]

Cucurbits are widely grown vegetables in different provinces of Turkey. However their production is restricted by pests and pathogens including different plant viruses, among which Zucchini yellow mosaic virus (ZYMV) is particularly damaging. Infections by this virus during the early stages of plant development causes deformation of fruits and significant yield losses. During 2009-2014, 221 cucurbits samples were collected from fields and greenhouses from different provinces of Turkey. Serological testing was performed by double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) for presence of Watermelon mosaic virus (WMV), ZYMV, Cucumber mosaic virus (CMV), Papaya ring spot virus (PRSV), cucumber green mottle mosaic virus (CGMMV) and Squash mosaic virus (SqMV). For molecular analaysis of ZYMV, full-length CP nucleotide sequences were obtained for 45 ZYMV isolates and compared with sequences from worldwide isolates available in databases. The CP coding regions of Turkish ZYMV were 837 nt long and encoded 279 amino acids (aa). Forty two isolates from different regions were classified in the molecular subgroup A1, the most frequent in the Mediterranean Basin, Europe and Africa. Three isolates collected from Antalya region were classified in subgroup A4 and showed 99% sequence identity with isolates from the same subgroup that have emerged recently in France. [ABSTRACT FROM AUTHOR]

Randomly selected symptomatic chilli samples from Dharwad location were used to isolate total nucleic acids and the resulting genomic DNA was used for PCR using all the three primer sets. Upon fractionation and staining of PCR products is 166 bp on 1.3% agarose gel stained with Ethidium Bromide, expected size PCR amplicon was observed in two samples of chilli for primer pairs specific to ToLCV. On the other hand there was no amplification in any of the samples for TYLCV and ChLCV specific primers. Further, the sequencing results of an amplicon resulting from use of ToLCV specific primer pairs cent per cent matched with already published ToLCV and ChLCV sequences. [ABSTRACT FROM AUTHOR]

Abstract Dermacentor reticulatus , also known as ornate dog tick, is an important vector of the causative agents of various tick-borne diseases in humans, livestock and wild animals. The geographical range of D. reticulatus in Europe is fragmented and divided into two main zones: The Western European and the Eastern European zone. To investigate D. reticulatus population structure through its distribution range we used microsatellite markers and compared the genetic diversity of D. reticulatus in 26 selected sites in the western and eastern European distribution areas. A total of 254 unfed adult D. reticulatus ticks were collected from vegetation and genotyped at 5 microsatellite loci, and altogether 26 alleles were detected. The overall F ST value of pairwise comparisons among 26 sampling sites was 0.128 and revealed a moderate genetic differentiation. Bayesian-clustering analysis showed that D. reticulatus forms two genetically distinct groups across Europe. Division of D. reticulatus distribution range into Eastern European and Western European populations with a possible recent overlap in Poland has been supported by molecular data obtained in this study. Highlights • The distribution of D. reticulatus shows a highly focal pattern. • Tick has extended its range in some regions and increased its epidemiologic impact. • Eastern and Western sites are separated, but have an overlapping zone. • Changes in EU agricultural practice led to an increase of host population growth. [ABSTRACT FROM AUTHOR]

Trichoderma is one of the most exploited biocontrol agent for the management of plant diseases. Twenty strains of Trichoderma (six of T. harzianum , four of T. viride , three of T. virens , three of T. koningii , each one of T. hamatum , T. reesei , T. parceramosum and Trichoderma spp.) subjected to in vitro antagonism up to 12 days after inoculation against Sclerotium rolfsii Sacc. causing stem rot in groundnut. A new concept was developed to determine inhibition coefficient representing pathogen biology and biocontrol related biophysical variables. Results explained differential inhibition coefficient of test pathogen by Trichoderma antagonists. The inhibition coefficient of test pathogen was examined highest (91.13%) by T. virens NBAII Tvs12 followed by T. virens MTCC 794 (89.33%) and T. koningii MTCC 796 (62.39%). Microscopic study confirmed biocontrol mechanism as mycoparasitism for Tvs12 and antibiosis for T. koningii MTCC 796. The sclerotial biogenesis of test pathogen was elevated during weak antagonism and diminished in interactions with strong antagonists. The inhibition coefficient of S. rolfsii was significantly negatively correlated with sclerotia formation and lipid peroxidation during the antagonism. Trichoderma strains were screened for fungicides (carbendazim and tebuconazole, thiram and mancozeb) and abiotic stress (drought and salt) tolerance. Results indicated that T. koningii MTCC 796 efficiently grew better than the other strains with maximum radial growth under adverse conditions. The genetic variability among the Trichoderma was determined using 34 gene specific markers which amplified 146 alleles. The SSR similarities explained substantial diversity (15 to 87%) across Trichoderma strains and pathogen S. rolfsii . Principal coordinates analysis (PCA) were comparable to the cluster analysis and first three most informative PC components explained 64.45% of the total variation. In PCA, potent antagonists appear to be distinct from other strains. Five SSR markers T1F/T1R (311) , TvCTT56f/TvCTT56r (387) , TvGAT18f/TvGAT18r (364) , TvCA39f/TvCA39r (196) and TvAG29f/TvAG29r (418) found to be unique to distinguish best antagonist strain Tvs12. However, MTCC 796 was examined most stress tolerant strain with better inhibition coefficient which might be useful to control the disease under adverse conditions or as a part of integrated pest management. [ABSTRACT FROM AUTHOR]

Genetic diversity in safflower blight pathogen (Alternaria carthami) was analyzed using 20 isolates collected from major safflower growing regions of Maharashtra state in India. Experiment was conducted at Department of Agricultural Bioatechnology, College of Agriculture, Latur, VNMKV, Parbhani (M.S.). Genomic DNA extracted from each isolates of Alternaria carthami was subjected to polymerase chain reaction using 20 random decamer primers from OPA series. Only 08 of the 20 RAPD primers were selected based on repeatability. Result revealed that 100 per cent polymorphism were found. The dendrogram analysis revealed two clusters, Cluster I comprised twelve isolates viz., Ac-1, Ac-8, Ac-4, Ac-5, Ac-7, Ac-11, Ac-18, Ac-15, Ac-17, Ac-9, Ac-20 and Ac-19 with similarity coefficient of 77 per cent. Cluster II comprised of eight isolates viz., Ac-2, Ac-3, Ac-6, Ac-13, Ac-12, Ac-14, Ac-10 and Ac-16 with similarity coefficient of 76 per cent. [ABSTRACT FROM AUTHOR]

The genetic variability of the Brazilian physic nut (Jatropha curcas) germplasm bank (117 accessions) was assessed using a combination of phenotypic and molecular data. The joint dissimilarity matrix showed moderate correlation with the original matrices of phenotypic and molecular data. However, the correlation between the phenotypic dissimilarity matrix and the genotypic dissimilarity matrix was low. This finding indicated that molecular markers (RAPD and SSR) did not adequately sample the genomic regions that were relevant for phenotypic differentiation of the accessions. The dissimilarity values of the joint dissimilarity matrix were used to measure phenotypic + molecular diversity. This diversity varied from 0 to 1.29 among the 117 accessions, with an average dissimilarity among genotypes of 0.51. Joint analysis of phenotypic and molecular diversity indicated that the genetic diversity of the physic nut germplasm was 156% and 64% higher than the diversity estimated from phenotypic and molecular data, respectively. These results show that Jatropha genetic variability in Brazil is not as limited as previously thought.

Twister disease is a major disease of onion (Allium ascalonicum L.). The causal organisms of the anthracnose/twister disease of onion were characterized and identified using molecular markers to assess the diversity of the pathogens and the identity of the pathogen was confirmed by sequencing the amplified ITS rDNA region, and analysing in NCBI BLAST program and identified as C. gloeosporioides, C. acutatum, G. acutata, F. oxysporum and G. moniliformis. The phylogenetic tree showed that all five isolates of Colletotrichum spp. Framed into 3 clusters. Since, there is no gene sequences of C. gloeosporioides C. acutatum and F. oxysporum causing onion twister disease in the Genbank we have deposited our sequences Genbank. Specific DNA amplification of region CgInt was fairly consistent band of 450 bp for C. gloeosporioides and for C. acutatum it was 490 bp which was positive for all isolates of C. acutatum. For F. oxysporum amplification was at 550-570 bp. The products of the PCR ITS rDNA digestion with DraI revealed that no restriction sites were present. The digestion with HaeIII resulted in a characteristic pattern of three fragments in 19 C. gloeosporioides isolates. In 24 isolates of C. acutatum isolates and 25 isolates F. oxysporum showed four clusters. [ABSTRACT FROM AUTHOR]

During 2009-10, wheat fields in eight provinces of Iran including Tehran, Esfahan, Ardabil, Golestan, Mazandaran, Markazi, Qazvin and Zanjan were surveyed and samples were collected from plants showing crown rot disease symptoms. Fusarium species were identified based on morphological features and molecular markers (SCAR). Twelve Fusarium species including F. culmorum, F. pseudograminearum, F. equiseti, F. nygamai, F. proliferatum, F. oxysporum, F. solani, F. pseudonygamai, F. sambucinum, F. acuminatum, F. lateritium and F. verticillioides were identified. F. culmorum was the dominant species and had the highest (32%) frequency, followed by F. pseudograminearum (18%). Genetic diversity of 64 representative isolates of F. culmorum was studied using eight Simple Sequence Repeat (SSR) markers. There was a high level (0.81) of genetic diversity within the total population, where 89% of the variability was distributed within populations and 11% among populations. Number of alleles was between 7 to 22. In addition, there was significant difference among isolates in their aggressiveness. Isolates with a high level of aggressiveness from different geographical areas can be used for screening resistance to F. culmorum. [ABSTRACT FROM AUTHOR]

Apple chlorotic leaf spot virus (ACLSV) is a harmful latent pathogen distributed worldwide in apple orchards. To evaluate the genetic diversity of this virus in Belarusian apple orchards, 850 bp genome fragments coding parts of replicase and movement protein open reading frames from five viral isolates from apple in Belarus were sequenced. High genetic variability was detected among isolates studied. The potential sites of recombination were identified in the partial sequences of the replicase and movement protein genes of ASLSV. The estimation of selection pressure revealed strong negative selection on the genome fragments obtained in this study and homologous to them ACLSV sequences from the GenBank database. Relationships between the geographic origin and the nucleotide identity of the fragments of ACLSV were not found. [ABSTRACT FROM AUTHOR]

'Blast' caused by the heterothallic ascomycete, Magnaporthe grisea (Hebert) Barr. (Anamorph: Pyricularia grisea (Cooke) Sacc.) is the most important disease of finger millet. The rapid changes that occur in the virulence characteristics of this pathogen raise a continuous threat to the existing blast resistant varieties. The pathogen is known for its high genetic variability. Due to continuous shift in its genetic makeup, resistant varieties often succumb to infection. Therefore the present study was undertaken to know the variability of P. grisea existing among the different agro-ecological zones of India. A total of seven SSR markers were used for assaying genetic diversity among the isolates of P. grisea from 48 finger millet varieties collected from three different locations viz., Bengaluru, Vizianagaram and Waghai. Of the seven SSR primers used, 16 alleles were detected with the number of alleles per locus ranging from 2-3 (average of 2.28 alleles/ locus). Gene diversity varied from 0.08 (MGM437) to 0.65 (Pyrms 15 and 16) with an average of 0.38. However, no heterozygosity (0.00%) was detected among the isolates. The PIC values ranged from 0.07 (MGM437) to 0.58 (Pyrms 15 and 16) with an average of 0.32/marker. The allelic size also ranged from 134-204 to 151-281 bp for MGM and Pyrms primers respectively. [ABSTRACT FROM AUTHOR]

The genes encoding 13 classes of pathogenesis-related (PR) proteins were examined for positive selection using maximum-likelihood (ML) models of codon substitution. The study involved 194 sequences from 54 species belonging to 37 genera. Although the sizes of the sequences examined varied from 237 bp for PR12 to 1,110 bp for PR7, most classes (9 out of 13) contained sequences made up of more than 400 nucleotides. Signs of positive selection were obtained for sites in PR proteins 4, 6, 8, 9 and 15 using an ML-based Bayesian method and likelihood ratio tests. These results confirm the importance of positive selection in proteins related to defense mechanisms already observed in a wide array of organisms.

Nineteen isolates of Fusarium oxysporum f.sp. zingiberi causal organism of Fusarium yellows in ginger were collected from different ginger growing areas of Himachal Pradesh and designated as I1 to I19. Morphological variations with respect to mycelial colour, conidial size and formation of chlamydospores and pathogenic variation in terms of disease incidence among different isolates was studied in these isolates. The mycelial colour varied from white to dull white with slightly pinkish tinge. The microconidial size varied from 5.20×4.00 μm (I8) to 12.30×5.70 μm (I3) whereas macroconidial size varied from 16.20×4.70 μm (I7) to 32.0×5.70 μm (I4). Chlamydospore dimensions also varied in all the nineteen isolates of the test pathogen. All isolates formed chlamydospores on PDA medium. Pathogenic variability revealed that lesion size varied from 8.50 to 18.00 mm after 10 days of inoculation whereas, incubation period varied from 11 to 19 days. Genetic variation was also analysed by using forty 10 - mer oligonucleotide RAPD primers, out of which 2 primers yielded informative, strong and reproducible DNA amplicons of Fusarium oxysporum f.sp. zingiberi and thus were selected for studying the variation among isolates. The dendrogram of DNA fingerprints revealed 0 to 80% variation among isolates. All isolates were grouped into two different major groups each comprising of ten and nine isolates, respectively. [ABSTRACT FROM AUTHOR]

Turnip mosaic virus ( Tu MV) is one of the most devastating threats to oilseed rape by causing serious crop losses. A total of 86 leaf samples of oilseed rape from eight different locations in Shaanxi, China, were tested by RT- PCR for Tu MV; the results revealed an infection level of 43% by Tu MV. The complete coat protein ( CP) gene of 32 Tu MV isolates was cloned and sequenced. Analysis of the CP gene with sequences from the database allowed the genetic classification of 170 Tu MV isolates or sequences. Four genetic clusters were obtained: MB (mostly Brassica isolates), MR (mostly Radish isolates), IBR (mostly Intermediate between Brassica and Radish clusters) and OBR (mostly outside Brassica and Radish clusters). All subgroups were slightly related to the hosts, but unrelated to geographical origins. Most of Shaanxi Tu MV isolates were on separate branches, compared with the 138 known isolates originating from other parts of the world. Our results help provide a better understanding of the genetic diversity of Tu MV isolates infecting oilseed rape in Shaanxi, China. [ABSTRACT FROM AUTHOR]

The aim of this study was to determine the molecular variability in a collection of Venezuelan isolates of entomopathogenic nematodes and their symbiont bacteria through the application of RAPD markers. The DNA of nematodes and bacteria were extracted by a modification of the method described by Salazar et al. RAPD assay was developed with the primers from the kits OPA and OPB. Genetic fingerprinting of isolates of the nematode and symbiotic bacteria were determined. The total amplified bands for nematode was 493 and 496 for bacteria, with 99,18 and 100% polymorphism, respectively. The clustering obtained for the nematodes was related to the altitude above the sea level at which they were collected, while for the bacteria, the clustering was in general related to the type of soil from which they came. [ABSTRACT FROM AUTHOR]

Sequences of the protein 1 (P1) and coat protein (CP) coding regions of 22 sugarcane streak mosaic virus (SCSMV) isolates were determined. Phylogenetic analysis showed that SCSMV had at least three major lineages, and the lineages seemed to reflect geographical origin. The sudden expansions of the Chinese and Indian subpopulations were supported by calculations showing deviations from the neutral equilibrium model for the individual lineages with an overall lack of nucleotide diversity. Our study shows that Chinese and Indian SCSMV isolates are part of a distinct population, and the subpopulations probably reflect founder effects. [ABSTRACT FROM AUTHOR]

Tomato yellow leaf curl virus (TYLCV), belonging to the genus Begomovirus of the family Geminiviridae, is emerging as the most destructive pathogen of tomato plants. Since the first report of TYLCV in Shanghai, China in 2006, TYLCV has spread rapidly to 13 provinces or autonomous regions of China. In this study, the molecular variability and evolution of TYLCV were monitored in Shanghai from its first upsurge in 2006 until 2010. Full-length genomic sequences of 26 isolates were obtained by rolling circle amplification. Sequence analysis showed that the intergenic region was the most variable, with a mean mutation rate of 4.81×10 nucleotide substitutions per site per year. Genetic differentiation was found within isolates obtained from 2006, 2009, and 2010, though a linear increase in genetic diversity over time was not evident. Whilst significant parts of TYLCV genes were under negative selection, the C4 gene embedded entirely within the C1 gene had a tendency to undergo positive selection. Our results indicate that a mechanism of independent evolution of overlapping regions could apply to the natural population of TYLCV in Shanghai, China. [ABSTRACT FROM AUTHOR]

Highlights: [•] 83 new complete CP gene sequences were obtained for GLRaV-1. [•] Conserved AA sequences suitable for antibody production were identified. [•] A monospecific IgG (Mono-IgG) was commercially produced against a 14 AA peptide. [•] The Mono-IgG was validated by in situ immunoassay and tissue print immunoblotting. [Copyright &y& Elsevier]

Aflatoxin contamination is a major problem in maize, groundnut, chillies, cotton and tree nuts. These aflatoxins are low molecular weight toxic and carcinogenic secondary metabolites produced byAspergillus flavus,A. parasiticusandA. nomius. In the present study, a total of 11 isolates ofA. flavusisolated from groundnut, maize and chilli collected from different locations of Tamil Nadu, India were tested for their ability to produce aflatoxin B1 (AFB1)in vitroby indirect competitive enzyme-linked immunosorbent assay. The results show that the isolates vary in their level of toxin production. The amount of AFB1 produced by the toxigenic isolates ofA. flavusranged from 6.6 to 108.1 ng ml−1. Among the various isolates ofA. flavus, the isolate VKR produced the highest amount (108.1 ng ml−1) of AFB1. The isolates viz. CBE1, CBE2, BSR1, BSR3 and BSR4 were found to be non-toxigenic. The genetic variability among these isolates was assessed by Random amplified polymorphic DNA (RAPD) analysis. DNA fragments of between 0.15 and 3.0 kb were obtained using 13 random primers, and each isolate differed in the size and number of PCR products indicating considerable polymorphism. Cluster analysis using Unweighted Pair Group Method with Arithmetic Mean clearly separated the isolates into four main clusters confirming the genetic diversity among the isolates ofA. flavus. Both toxigenic and non-toxigenic isolates were intermingled in these four groups, indicating that no relationship exists between RAPD profile and the production of aflatoxin byA. flavus. [ABSTRACT FROM PUBLISHER]

The coat protein (CP) gene of five Indian Garlic common latent virus (GarCLV) isolates was sequenced and it was 960 bp long in all the five isolates, encoding a protein of 319 amino acids. Comparative nucleotide sequence analysis revealed diversity of 4.3 % among the Indian isolates and of 11.9 % among all isolates worldwide. Amino acid sequence comparison showed a significant variability in the N-terminal of CP of GarCLV. Various protein analysis tools identified thirteen conserved domains and motifs including Carlavirus and Potexvirus-specific Flexi CP and Flexi N CP. Phylogenetic analysis clustered GarCLV isolates in the subgroup II with isolates from Australia, Brazil, Japan, and South Korea. Intraspecies recombination study revealed that only one of the Indian isolates was a recombinant. Interspecies recombination study suggested the absence of genetic exchange from Carlavirus species to GarCLV; conversely, GarCLV was identified as a putative donor for at least two other Carlavirus species. This is the first report of molecular variability and recombination in GarCLV isolates. [ABSTRACT FROM AUTHOR]

Abstract: Thirty-five unique partial sugarcane bacilliform virus (SCBV) sequences extending over 529bp were identified in sugarcane samples from Guadeloupe diagnosed by Immunocapture-PCR (IC-PCR) using specific badnavirus primers. Phylogenetic analysis of these sequences along with the two known genome sequences of Sugarcane bacilliform Mor virus (SCBMV) and Sugarcane bacilliform IM virus (SCBIMV) revealed high molecular variability in the SCBV genome. Seven phylogenetic groups, named A to G, were characterized: virus isolates from groups A-B, C and D are proposed to be members of three additional SCBV species. The two (7446 and 7444bp) and one (7317bp) complete sequences of SCBV isolates from groups A and D, respectively, likely represented the genome of two new species. Phylogenetic analysis of the complete genome and RT/RNase H sequences confirmed the polyphyletic structure of SCBV isolates and the absence of a clear separation between SCBV and Banana streak virus (BSV) isolates within badnavirus group 1. These results showed that reconsideration of taxonomy and classification of SCBV and BSV are necessary. [Copyright &y& Elsevier]

Genetic variability among the virulent isolates of Sclerotium rolfsii was studied using molecular techniques like RAPD, ITS-PCR and RFLP. The RAPD banding pattern reflected the genetic diversity among the isolates by formation of two clusters. A total of 221 reproducible and scorable polymorphic bands ranging approximately as low as 100 bp to as high as 2500 bp were generated with five RAPD primers. ITS region of rDNA amplification with specific ITS1 and ITS4 universal primers produced approximately 650 to 700 bp in all the isolates confirmed that all the isolates obtained are Sclerotium rolfsii. Studies by ITS-RFLP indicated that there was no polymorphism in restriction banding pattern among the isolates with the restriction endonucleases used. [ABSTRACT FROM AUTHOR]

Spot blotch, caused by the pathogen Bipolaris sorokiniana is an important disease of wheat and is responsible for large economic losses world wide. In this study, molecular variability in B. sorokiniana isolates collected from different regions of India was investigated using URP-PCR technique. All the 40 isolates used in the study were pathogenic when tested on susceptible host, Agra local, although they varied in pathogenicity. Isolate BS-49 was least virulent showing 4.5 infection index while BS-75 was the most virulent with 63.4 infection index. The universal rice primers (URPs’) are primers which have been derived from DNA repeat sequences in the rice genome. Out of the 12 URP markers used in the study, 10 markers were effective in producing polymorphic fingerprint patterns from DNA of B. sorokiniana isolates. The analysis of entire fingerprint profile using unweighted pair group method with arithmetic averages (UPGMA) differentiated B. sorokiniana isolates obtained from different geographic regions. One isolate BS-53 from northern hill zone was different from rest of the isolates showing less than 50% similarity. Broadly, three major clusters were obtained using UPGMA method. One cluster consisted of isolates from North western plain zone; second cluster having isolates from North eastern plain zone and third cluster consisted of isolates from Peninsular zone showing more than 75% genetic similarity among them. One of the markers, URP-2F (5′GTGTGCGATCAGTTGCTGGG3′) amplified three monomorphic bands of 0.60, 0.80 and 0.90 kb size which could be used as specific markers for identification of B. sorokiniana. Further, based on URP-PCR analysis, the grouping of the isolates according to the geographic origin was possible. This analysis also provided important information on the degree of genetic variability and relationship between the isolates of B. sorokiniana. [ABSTRACT FROM AUTHOR]

Six new sequences of the coat protein (CP) gene of Citrus variegation virus (CVV) isolates, some producing crinkly leaf symptoms and some asymptomatic, and collected in Campania (southern Italy), are presented. Comparison with previously reported CP gene sequences of isolates from various locations worldwide confirmed a high degree of coat protein gene conservation in Campania (lowest similarity among all CVV sequences 92.4%). No relationship was found between amino-acid substitutions and host species or symptoms. Phylogenetic analysis proved that CP sequences from Campania isolates clustered in a new group when compared to those reported in the data bank. [ABSTRACT FROM AUTHOR]