Search

The protein kinases DYRK1A and DYRK1B are pivotal regulators of cell cycle progression by promoting cell cycle exit into quiescence. DYRK1B appears to play a more important role in cancer cell quiescence than DYRK1A, as evidenced by its overexpression or copy number variations in human tumour samples. Nonetheless, the stimuli driving DYRK1B upregulation and the potential divergence in expression patterns between DYRK1A and DYRK1B remain largely elusive. In the present study, we scrutinized the regulatory pathways modulating DYRK1B expression relative to DYRK1A in PANC-1 and A549 cancer cell lines across varying conditions. Serum deprivation, pharmacological mTOR inhibition and increased cell density resulted in the differential upregulation of DYRK1B compared to DYRK1A. We then aimed to assess the role of protein kinases MST1 and MST2, which are key transmitters of cell density dependent effects. Unexpectedly, exposure to the MST1/2 inhibitor XMU-MP-1 resulted in increased DYRK1B levels in A549 cells. Further investigation into the off-target effects of XMU-MP-1 unveiled the inhibition of Aurora kinases (AURKA and AURKB) as a potential causative factor. Consistently, AURK inhibitors VX-680 (tozasertib), MLN8237 (alisertib), AZD1152-HQPA (barasertib) resulted in the upregulation of DYRK1B expression in A549 cells. In summary, our findings indicate that the expression of DYRK1A and DYRK1B is differentially regulated in cancer cells and reveal that the kinase inhibitor XMU-MP-1 increases DYRK1B expression likely through off target inhibition of Aurora kinases. [ABSTRACT FROM AUTHOR]

Abstract The protein kinases DYRK1A and DYRK1B are pivotal regulators of cell cycle progression by promoting cell cycle exit into quiescence. DYRK1B appears to play a more important role in cancer cell quiescence than DYRK1A, as evidenced by its overexpression or copy number variations in human tumour samples. Nonetheless, the stimuli driving DYRK1B upregulation and the potential divergence in expression patterns between DYRK1A and DYRK1B remain largely elusive. In the present study, we scrutinized the regulatory pathways modulating DYRK1B expression relative to DYRK1A in PANC-1 and A549 cancer cell lines across varying conditions. Serum deprivation, pharmacological mTOR inhibition and increased cell density resulted in the differential upregulation of DYRK1B compared to DYRK1A. We then aimed to assess the role of protein kinases MST1 and MST2, which are key transmitters of cell density dependent effects. Unexpectedly, exposure to the MST1/2 inhibitor XMU-MP-1 resulted in increased DYRK1B levels in A549 cells. Further investigation into the off-target effects of XMU-MP-1 unveiled the inhibition of Aurora kinases (AURKA and AURKB) as a potential causative factor. Consistently, AURK inhibitors VX-680 (tozasertib), MLN8237 (alisertib), AZD1152-HQPA (barasertib) resulted in the upregulation of DYRK1B expression in A549 cells. In summary, our findings indicate that the expression of DYRK1A and DYRK1B is differentially regulated in cancer cells and reveal that the kinase inhibitor XMU-MP-1 increases DYRK1B expression likely through off target inhibition of Aurora kinases.

Misganaw Asmamaw Mengstie,1 Muluken Teshome Azezew,2 Tadesse Asmamaw Dejenie,3 Assefa Agegnehu Teshome,4 Fitalew Tadele Admasu,1 Awgichew Behaile Teklemariam,1 Anemut Tilahun Mulu,1 Melaku Mekonnen Agidew,1 Dagnew Getnet Adugna,5 Habtamu Geremew,6 Endeshaw Chekol Abebe1 1Department of Biochemistry, College of Medicine and Health Sciences, Debre Tabor University, Debre Tabor, Ethiopia; 2Department of Physiology, College of Medicine and Health Sciences, Debre Tabor University, Debre Tabor, Ethiopia; 3Department of Medical Biochemistry, College of Medicine and Health Sciences, University of Gondar, Gondar, Ethiopia; 4Department of Anatomy, College of Medicine and Health Sciences, Debre Tabor University, Debre Tabor, Ethiopia; 5Department of Anatomy, School of Medicine, College of Medicine and Health Sciences, University of Gondar, Gondar, Ethiopia; 6College of Health Sciences, Oda Bultum University, Chiro, EthiopiaCorrespondence: Misganaw Asmamaw Mengstie, Department of Biochemistry, College of Medicine and Health Sciences, Debre Tabor University, Debre Tabor, Ethiopia, Tel +25196715350, Email misganaw118@gmail.comAbstract: The CRISPR-Cas (Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)) and the associated protein (Cas9) system, a young but well-studied genome-editing tool, holds plausible solutions to a wide range of genetic disorders. The single-guide RNA (sgRNA) with a 20-base user-defined spacer sequence and the Cas9 endonuclease form the core of the CRISPR-Cas9 system. This sgRNA can direct the Cas9 nuclease to any genomic region that includes a protospacer adjacent motif (PAM) just downstream and matches the spacer sequence. The current challenge in the clinical applications of CRISPR-Cas9 genome-editing technology is the potential off-target effects that can cause DNA cleavage at the incorrect sites. Off-target genome editing confuses and diminishes the therapeutic potential of CRISPR-Cas9 in addition to potentially casting doubt on scientific findings regarding the activities of genes. In this review, we summarize the recent technological advancements in reducing the off-target effect of CRISPR-Cas9 genome editing.Keywords: CRISPR-Cas9, genome editing, off-target effect, recent advancements, review

The CRISPR-Cas (Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)) and the associated protein (Cas9) system, a young but well-studied genome-editing tool, holds plausible solutions to a wide range of genetic disorders. The single-guide RNA (sgRNA) with a 20-base user-defined spacer sequence and the Cas9 endonuclease form the core of the CRISPR-Cas9 system. This sgRNA can direct the Cas9 nuclease to any genomic region that includes a protospacer adjacent motif (PAM) just downstream and matches the spacer sequence. The current challenge in the clinical applications of CRISPR-Cas9 genome-editing technology is the potential off-target effects that can cause DNA cleavage at the incorrect sites. Off-target genome editing confuses and diminishes the therapeutic potential of CRISPR-Cas9 in addition to potentially casting doubt on scientific findings regarding the activities of genes. In this review, we summarize the recent technological advancements in reducing the off-target effect of CRISPR-Cas9 genome editing. [ABSTRACT FROM AUTHOR]

Several studies have demonstrated that, beyond their antithrombotic effects, P2Y12 receptor inhibitors may provide additional off-target effects through different mechanisms. These effects range from the preservation of endothelial barrier function to the modulation of inflammation or stabilization of atherosclerotic plaques, with an impact on different cell types, including endothelial and immune cells. Many P2Y12 inhibitors have been developed, from ticlopidine, the first thienopyridine, to the more potent non-thienopyridine derivatives such as ticagrelor which may promote cardioprotective effects following myocardial infarction (MI) by inhibiting adenosine reuptake through sodium-independent equilibrative nucleoside transporter 1 (ENT1). Adenosine may affect different molecular pathways involved in cardiac fibrosis, such as the Wnt (wingless-type)/beta (β)-catenin signaling. An early pro-fibrotic response of the epicardium and activation of cardiac fibroblasts with the involvement of Wnt1 (wingless-type family member 1)/β-catenin, are critically required for preserving cardiac function after acute ischemic cardiac injury. This review discusses molecular signaling pathways involved in cardiac fibrosis post MI, focusing on the Wnt/β-catenin pathway, and the off-target effect of P2Y12 receptor inhibition. A potential role of ticagrelor was speculated in the early modulation of cardiac fibrosis, thanks to its off-target effect. [ABSTRACT FROM AUTHOR]

RNase H-dependent gapmer antisense oligonucleotides (ASOs) are a promising therapeutic approach via sequence-specific binding to and degrading target RNAs. However, the efficacy and mechanism of antiviral gapmer ASOs have remained unclear. Here, we investigated the inhibitory effects of gapmer ASOs containing locked nucleic acids (LNA gapmers) on proliferating a mosquito-borne flavivirus, Japanese encephalitis virus (JEV), with high mortality. We designed several LNA gapmers targeting the 3′ untranslated region of JEV genomic RNAs. In vitro screening by plaque assay using Vero cells revealed that LNA gapmers targeting a stem-loop region effectively inhibit JEV proliferation. Cell-based and RNA cleavage assays using mismatched LNA gapmers exhibited an underlying mechanism where the inhibition of viral production results from JEV RNA degradation by LNA gapmers in a sequence- and modification-dependent manner. Encouragingly, LNA gapmers potently inhibited the proliferation of five JEV strains of predominant genotypes I and III in human neuroblastoma cells without apparent cytotoxicity. Database searching showed a low possibility of off-target binding of our LNA gapmers to human RNAs. The target viral RNA sequence conservation observed here highlighted their broad-spectrum antiviral potential against different JEV genotypes/strains. This work will facilitate the development of an antiviral LNA gapmer therapy for JEV and other flavivirus infections. [ABSTRACT FROM AUTHOR]

Small interfering RNA (siRNA) and short hairpin RNA (shRNA) are widely used as RNA interference (RNAi) reagents. Recently, truncated shRNAs that trigger RNAi in a Dicer-independent manner have been developed. We generated a novel class of RNAi reagent, designated enforced strand bias (ESB) RNA, in which an siRNA duplex was chemically bridged between the 3′ terminal overhang region of the guide strand and the 5′ terminal nucleotide of the passenger strand. ESB RNA, which is chemically bridged at the 2′ positions of ribose (2′-2′ ESB RNA), functions in a Dicer-independent manner and was highly effective at triggering RNAi without the passenger strand-derived off-target effect. In addition, the 2′-2′ ESB RNA exhibited a unique target sequence preference that differs from siRNA and silenced target sequences that could not be effectively suppressed by siRNA. Our results indicate that ESB RNA has the potential to be an effective RNAi reagent even when the target sequence is not suitable for siRNA.

Paired SpCas9 nickases (SpCas9n) are an effective strategy to reduce off-target effect in genome editing. However, this approach is not efficient with 3′-overhanging ends, limiting its applications. In order to expand the utility of paired SpCas9n in genome editing, we tested the effect of the TREX2 3′-5′ exonuclease on repair of 3′-overhanging ends. We found ectopic overexpression of Trex2 stimulates the efficiency of paired SpCas9n in genome disruption with 3′-overhanging ends up to 400-fold with little stimulation of off-target editing. TREX2 overexpressed preferentially deletes entire 3′ overhangs but has no significant effect on 5′ overhangs. Trex2 overexpression also stimulates genome disruption by paired SpCas9n that potentially generate short 3′-overhanging ends at overlapping SpCas9n target sites, suggesting sequential nicking of overlapping target sites by SpCas9n. This approach is further simplified with improved efficiency and safety by fusion of TREX2 and particularly its DNA-binding-deficient mutant to SpCas9n. Junction analysis at overlapping targets revealed the different extent of end resection of 3′ single-stranded DNA (ssDNA) by free TREX2 and TREX2 fused to SpCas9n. SpCas9n-TREX2 fusion is more convenient and safer than overexpression of free TREX2 to process 3′-overhanging ends for efficient genome disruption by paired SpCas9n, allowing practical use of this TREX2-based strategy in genome editing.

The renin–angiotensin–aldosterone system (RAAS) plays a crucial role in maintaining various physiological processes in the body, including blood pressure regulation, electrolyte balance, and overall cardiovascular health. However, any compounds or drugs known to perturb the RAAS might have an additional impact on transmembrane ionic currents. In this retrospective review article, we aimed to present a selection of chemical compounds or medications that have long been recognized as interfering with the RAAS. It is noteworthy that these substances may also exhibit regulatory effects in different types of ionic currents. Apocynin, known to attenuate the angiotensin II-induced activation of epithelial Na+ channels, was shown to stimulate peak and late components of voltage-gated Na+ current (INa). Esaxerenone, an antagonist of the mineralocorticoid receptor, can exert an inhibitory effect on peak and late INa directly. Dexamethasone, a synthetic glucocorticoid, can directly enhance the open probability of large-conductance Ca2+-activated K+ channels. Sparsentan, a dual-acting antagonist of the angiotensin II receptor and endothelin type A receptors, was found to suppress the amplitude of peak and late INa effectively. However, telmisartan, a blocker of the angiotensin II receptor, was effective in stimulating the peak and late INa along with a slowing of the inactivation time course of the current. However, telmisartan's presence can also suppress the erg-mediated K+ current. Moreover, tolvaptan, recognized as an aquaretic agent that can block the vasopressin receptor, was noted to suppress the amplitude of the delayed-rectifier K+ current and the M-type K+ current directly. The above results indicate that these substances not only have an interference effect on the RAAS but also exert regulatory effects on different types of ionic currents. Therefore, to determine their mechanisms of action, it is necessary to gain a deeper understanding. [ABSTRACT FROM AUTHOR]

The use of RNA interference (RNAi) is becoming a routine method of scientific discovery and treatment of human diseases. However, its application is hindered by adverse effects, especially the off-target effects. In this work, we established an shRNA test platform based on the plasmid to test the silencing ability of short hairpin RNA (shRNA) targeting survivin gene designed according to shRNA online software and then screened out two shRNAs with excellent silencing ability. The off-target effects were measured by testing the silencing ability of two selected shRNAs against targets with single-nucleotide mutations at different locations. Based on our understanding of the 3′ tail function of microRNA (miRNA) and small interfering RNA (siRNA), we propose a method to reduce the off-target effect of short hairpin RNA by shortening the complementary length of the 3′ tail and target sequence of siRNA only. This method can reduce the off-target effect of shRNA without damaging the silencing efficiency of shRNA gene, so as to effectively improve the specificity of shRNA gene silencing. Compared to previous studies of the weak base pairing of “seed” and 3′ regions to reduce the off-target effect, our method is simpler and more efficient, without being limited by the sequence of 3′ regions of the antisense strand. This method of reducing the off-target effects provides new ideas for the design of shRNA and siRNA, simplifies the sequence restriction in the design of shRNA and siRNA drugs to a certain extent, and broadens their use and prospects as therapeutic and diagnostic tools in medical treatment. [ABSTRACT FROM AUTHOR]

CRISPR/Cas9 genome-editing tools have tremendously boosted our capability of manipulating the eukaryotic genomes in biomedical research and innovative biotechnologies. However, the current approaches that allow precise integration of gene-sized large DNA fragments generally suffer from low efficiency and high cost. Herein, we developed a versatile and efficient approach, termed LOCK (Long dsDNA with 3'-Overhangs mediated CRISPR Knock-in), by utilizing specially designed 3'-overhang double-stranded DNA (odsDNA) donors harboring 50-nt homology arm. The length of the 3'-overhangs of odsDNA is specified by the five consecutive phosphorothioate modifications. Compared with existing methods, LOCK allows highly efficient targeted insertion of kilobase-sized DNA fragments into the mammalian genomes with low cost and low off-target effects, yielding >fivefold higher knock-in frequencies than conventional homologous recombination-based approaches. This newly designed LOCK approach based on homology-directed repair is a powerful tool suitable for gene-sized fragment integration that is urgently needed for genetic engineering, gene therapies, and synthetic biology. [ABSTRACT FROM AUTHOR]

Objective: Concerns about off-target effects (OTEs) of genomic DNA cleavages by gene-editing enzymes have been raised, especially for OTEs that go undetected due to technical limitations. Since no explicit guidelines have been in place for risk assessment of OTEs, the regulatory authorities' concept of an acceptable evaluation scheme for OTEs in the investigational drug application (IND) has not been clear. Here, we clarify the regulatory expectations by examining reports on OTE evaluations of leading gene-editing products that have achieved IND clearance. Methods: We collected and analyzed the gene-editing products that have entered clinical trials by searching on ClinicalTrials.gov and EU-Clinical-Trial-Registries, and related reports for OTE evaluations from Google Scholar, PubMed, and the developers' websites. Results: We found a common two-step verification method used for different products at the preclinical stage. First, numerous potential off-target loci (POLs) are listed with state-of-the-art high-sensitivity detection methods and theoretical screens; Second, these OTEs are checked by amplicon sequencing of the POLs after treatment by enzymes in in vitro models close to clinical use conditions. Only the OTEs that can be detected and verified are addressed in the risk assessment in the translational phase from preclinical to clinical study. Discussion: Here, we describe a clear scheme for risk assessment of OTEs at the key translational phase, based on the common features in protocols for gene-editing products that were cleared for use in clinical trials. This report will provide a guide for those newly attempting to conduct clinical development in this field. [ABSTRACT FROM AUTHOR]

Genome editing in pluripotent stem cells (PSCs) using CRISPR technology holds great promise for therapeutic applications. Yet, it has been reported that Cas9-mediated cleavage could cause large deletions or rearrangements of DNA, and the selection of edited PSCs could acquire p53 mutations. Adenine base editors (ABEs) do not introduce DNA double-strand breaks and thus have been proposed as alternatives to circumvent those problems, but their off-target effects still limit their applications. Here, we tested different combinations of off-target reduction methods to further diminish off-target effects of ABEs without compromising their on-target editing efficiencies. We subsequently chose the best editor, CE-8e-dV, which contains V106W substitution, R153 deletion, and Cas-embedding strategy, to establish a single-cell-derived human embryonic stem cell (hESC) line expressing tetracycline-inducible CE-8e-dV. By performing RNA and whole-genome sequencing, we demonstrated that the expression of CE-8e-dV did not produce nearly any DNA or RNA off-target effects in hESCs. Our results provide stringent proof of the safety of ABEs in PSCs and suggest that CE-8e-dV could be suitable for related therapeutic strategies, such as generation of engineered stem cells in vitro and gene therapy in vivo.

Abstract Background Due to post-cleavage residence of the Cas9-sgRNA complex at its target, Cas9-induced DNA double-strand breaks (DSBs) have to be exposed to engage DSB repair pathways. Target interaction of Cas9-sgRNA determines its target binding affinity and modulates its post-cleavage target residence duration and exposure of Cas9-induced DSBs. This exposure, via different mechanisms, may initiate variable DNA damage responses, influencing DSB repair pathway choices and contributing to mutational heterogeneity in genome editing. However, this regulation of DSB repair pathway choices is poorly understood. Results In repair of Cas9-induced DSBs, repair pathway choices vary widely at different target sites and classical nonhomologous end joining (c-NHEJ) is not even engaged at some sites. In mouse embryonic stem cells, weakening the target interaction of Cas9-sgRNA promotes bias towards c-NHEJ and increases target dissociation and reduces target residence of Cas9-sgRNAs in vitro. As an important strategy for enhancing homology-directed repair, inactivation of c-NHEJ aggravates off-target activities of Cas9-sgRNA due to its weak interaction with off-target sites. By dislodging Cas9-sgRNA from its cleaved targets, DNA replication alters DSB end configurations and suppresses c-NHEJ in favor of other repair pathways, whereas transcription has little effect on c-NHEJ engagement. Dissociation of Cas9-sgRNA from its cleaved target by DNA replication may generate three-ended DSBs, resulting in palindromic fusion of sister chromatids, a potential source for CRISPR/Cas9-induced on-target chromosomal rearrangements. Conclusions Target residence of Cas9-sgRNA modulates DSB repair pathway choices likely through varying dissociation of Cas9-sgRNA from cleaved DNA, thus widening on-target and off-target mutational spectra in CRISPR/Cas9 genome editing.

Abstract MicroRNAs (miRNAs), which were initially discovered in Caenorhabditis elegans, can regulate gene expression by recognizing cognate sequences and interfering with the transcriptional or translational machinery. The application of bioinformatics tools for structural analysis and target prediction has largely driven the investigation of certain miRNAs. Notably, it has been found that certain miRNAs which are widely involved in the inflammatory response and immune regulation are closely associated with the occurrence, development, and outcome of bacterial pneumonia. It has been shown that certain miRNA techniques can be used to identify related targets and explore associated signal transduction pathways. This enhances the understanding of bacterial pneumonia, notably for “refractory” or drug-resistant bacterial pneumonia. Although these miRNA-based methods may provide a basis for the clinical diagnosis and treatment of this disease, they still face various challenges, such as low sensitivity, poor specificity, low silencing efficiency, off-target effects, and toxic reactions. The opportunities and challenges of these methods have been completely reviewed, notably in bacterial pneumonia. With the continuous improvement of the current technology, the miRNA-based methods may surmount the aforementioned limitations, providing promising support for the clinical diagnosis and treatment of “refractory” or drug-resistant bacterial pneumonia.

The CRISPR-Cas9 system has emerged as a powerful and efficient tool for genome editing. An important drawback of the CRISPR-Cas9 system is the constitutive endonuclease activity when Cas9 endonuclease and its sgRNA are co-expressed. This constitutive activity results in undesirable off-target effects that hinder studies using the system, such as probing gene functions or its therapeutic use in humans. Here, we describe a convenient method that allows temporal and tight control of CRISPR-Cas9 activity by combining transcriptional regulation of Cas9 expression and protein stability control of Cas9 in human stem cells. To achieve this dual control, we combined the doxycycline-inducible system for transcriptional regulation and FKBP12-derived destabilizing domain fused to Cas9 for protein stability regulation. We showed that approximately 5%–10% of Cas9 expression was observed when only one of the two controls was applied. By combining two systems, we markedly lowered the baseline Cas9 expression and limited the exposure time of Cas9 endonuclease in the cell, resulting in little or no undesirable on- or off-target effects. We anticipate that this dual conditional CRISPR-Cas9 system can serve as a valuable tool for systematic characterization and identification of genes for various pathological processes.

A recent breakthrough in agricultural biotechnology is the introduction of RNAi-mediated strategies in pest control. However, the off-target effects of RNAi pest control are still not fully understood. Here, we studied the off-target effects of two insecticidal siRNAs in both target and non-target insects. The results revealed that off-target effects of insecticidal siRNAs occur widely in both target and non-target insects. We classified the expression-changed genes according to their homology to the siRNA-targeted gene, related KEGG pathways with the siRNA-targeted gene and continuous matches with siRNAs. Surprisingly, the unintended significant changes in gene expression levels did not strictly match with the number of contiguous nucleotides in the siRNAs. As expected, the expression of small portions of the homologous and KEGG-related genes were significantly changed. We calculated the Shannon entropy of the transcriptome profile of the insects after injecting them with insecticidal siRNAs. Though hundreds of genes were affected in their expression levels post siRNA-treatment, the Shannon entropy of the transcriptome remained unchanged, suggesting that the transcriptome expression was balanced. Our results provide evidence that siRNAs cross-reacted with individual genes in non-target species, but did not have significant effects on the integrity of the transcriptome profiles in either target or non-target species on a genomic scale. The metric we proposed can be used to estimate the off-target effects of insecticidal siRNAs, which might be useful for evaluating the safety of RNAi in pest control.

• ETI affects de-novo synthesis of sphingolipids by altering the ceramides/dihydroceramides ratio • This effect is independent of the genotype and independent of CFTR rescue and functions • The effect is consistent with the inhibition of ceramide desaturase enzymes • Potential long-term safety concerns due to dihydrosphingolipid accumulation should be assessed We report here how the triple combination of drugs elexacaftor/tezacaftor/ivacaftor (ETI) alters the balance of the de-novo synthethic pathway of sphingolipids in primary cells of human bronchial epithelium. The treatment with ETI roughly doubles the levels of dihydrosphingolipids, possibly by modulating the delta(4)-desaturase enzymes that convert dihydroceramides into ceramides. This appears to be an off-target effect of ETI, since it occurs in a genotype-independent manner, for both cystic fibrosis (CF) and non-CF subjects. [ABSTRACT FROM AUTHOR]

The genome editing approach using the components of the CRISPR/Cas system has found wide application in molecular biology, fundamental medicine and genetic engineering. A promising method is to increase the efficacy and specificity of CRISPR/Cas-based genome editing systems by modifying their components. Here, we designed and chemically synthesized guide RNAs (crRNA, tracrRNA and sgRNA) containing modified nucleotides (2'-O-methyl, 2'-fluoro, LNA—locked nucleic acid) or deoxyribonucleotides in certain positions. We compared their resistance to nuclease digestion and examined the DNA cleavage efficacy of the CRISPR/Cas9 system guided by these modified guide RNAs. The replacement of ribonucleotides with 2'-fluoro modified or LNA nucleotides increased the lifetime of the crRNAs, while other types of modification did not change their nuclease resistance. Modification of crRNA or tracrRNA preserved the efficacy of the CRISPR/Cas9 system. Otherwise, the CRISPR/Cas9 systems with modified sgRNA showed a remarkable loss of DNA cleavage efficacy. The kinetic constant of DNA cleavage was higher for the system with 2'-fluoro modified crRNA. The 2'-modification of crRNA also decreased the off-target effect upon in vitro dsDNA cleavage. [ABSTRACT FROM AUTHOR]

Background Trichomoniasis and amoebiasis are neglected diseases and still remain as a global health burden not only for developing countries, from where are endemic, but also for the developed world. Previously, we tested the antiparasitic activity of a number of imidazo[1,2- a ]pyridine derivatives (IMPYs) on metronidazole-resistant strains of Entamoeba Hystolitica (HM1:IMSS), and Trichomonas Vaginalis (GT3). Their anti-inflammatory activity was also evaluated. Objective The present work is a part of a project whose aim is to find new alternatives to standard treatments for these maladies, and to address the current concern of emerging resistant parasite strains. Here we report a non-clinical study focused on exploratory toxicology assays of seven IMPYs that showed the best antiparasitic and/or anti-inflammatory properties. Methods Acute, and subacute toxicity tests were carried out. After 14-day oral treatment, liver and kidney functionality assays in combination with chemometric methods were implemented to detect hepatic and/or kidney damage. Results Some compounds produced off-target effects. Vehicle effects were also detected. However, no signs of hepatic or renal toxicity were observed for any IMPY. Conclusion These compounds can continue non-clinical evaluations, and if possible, clinical trials as new candidates to treat trichomoniasis and amoebiasis, and inflammatory diseases. Further studies are also needed to fully elucidate a proposed dual effect that may exert these molecules against trichomoniasis and amoebiasis, which may also signify a novel mechanism of action to treat these infections. [ABSTRACT FROM AUTHOR]

Summary: PAM‐relaxed Cas9 nucleases, cytosine base editors and adenine base editors are promising tools for precise genome editing in plants. However, their genome‐wide off‐target effects are largely unexplored. Here, we conduct whole‐genome sequencing (WGS) analyses of transgenic plants edited by xCas9, Cas9‐NGv1, Cas9‐NG, SpRY, nCas9‐NG‐PmCDA1, nSpRY‐PmCDA1 and nSpRY‐ABE8e in rice. Our results reveal that Cas9 nuclease and base editors, when coupled with the same guide RNA (gRNA), prefer distinct gRNA‐dependent off‐target sites. De novo generated gRNAs by SpRY editors lead to additional, but insubstantial, off‐target mutations. Strikingly, ABE8e results in ~500 genome‐wide A‐to‐G off‐target mutations at TA motif sites per transgenic plant. ABE8e's preference for the TA motif is also observed at the target sites. Finally, we investigate the timeline and mechanism of somaclonal variation due to tissue culture, which chiefly contributes to the background mutations. This study provides a comprehensive understanding on the scale and mechanisms of off‐target and background mutations occurring during PAM‐relaxed genome editing in plants. [ABSTRACT FROM AUTHOR]

MicroRNAs (miRNAs), which were initially discovered in Caenorhabditis elegans, can regulate gene expression by recognizing cognate sequences and interfering with the transcriptional or translational machinery. The application of bioinformatics tools for structural analysis and target prediction has largely driven the investigation of certain miRNAs. Notably, it has been found that certain miRNAs which are widely involved in the inflammatory response and immune regulation are closely associated with the occurrence, development, and outcome of bacterial pneumonia. It has been shown that certain miRNA techniques can be used to identify related targets and explore associated signal transduction pathways. This enhances the understanding of bacterial pneumonia, notably for "refractory" or drug-resistant bacterial pneumonia. Although these miRNA-based methods may provide a basis for the clinical diagnosis and treatment of this disease, they still face various challenges, such as low sensitivity, poor specificity, low silencing efficiency, off-target effects, and toxic reactions. The opportunities and challenges of these methods have been completely reviewed, notably in bacterial pneumonia. With the continuous improvement of the current technology, the miRNA-based methods may surmount the aforementioned limitations, providing promising support for the clinical diagnosis and treatment of "refractory" or drug-resistant bacterial pneumonia. [ABSTRACT FROM AUTHOR]

Cancer becomes one of the main causes of human deaths in the world due to the high incidence and mortality rate and produces serious economic burdens. With more and more attention is paid on cancer, its therapies are getting more of a concern. Previous research has shown that the occurrence, progression, and treatment prognosis of malignant tumors are closely related to genetic and gene mutation. CRISPR/Cas9 has emerged as a powerful method for making changes to the genome, which has extensively been applied in various cell lines. Establishing the cell and animal models by CRISPR/ Cas9 laid the foundation for the clinical trials which possibly treated the tumor. CRISPR- Cas9-mediated genome editing technology brings a great promise for inhibiting migration, invasion, and even treatment of tumor. However, the potential off-target effect limits its clinical application, and the effective ethical review is necessary. The article reviews the molecular mechanisms of CRISPR/Cas9 and discusses the research and the limitation related to cancer clinical trials. [ABSTRACT FROM AUTHOR]

[Display omitted] The efficacy of chimeric antigen receptor (CAR)-T cell for solid tumors is limited partially because of the lack of tumor-specific antigens and off-target effects. Low molecular weight peptides allowed CAR T cell to display several antigen receptors to reduce off-target effects. Here, we develop a peptide-based bispecific CAR for EGFR and tumor stroma, which are expressed in a variety of tumor types. The peptide-based CAR T cells show excellent proliferation, cytotoxicity activity and are only activated by tumor cells overexpressing EGFR instead of normal cells with low EGFR expressing. In mouse xenograft models, the peptide bispecific CAR T cells can be delivered into the inner of tumor masses and thus are effective in inhibiting tumor growth. Meanwhile, they show strong expansion capacity and the property of maintaining long-term function in vivo. During treatment, no off-tumor toxicity is observed on healthy organs expressing lower levels of EGFR. Our findings demonstrate that peptide-based bispecific CAR T holds great potential in solid tumor therapy due to an excellent targeting ability towards tumors and tumor microenvironment. [ABSTRACT FROM AUTHOR]

Abstract Background It is of utmost importance to investigate novel therapies for cancer, as it is a major cause of death. In recent years, immunotherapies, especially those against immune checkpoints, have been developed and brought significant improvement in cancer management. However, on the other hand, immune checkpoints blockade (ICB) by monoclonal antiboties may cause common and severe adverse reactions (ADRs), the cause of which remains largely undetermined. We hypothesize that ICB-agents may induce adverse reactions through off-target protein interactions, similar to the ADR-causing off-target effects of small molecules. In this study, we propose a hybrid phenotype mining approach which integrates molecular level information and provides new mechanistic insights for ICB-associated ADRs. Methods We trained a conditional random fields model on the TAC 2017 benchmark training data, then used it to extract all drug-centric phenotypes for the five anti-PD-1/PD-L1 drugs from the drug labels of the DailyMed database. Proteins with structure similar to the drugs were obtained by using BlastP, and the gene targets of drugs were obtained from the STRING database. The target-centric phenotypes were extracted from the human phenotype ontology database. Finally, a screening module was designed to investigate off-target proteins, by making use of gene ontology analysis and pathway analysis. Results Eventually, through the cross-analysis of the drug and target gene phenotypes, the off-target effect caused by the mutation of gene BTK was found, and the candidate side-effect off-target site was analyzed. Conclusions This research provided a hybrid method of biomedical natural language processing and bioinformatics to investigate the off-target-based mechanism of ICB treatment. The method can also be applied for the investigation of ADRs related to other large molecule drugs.

Clustered regularly interspaced short palindromic repeats (CRISPR)-associated systems have revolutionized traditional gene-editing tools and are a significant tool for ameliorating gene defects. Characterized by high target specificity, extraordinary efficiency, and cost-effectiveness, CRISPR/Cas systems have displayed tremendous potential for genetic manipulation in almost any organism and cell type. Despite their numerous advantages, however, CRISPR/Cas systems have some inherent limitations, such as off-target effects, unsatisfactory efficiency of delivery, and unwanted adverse effects, thereby resulting in a desire to explore approaches to address these issues. Strategies for improving the efficiency of CRISPR/Cas-induced mutations, such as reducing off-target effects, improving the design and modification of sgRNA, optimizing the editing time and the temperature, choice of delivery system, and enrichment of sgRNA, are comprehensively described in this review. Additionally, several newly emerging approaches, including the use of Cas variants, anti-CRISPR proteins, and mutant enrichment, are discussed in detail. Furthermore, the authors provide a deep analysis of the current challenges in the utilization of CRISPR/Cas systems and the future applications of CRISPR/Cas systems in various scenarios. This review not only serves as a reference for improving the maturity of CRISPR/Cas systems but also supplies practical guidance for expanding the applicability of this technology.

Molnupiravir (EIDD-2801) (MLN) is an oral antiviral drug for COVID-19 treatment, being integrated into viral RNA through RNA-dependent RNA polymerase (RdRp). Upon ingestion, MLN is transformed into two active metabolites: β-d-N 4 -hydroxycytidine (NHC) (EIDD-1931) in the host plasma, and EIDD-1931-triphosphate (MTP) within the host cells. However, recent studies provide increasing evidence of MLN's interactions with off-target proteins beyond the viral genome, suggesting that the complete mechanisms of action of MLN remain unclear. The aim of this study was therefore to investigate the molecular interactions of MLN in the form of NHC and MTP with the non-RNA structural components of avian influenza (hemagglutinin, neuraminidase) and SARS-CoV-2 (spike glycoprotein, Mpro, and RdRp) viruses and to elucidate whether these two metabolites possess the ability to form stable complexes with these major viral components. Molecular docking of NHC and MTP was performed using AutoDock 4.2.6 and the obtained protein-drug complexes were submitted to 200-ns molecular dynamics simulations in triplicate with subsequent free energy calculations using GROMACS. Docking scores, molecular dynamics and MM/GBSA results showed that MTP was tightly bound within the active site of SARS-CoV-2 RdRp and remained highly stable throughout the 200-ns simulations. Besides, it was also shown that NHC and MTP formed moderately-to-highly stable molecular complexes with off-target receptors hemagglutinin, neuraminidase and Mpro, but rather weak interactions with spike glycoprotein. Our computational findings suggest that NHC and MTP may directly inhibit these receptors, and propose that additional studies on the off-target effects of MLN, i.e. real-time protein binding assays, should be performed.Communicated by Ramaswamy H. Sarma.

The therapeutic application of CRISPR-Cas9 is limited due to its off-target activity. To have a better understanding of this off-target effect, we focused on its mismatch-prone PAM distal end. The off-target activity of SpCas9 depends directly on the nature of mismatches, which in turn results in deviation of the active site of SpCas9 due to structural instability in the RNA-DNA duplex strand. In order to test the hypothesis, we designed an array of mismatched target sites at the PAM distal end and performed in vitro and cell line-based experiments, which showed a strong correlation for Cas9 activity. We found that target sites having multiple mismatches in the 18th to 15th position upstream of the PAM showed no to little activity. For further mechanistic validation, Molecular Dynamics simulations were performed, which revealed that certain mismatches showed elevated root mean square deviation values that can be attributed to conformational instability within the RNA-DNA duplex. Therefore, for successful prediction of the off-target effect of SpCas9, along with complementation-derived energy, the RNA-DNA duplex stability should be taken into account., Competing Interests: Conflict of interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 The Authors. Published by Elsevier Inc. All rights reserved.)

Despite the advantages of CRISPR/Cas9 technology in the food industry, controversy over its off-target effects exists. We engineered an industrial Saccharomyces cerevisiae strain isolated from a Korean rice wine starter, Nuruk , using CRISPR/Cas9 to decrease ethyl carbamate (EC) formation. We disrupted the CAR1 gene encoding arginase, which plays a key role in EC formation. Subsequently, we compared the whole genome of the engineered strain to that of the wild type by analyzing heterozygous and homozygous mutations through variant calling. Homozygous mutations in the genome of the engineered strains were identified as the target mutations in CAR1 induced by CRISPR/Cas9, and no other off-target effects were observed. Our findings have critical implications for the use of CRISRP/Cas9 technology in yeasts in the food industry. • CRISPR/Cas9 was used to successfully inactivate the arginase gene in Nuruk yeast. • The genome of Cas9-mediated mutants was compared with that of the wild-type strain. • The mutants showed only the intended CRISPR/Cas9-mediated mutations. • CRISRP/Cas9 technology in yeasts is possibly applicable in the food industry. [ABSTRACT FROM AUTHOR]

RNAi is a potent technique for the knockdown of target genes. However, its potential off-target effects limit the widespread applications in both reverse genetic analysis and genetic manipulation. Previous efforts have uncovered rules underlying specificity of siRNA-based silencing, which has broad applications in humans, but the basis for specificity of dsRNAs, which are better suited for use as insecticides, is poorly understood. Here, we investigated the rules governing dsRNA specificity. Mutational analyses showed that dsRNAs with >80% sequence identity with target genes triggered RNAi efficiently. dsRNAs with ≥16 bp segments of perfectly matched sequence or >26 bp segments of almost perfectly matched sequence with one or two mismatches scarcely distributed (single mismatches inserted between ≥5 bp matching segments or mismatched couplets inserted between ≥8 bp matching segments) also able to trigger RNAi. Using these parameters to predict off-target risk, dsRNAs can be designed to optimize specificity and efficiency, paving the way to the widespread, rational application of RNAi in pest control. [ABSTRACT FROM AUTHOR]

Copyright of Experimental Technology & Management is the property of Experimental Technology & Management Editorial Office and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Small molecular weight protein kinase inhibitors are frequently used tools to unravel the complex network of cellular signal transduction under certain physiological and pathophysiological conditions. 4-amino-5-(4-chlorophenyl)-7-(dimethylethyl)pyrazolo[3,4-d]pyrimidine (PP2) is a widely used compound to block the activity of Src family kinases, the major group of non-receptor tyrosine kinases, which trigger multiple cellular signaling pathways. Here, we show that PP2 induces cytochrome P450 1A1 mRNA expression and enzyme activity in a dose-dependent manner in human HepG2 hepatoma cells and NCTC 2544 keratinocytes. By means of reporter gene assays, RNA interference, electrophoretic mobility shift assay, and competitive ligand-binding assay, we further demonstrate that PP2 is a ligand for the aryl hydrocarbon receptor (AHR), an intracellular chemosensor that regulates xenobiotic metabolism, environmental stress responses, and immune functions. Upon ligand-dependent activation, the AHR translocates into the nucleus and dimerizes with the AHR nuclear translocator (ARNT) to modulate the expression of its target genes. In addition, AHR activation is frequently accompanied by an activation of the tyrosine kinase c-Src, resulting in stimulation of cell-surface receptors and downstream signal transduction. As PP2 activates the AHR/ARNT pathway by simultaneously blocking c-Src-mediated alternative signaling routes, this compound may be a suitable tool to study the contribution of the different AHR-dependent signaling pathways to biological processes and adverse outcomes. On the other hand, the unexpected property of PP2 to stimulate AHR/ARNT signaling should be carefully taken into account in future investigations in order to avoid a false interpretation of experimental results and molecular interrelations.

The resistance to radiotherapy in lung cancer can be attributed to vasculogenic mimicry (VM) to some extent. Celecoxib (CXB), a selective inhibitor of cyclooxygenase-2 (COX-2), is reported as a radiosensitizer in non-small cell lung cancer (NSCLC). However, whether CXB can regulate VM formation via an off-target effect to radiosensitize NSCLC remains unclear. This study aimed to elucidate the mechanism underlying the radiosensitizing effect of CXB on NSCLC, i.e., whether CXB can inhibit VM formation via binding to newly identified targets other than COX-2. CXB radiosensitivity assay was performed in BALB/c mice bearing H460 xenografts and C57 mice bearing Lewis lung cancer (LLC) xenografts, which were divided into the control, CXB, irradiation (IR) treatment, and IR plus CXB groups. VM formation was observed using 3D Matrigel, periodic acid solution (PAS) staining, and immunofluorescence staining. The potential off-targets of CXB were screened using Protein Data Bank (PDB) database, MGLTools 1.5.6, and AutoDock Vina 1.1.2 and confirmed by Western blotting, enzyme activity assay, and RNA interference in vitro experiments and by immunohistochemistry in vivo experiments. CXB treatment almost eliminated the enhancement of VM formation by IR in vitro and in vivo, partially due to COX-2 inhibition. Four potential off-targets were predicted by molecular docking. Among them, aminopeptidase N (APN) and integrin alpha-V (ITAV) were remarkably inhibited in protein expression and enzyme activity in vitro or in vivo, consistent with the remarkable reduction of VM formation in H460 xenografts in BALB/c mice. In conclusion, CXB dramatically blocked VM through inhibiting newly identified off-targets APN and ITAV, other than COX-2, then radiosensitizing NSCLC.

The resistance to radiotherapy in lung cancer can be attributed to vasculogenic mimicry (VM) to some extent. Celecoxib (CXB), a selective inhibitor of cyclooxygenase-2 (COX-2), is reported as a radiosensitizer in non-small cell lung cancer (NSCLC). However, whether CXB can regulate VM formation via an off-target effect to radiosensitize NSCLC remains unclear. This study aimed to elucidate the mechanism underlying the radiosensitizing effect of CXB on NSCLC, i.e., whether CXB can inhibit VM formation via binding to newly identified targets other than COX-2. CXB radiosensitivity assay was performed in BALB/c mice bearing H460 xenografts and C57 mice bearing Lewis lung cancer (LLC) xenografts, which were divided into the control, CXB, irradiation (IR) treatment, and IR plus CXB groups. VM formation was observed using 3D Matrigel, periodic acid solution (PAS) staining, and immunofluorescence staining. The potential off-targets of CXB were screened using Protein Data Bank (PDB) database, MGLTools 1.5.6, and AutoDock Vina 1.1.2 and confirmed by Western blotting, enzyme activity assay, and RNA interference in vitro experiments and by immunohistochemistry in vivo experiments. CXB treatment almost eliminated the enhancement of VM formation by IR in vitro and in vivo , partially due to COX-2 inhibition. Four potential off-targets were predicted by molecular docking. Among them, aminopeptidase N (APN) and integrin alpha-V (ITAV) were remarkably inhibited in protein expression and enzyme activity in vitro or in vivo , consistent with the remarkable reduction of VM formation in H460 xenografts in BALB/c mice. In conclusion, CXB dramatically blocked VM through inhibiting newly identified off-targets APN and ITAV, other than COX-2, then radiosensitizing NSCLC. [ABSTRACT FROM AUTHOR]

Abstract In October 2020, Dr. Emmanuelle Charpentier and Dr. Jennifer Doudna won the Nobel Prize in Chemistry for their pioneering work in precise genome editing using the CRISPR technology. Although CRISPR technology has developed rapidly in the last decade, there are still many uncertainties before eventual use in clinical settings. In this mini review, we summarize the current efforts in addressing the limitations of CRISPR technology and future directions.

Abstract Background Application of the CRISPR/Cas9 system or its derived base editors enables targeted genome modification, thereby providing a programmable tool to exploit gene functions and to improve crop traits. Results We report that PmCDA1 is much more efficient than rAPOBEC1 when fused to CRISPR/Cas9 nickase for the conversion of cytosine (C) to thymine (T) in rice. Three high-fidelity SpCas9 variants, eSpCas9(1.1), SpCas9-HF2 and HypaCas9, were engineered to serve with PmCDA1 (pBEs) as C-to-T base editors. These three high-fidelity editors had distinct multiplex-genome editing efficiencies. To substantially improve their base-editing efficiencies, a tandemly arrayed tRNA-modified single guide RNA (sgRNA) architecture was applied. The efficiency of eSpCas9(1.1)-pBE was enhanced up to 25.5-fold with an acceptable off-target effect. Moreover, two- to five-fold improvement was observed for knock-out mutation frequency by these high-fidelity Cas9s under the direction of the tRNA-modified sgRNA architecture. Conclusions We have engineered a diverse toolkit for efficient and precise genome engineering in rice, thus making genome editing for plant research and crop improvement more flexible.

Viral DNA integrated in host cells is a major barrier to completely curing HIV-1. However, genome editing using the recently developed technique of clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 has the potential to eradicate HIV-1. The present study aimed to use a lentiviral vector-based CRISPR/Cas9 system combined with dual-small/single guide RNAs (sgRNAs) to attack HIV-1 DNA in the latency reactivation model J-Lat 10.6 cell line and to assess off-target effects using whole-genome sequencing (WGS). We designed 12 sgRNAs targeting HIV-1 DNA, and selected high-efficiency sgRNAs for further pairwise combinations after a preliminary evaluation of the editing efficiency. Three combinations of dual-sgRNAs/Cas9 with high editing efficiency were screened successfully from multiple combinations. Among these combinations, the incidences of insertions and deletions in the sgRNA-targeted regions reached 76% and above, and no credible off-target sites were detected using WGS. The results provided comprehensive basic experimental evidence and methodological recommendations for future personalized HIV-1 treatment using CRISPR/Cas9 genome editing technology.

Viral DNA integrated in host cells is a major barrier to completely curing HIV-1. However, genome editing using the recently developed technique of clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 has the potential to eradicate HIV-1. The present study aimed to use a lentiviral vector-based CRISPR/Cas9 system combined with dual-small/single guide RNAs (sgRNAs) to attack HIV-1 DNA in the latency reactivation model J-Lat 10.6 cell line and to assess off-target effects using whole-genome sequencing (WGS). We designed 12 sgRNAs targeting HIV-1 DNA, and selected high-efficiency sgRNAs for further pairwise combinations after a preliminary evaluation of the editing efficiency. Three combinations of dual-sgRNAs/Cas9 with high editing efficiency were screened successfully from multiple combinations. Among these combinations, the incidences of insertions and deletions in the sgRNA-targeted regions reached 76% and above, and no credible off-target sites were detected using WGS. The results provided comprehensive basic experimental evidence and methodological recommendations for future personalized HIV-1 treatment using CRISPR/Cas9 genome editing technology. [ABSTRACT FROM AUTHOR]

Severe acute respiratory syndrome coronavirus 2 (SARS‐CoV‐2), is a retrovirus having genome size of around 30 kb. Its genome contains a highly conserved leader sequence at its 5′ end, which is added to all subgenomic mRNAs at their 5′ terminus by a discontinuous transcription mechanism and regulates their translation. Targeting the leader sequence by RNA interference can be an effective approach to inhibit the viral replication. In the present study an in‐silico prediction of highly effective siRNAs was performed to target the leader sequence using the online software siDirect version 2.0. Low seed‐duplex stability, exact complementarity with target, at least three mismatches with any off‐target and least number of off‐targets, were considered as effective criteria for highly specific siRNA. Further validation of siRNA affinity for the target was accomplished by molecular docking by HNADOCK online server. Our results revealed four potential siRNAs, of which siRNA having guide strand sequence 5′GUUUAGAGAACAGAUCUACAA3′ met almost all specificity criteria with no off‐targets for guide strand. Molecular docking of all predicted siRNAs (guide strand) with the target leader sequence depicted highest binding score of −327.45 for above‐mentioned siRNA. Furthermore, molecular docking of the passenger strand of the best candidate with off‐target sequences gave significantly low binding scores. Hence, 5′GUUUAGAGAACAGAUCUACAA3′ siRNA possess great potential to silence the leader sequence of SARS‐CoV‐2 with least off‐target effect. Present study provides great scope for development of gene therapy against the prevailing COVID‐19 disease, thus further research in this concern is urgently demanded. [ABSTRACT FROM AUTHOR]

Variants of the SH3 and multiple ankyrin repeat domains 3 (SHANK3), which encodes postsynaptic scaffolds, are associated with brain disorders. The targeted alleles in a few Shank3 knock-out (KO) lines contain a neomycin resistance (Neo) cassette, which may perturb the normal expression of neighboring genes; however, this has not been investigated in detail. We previously reported an unexpected increase in the mRNA expression of Shank3 exons 1–12 in the brains of Shank3B KO mice generated by replacing Shank3 exons 13–16 with the Neo cassette. In this study, we confirmed that the increased Shank3 mRNA in Shank3B KO brains produced an unusual ∼60 kDa Shank3 isoform (Shank3-N), which did not properly localize to the synaptic compartment. Functionally, Shank3-N overexpression altered the dendritic spine morphology in cultured neurons. Importantly, Shank3-N expression in Shank3B KO mice was not a compensatory response to a reduction of full-length Shank3 because expression was still detected in the brain after normalizing the level of full-length Shank3. Moreover, in another Shank3 KO line (Shank3 gKO) with a similar Shank3 exonal deletion as that in Shank3B KO mice but without a Neo cassette, the mRNA expression levels of Shank3 exons 1–12 were lower than those of wild-type mice and Shank3-N was not detected in the brain. In addition, the expression levels of genes neighboring Shank3 on chromosome 15 were altered in the striatum of Shank3B KO but not Shank3 gKO mice. These results suggest that the Neo cassette has potential off-target effects in Shank3B KO mice.

• sgRNA-dCas9 shows promise as a therapeutic tool against cancer. • sgRNA-dCas9 could be exploited as a versatile epigenetic editing tool. • In vivo and in vitro studies with sgRNA-dCas9 in cancer are limited. • Several technical factors are crucial for targeting cancer with sgRNA-dCas9. Cancer therapeutics is an ever-evolving field due to incessant demands for effective and precise treatment options. Over the last few decades, cancer treatment strategies have shifted somewhat from surgery to targeted precision medicine. CRISPR-dCas9 is an emerging version of precision cancer therapy that has been adapted from the prokaryotic CRISPR-Cas system. Once ligated to epigenetic effectors (EE), CRISPR-dCas9 can function as an epigenetic editing tool and CRISPR-dCas9-EE complexes could be exploited to alter cancerous epigenetic features associated with different cancer hallmarks. In this article, we discuss the rationale of epigenetic editing as a therapeutic strategy against cancer. We also outline how sgRNA-dCas9 was derived from the CRISPR-Cas system. In addition, the current status of sgRNA-dCas9 use (in vivo and in vitro) in cancer is updated with a molecular illustration of CRISPR-dCas9-mediated epigenetic and transcriptional modulation. As sgRNA-dCas9 is still at the developmental phase, challenges are inherent to its use. We evaluate major challenges in targeting cancer with sgRNA-dCas9 such as off-target effects, lack of sgRNA designing rubrics, target site selection dilemmas and deficient sgRNA-dCas9 delivery systems. Finally, we appraise the sgRNA-dCas9 as a prospective cancer therapeutic by summarizing ongoing improvements of sgRNA-dCas9 methodology. [ABSTRACT FROM AUTHOR]

Copyright of Chinese Journal of Cancer Biotherapy is the property of Editorial Office of Chinese Journal of Cancer Biotherapy and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Variants of the SH3 and multiple ankyrin repeat domains 3 (SHANK3), which encodes postsynaptic scaffolds, are associated with brain disorders. The targeted alleles in a few Shank3 knock-out (KO) lines contain a neomycin resistance (Neo) cassette, which may perturb the normal expression of neighboring genes; however, this has not been investigated in detail. We previously reported an unexpected increase in the mRNA expression of Shank3 exons 1–12 in the brains of Shank3B KO mice generated by replacing Shank3 exons 13–16 with the Neo cassette. In this study, we confirmed that the increased Shank3 mRNA in Shank3B KO brains produced an unusual ∼60 kDa Shank3 isoform (Shank3-N), which did not properly localize to the synaptic compartment. Functionally, Shank3-N overexpression altered the dendritic spine morphology in cultured neurons. Importantly, Shank3-N expression in Shank3B KO mice was not a compensatory response to a reduction of full-length Shank3 because expression was still detected in the brain after normalizing the level of full-length Shank3. Moreover, in another Shank3 KO line (Shank3 gKO) with a similar Shank3 exonal deletion as that in Shank3B KO mice but without a Neo cassette, the mRNA expression levels of Shank3 exons 1–12 were lower than those of wild-type mice and Shank3-N was not detected in the brain. In addition, the expression levels of genes neighboring Shank3 on chromosome 15 were altered in the striatum of Shank3B KO but not Shank3 gKO mice. These results suggest that the Neo cassette has potential off-target effects in Shank3B KO mice. [ABSTRACT FROM AUTHOR]

In drug discovery, most small molecules cannot cross many stages, only a few can become drug candidates. Once the drug molecule is approved and marketed, nontarget effects that are not easily distinguishable from the actual target of the drugs might be evaluated. This situation restricts the treatment. Thus, the discovery of new drugs is a very long and expensive process. In recent years, without developing new drugs, the approach of using different and new target molecules in new indications apart from the indications of licensed drug molecules has gained importance. In this study, using the connectivity map program, it was determined that metformin and tolbutamide used in the treatment of type II diabetes had the potential to inhibit Rho kinase. In the experimental results to confirm this data, it has been shown that metformin and tolbutamide decrease the cell area within 24 h and metformin inhibits the activation of Rho kinase in MCF-7 cells. These results indicate that metformin, which is used in the treatment of type II diabetes, acts as a ROCK inhibitor. Metformin has potential in the treatment of various pathological conditions in which Rho kinase has a role. [ABSTRACT FROM AUTHOR]

RNAi plays a crucial role in insect gene function research and pest control field. Nonetheless, the variable efficiency of RNAi across diverse insects and off-target effects also limited its further application. In this study, we cloned six essential housekeeping genes from Solenopsis invicta and conducted RNAi experiments by orally administering dsRNA. Then, we found that mixing with liposomes significantly enhanced the RNAi efficiency by targeting for SiV-ATPaseE . Additionally, we observed a certain lethal effect of this dsRNA on queens by our established RNAi system. Furthermore, no strict sequence-related off-target effects were detected. Finally, the RNAi effect of large-scale bacteria expressing dsRNA was successfully confirmed for controlling S. invicta . In summary, this study established an RNAi system for S. invicta and provided a research template for the future development of nucleic acid drugs based on RNAi.

Clustered regularly interspaced short palindromic repeats (CRISPR)-Cas-based genome editing technology has enabled manipulation of the embryonic genome. Unbiased whole genome sequencing comparing parents to progeny has revealed that the rate of Cas9-induced mutagenesis in mouse embryos is indistinguishable from the background rate of de novo mutation. However, establishing the best practice to confirm on-target alleles of interest remains a challenge. We believe that improvement in editing strategies and screening methods for founder mice will contribute to the generation of quality-controlled animals, thereby ensuring reproducibility of results in animal studies and advancing the 3Rs (replacement, reduction, and refinement).

Circular non-coding RNAs are found to play important roles in biology but are still relatively unexplored as a structural motif for chemically regulating gene function. Here, we investigated whether small interfering RNA (siRNA) with a circular structure can circumvent off-target gene silencing, a problem often observed with standard linear duplex siRNA. In the present work, we, for the first time, synthesized a series of circular siRNAs by cyclizing two ends of a single-stranded RNA (sense or antisense strand) to construct circular siRNAs that were more resistant to enzymatic degradation. Gene silencing of GFP and luciferase was successfully achieved using these circular siRNAs with circular sense strand RNAs and their complementary linear antisense strand RNAs. The off-target effect of sense strand RNAs was evaluated and no cross off-target effects were observed. In addition, we successfully achieved longer gene-silencing efficiency in mice with circular siRNAs than with linear siRNAs. These results indicate the promise of circular siRNAs for overcoming off-target effects of siRNAs and enhancing the possible long-term effect of siRNA gene silencing in basic research and drug development.