Search

Telomeric G-quadruplexes (G4s) are non-canonical DNA structures composed of TTAGGG repeats. They are extensively studied both as biomolecules key for genome stability and as promising building blocks and functional elements in synthetic biology and nanotechnology. This is why it is extremely important to understand how the interaction between G4s is affected by their topology. We used small-angle x-ray scattering to investigate the end-to-end stacking of antiparallel telomeric G-quadruplexes formed by the sequence AG3(T2AG3)3. To represent the experimental data, we developed a highly efficient coarse-grained fitting tool, which successfully described the samples as an equilibrium mixture of monomeric and dimeric G4 species. Our findings indicate that the antiparallel topology prevents the formation of long multimeric structures under self-crowding conditions, unlike the hybrid/parallel structures formed by the same DNA sequence. This result supports the idea that the stacking of monomeric G-quadruplexes is strongly affected by the presence of diagonal loops. [ABSTRACT FROM AUTHOR]

Condensation of RNA and proteins is central to cellular functions, and the ability to program it would be valuable in synthetic biology and synthetic cell science. Here we introduce a modular platform for engineering synthetic RNA condensates from tailor-made, branched RNA nanostructures that fold and assemble co-transcriptionally. Up to three orthogonal condensates can form simultaneously and selectively accumulate fluorophores through embedded fluorescent light-up aptamers. The RNA condensates can be expressed within synthetic cells to produce membrane-less organelles with a controlled number and relative size, and showing the ability to capture proteins using selective protein-binding aptamers. The affinity between otherwise orthogonal nanostructures can be modulated by introducing dedicated linker constructs, enabling the production of bi-phasic RNA condensates with a prescribed degree of interphase mixing and diverse morphologies. The in situ expression of programmable RNA condensates could underpin the spatial organization of functionalities in both biological and synthetic cells.

Energy and its dissipation are fundamental to all living systems, including cells. Insufficient abundance of energy carriers─as caused by the additional burden of artificial genetic circuits─shifts a cell's priority to survival, also impairing the functionality of the genetic circuit. Moreover, recent works have shown the importance of energy expenditure in information transmission. Despite living organisms being non-equilibrium systems, non-equilibrium models capable of accounting for energy dissipation and non-equilibrium response curves are not yet employed in genetic design automation (GDA) software. To this end, we introduce Energy Aware Technology Mapping, the automated design of genetic logic circuits with respect to energy efficiency and functionality. The basis for this is an energy aware non-equilibrium steady state model of gene expression, capturing characteristics like energy dissipation─which we link to the entropy production rate─and transcriptional bursting, relevant to eukaryotes as well as prokaryotes. Our evaluation shows that a genetic logic circuit's functional performance and energy efficiency are disjoint optimization goals. For our benchmark, energy efficiency improves by 37.2% on average when comparing to functionally optimized variants. We discover a linear increase in energy expenditure and overall protein expression with the circuit size, where Energy Aware Technology Mapping allows for designing genetic logic circuits with the energetic costs of circuits that are one to two gates smaller. Structural variants improve this further, while results show the Pareto dominance among structures of a single Boolean function. By incorporating energy demand into the design, Energy Aware Technology Mapping enables energy efficiency by design. This extends current GDA tools and complements approaches coping with burden in vivo.

Living cells regulate the dynamics of developmental events through interconnected signaling systems that activate and deactivate inert precursors. This suggests that similarly, synthetic biomaterials could be designed to develop over time by using chemical reaction networks to regulate the availability of assembling components. Here we demonstrate how the sequential activation or deactivation of distinct DNA building blocks can be modularly coordinated to form distinct populations of self-assembling polymers using a transcriptional signaling cascade of synthetic genes. Our building blocks are DNA tiles that polymerize into nanotubes, and whose assembly can be controlled by RNA molecules produced by synthetic genes that target the tile interaction domains. To achieve different RNA production rates, we use a strategy based on promoter nicking and strand displacement. By changing the way the genes are cascaded and the RNA levels, we demonstrate that we can obtain spatially and temporally different outcomes in nanotube assembly, including random DNA polymers, block polymers, and as well as distinct autonomous formation and dissolution of distinct polymer populations. Our work demonstrates a way to construct autonomous supramolecular materials whose properties depend on the timing of molecular instructions for self-assembly, and can be immediately extended to a variety of other nucleic acid circuits and assemblies.

Synthetic biology primarily uses genetic engineering to control living cells. In contrast, recent work has ushered in the architectural engineering of living cells through intracellular materials. Specifically, Cyborg Bacteria are created by incorporating synthetic PEG-based hydrogel inside cells. Cyborg Bacteria do not replicate but maintain essential cellular functions, including metabolism and protein synthesis. Thus far, Cyborg Bacteria have been engineered using one primary composition of intracellular hydrogel components. Here, we demonstrate the versatility of controlling the physical and biochemical aspects of Cyborg Bacteria using different structures of hydrogels. The intracellular cell-gel architecture is modulated using a different photoinitiator, PEG-diacrylate (PEG-DA) of different molecular weights, 4arm PEG-DA, and dsDNA-PEG. We show that the molecular weight of the PEG-DA affects the generation and metabolism of Cyborg Bacteria. In addition, we show that the hybrid dsDNA-PEG intracellular hydrogel controls protein expression levels of the Cyborg Bacteria through post-transcriptional regulation and polymerase sequestration. Our work creates a new frontier of modulating intracellular gel components to control Cyborg Bacteria function and architecture.

The diversity of plant natural products presents a rich resource for accelerating drug discovery and addressing pressing human health issues. However, the challenges in accessing and cultivating source species, as well as metabolite structural complexity, and general low abundance present considerable hurdles in developing plant-derived therapeutics. Advances in high-throughput sequencing, genome assembly, gene synthesis, analytical technologies, and synthetic biology approaches, now enable us to efficiently identify and engineer enzymes and metabolic pathways for producing natural and new-to-nature therapeutics and drug candidates. This review highlights challenges and progress in plant natural product discovery and engineering by example of recent breakthroughs in identifying the missing enzymes involved in the biosynthesis of the anti-cancer agent Taxol®. These enzyme resources offer new avenues for the bio-manufacture and semi-synthesis of an old blockbuster drug.

Steroidal alkaloids are FDA-approved drugs (e.g., Zytiga) and promising drug candidates/leads (e.g., cyclopamine); yet many of the ≥697 known steroidal alkaloid natural products remain underutilized as drugs because it can be challenging to scale their biosynthesis in their producing organisms. Cyclopamine is a steroidal alkaloid produced by corn lily (Veratrum spp.) plants, and it is an inhibitor of the Hedgehog (Hh) signaling pathway. Therefore, cyclopamine is an important drug candidate/lead to treat human diseases that are associated with dysregulated Hh signaling, such as basal cell carcinoma and acute myeloid leukemia. Cyclopamine and its semi-synthetic derivatives have been studied in (pre)clinical trials as Hh inhibitor-based drugs. However, challenges in scaling the production of cyclopamine have slowed efforts to improve its efficacy and safety profile through (bio)synthetic derivatization, often limiting drug development to synthetic analogs of cyclopamine such as the FDA-approved drugs Odomzo, Daurismo, and Erivedge. If a platform for the scalable and sustainable production of cyclopamine were established, then its (bio)synthetic derivatization, clinical development, and, ultimately, widespread distribution could be accelerated. Ongoing efforts to achieve this goal include the biosynthesis of cyclopamine in Veratrum plant cell culture and the semi-/total chemical synthesis of cyclopamine. Herein, this work advances efforts towards a promising future approach: the biosynthesis of cyclopamine in engineered microorganisms. We completed the heterologous microbial production of verazine (biosynthetic precursor to cyclopamine) from simple sugars (i.e., glucose and galactose) in engineered Saccharomyces cerevisiae (S. cerevisiae) through the inducible upregulation of the native yeast mevalonate and lanosterol biosynthetic pathways, diversion of biosynthetic flux from ergosterol (i.e., native sterol in S. cerevisiae) to cholesterol (i.e., biosynthetic precursor to verazine), and expression of a refactored five-step verazine biosynthetic pathway. The engineered S. cerevisiae strain that produced verazine contains eight heterologous enzymes sourced from seven different species. Importantly, S. cerevisiae-produced verazine was indistinguishable via liquid chromatography-mass spectrometry from both a commercial standard (Veratrum spp. plant-produced) and Nicotiana benthamiana-produced verazine. To the best of our knowledge, this is the first report describing the heterologous production of a steroidal alkaloid in an engineered yeast. Verazine production was ultimately increased through design-build-test-learn cycles to a final titer of 83 ± 3 μg/L (4.1 ± 0.1 μg/g DCW). Together, this research lays the groundwork for future microbial biosynthesis of cyclopamine, (bio)synthetic derivatives of cyclopamine, and other steroidal alkaloid natural products.

Agricultural systems are under increasing pressure from declining environmental conditions, a growing population, and changes in consumer preferences, resulting in widespread malnutrition-related illnesses. Improving plant nutritional content through biotechnology techniques such as synthetic biology is a promising strategy to help combat hidden hunger caused by the lack of affordable and healthy foods in human diets. Production of compounds usually found in animal-rich diets, such as vitamin D or omega-3 fatty acids, has been recently demonstrated in planta. Here, we review recent biotechnological approaches to biofortifying plants with vitamins, minerals, and other metabolites, and summarise synthetic biology advances that offer the opportunity to build on these early biofortification efforts.

Transcription factors can promote gene expression through activation domains. Whole-genome screens have systematically mapped activation domains in transcription factors but not in non-transcription factor proteins (e.g., chromatin regulators and coactivators). To fill this knowledge gap, we employed the activation domain predictor PADDLE to analyze the proteomes of Arabidopsis thaliana and Saccharomyces cerevisiae. We screened 18,000 predicted activation domains from >800 non-transcription factor genes in both species, confirming that 89% of candidate proteins contain active fragments. Our work enables the annotation of hundreds of nuclear proteins as putative coactivators, many of which have never been ascribed any function in plants. Analysis of peptide sequence compositions reveals how the distribution of key amino acids dictates activity. Finally, we validated short, "universal" activation domains with comparable performance to state-of-the-art activation domains used for genome engineering. Our approach enables the genome-wide discovery and annotation of activation domains that can function across diverse eukaryotes.

Algae biotechnology holds immense promise for revolutionizing the bioeconomy through the sustainable and scalable production of various bioproducts. However, their development has been hindered by the lack of advanced genetic tools. This study introduces a synthetic biology approach to develop such tools, focusing on the construction and testing of synthetic promoters. By analyzing conserved DNA motifs within the promoter regions of highly expressed genes across six different algal species, we identified cis-regulatory elements (CREs) associated with high transcriptional activity. Combining the algorithms POWRS, STREME, and PhyloGibbs, we predicted 1511 CREs and inserted them into a minimal synthetic promoter sequence in 1, 2, or 3 copies, resulting in 4533 distinct synthetic promoters. These promoters were evaluated in vivo for their capacity to drive the expression of a transgene in a high-throughput manner through next-generation sequencing post antibiotic selection and fluorescence-activated cell sorting. To validate our approach, we sequenced hundreds of transgenic lines showing high levels of GFP expression. Further, we individually tested 14 identified promoters, revealing substantial increases in GFP expression─up to nine times higher than the baseline synthetic promoter, with five matching or even surpassing the performance of the native AR1 promoter. As a result of this study, we identified a catalog of CREs that can now be used to build superior synthetic algal promoters. More importantly, here we present a validated pipeline to generate building blocks for innovative synthetic genetic tools applicable to any algal species with a sequenced genome and transcriptome data set.

Advancements in synthetic biology have facilitated the incorporation of heterologous metabolic pathways into various bacterial chassis, leading to the synthesis of targeted bioproducts. However, total output from heterologous production pathways can suffer from low flux, enzyme promiscuity, formation of toxic intermediates, or intermediate loss to competing reactions, which ultimately hinder their full potential. The self-assembling, easy-to-modify, protein-based bacterial microcompartments (BMCs) offer a sophisticated way to overcome these obstacles by acting as an autonomous catalytic module decoupled from the cell's regulatory and metabolic networks. More than a decade of fundamental research on various types of BMCs, particularly structural studies of shells and their self-assembly, the recruitment of enzymes to BMC shell scaffolds, and the involvement of ancillary proteins such as transporters, regulators, and activating enzymes in the integration of BMCs into the cell's metabolism, has significantly moved the field forward. These advances have enabled bioengineers to design synthetic multi-enzyme BMCs to promote ethanol or hydrogen production, increase cellular polyphosphate levels, and convert glycerol to propanediol or formate to pyruvate. These pioneering efforts demonstrate the enormous potential of synthetic BMCs to encapsulate non-native multi-enzyme biochemical pathways for the synthesis of high-value products.

Synthetic biology constitutes a scientific domain focused on intentional redesign of organisms to confer novel functionalities or create new products through strategic engineering of their genetic makeup. Leveraging the inherent capabilities of nature, one may address challenges across diverse sectors including medicine. Inspired by this concept, we have developed an innovative bioengineering platform, enabling high-yield and large-scale production of biological small interfering RNA (BioRNA/siRNA) agents via bacterial fermentation. Herein, we show that with the use of a new tRNA fused pre-miRNA carrier, we can produce various forms of BioRNA/siRNA agents within living host cells. We report a high-level overexpression of nine target BioRNA/siRNA molecules at 100% success rate, yielding 3-10 mg of BioRNA/siRNA per 0.25 L of bacterial culture with high purity (>98%) and low endotoxin (

Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5 and 3 regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5: GTTAACTTCA) and Syn3-10b-2 (3: GGGCCTGTGG). These promoters activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5 sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3 sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter.

The field of Artificial Life studies the nature of the living state by modeling and synthesizing living systems. Such systems, under certain conditions, may come to deserve moral consideration similar to that given to nonhuman vertebrates or even human beings. The fact that these systems are nonhuman and evolve in a potentially radically different substrate should not be seen as an insurmountable obstacle to their potentially having rights, if they are sufficiently sophisticated in other respects. Nor should the fact that they owe their existence to us be seen as reducing their status as targets of moral concern. On the contrary, creators of Artificial Life may have special obligations to their creations, resembling those of an owner to their pet or a parent to their child. For a field that aims to create artificial life-forms with increasing levels of sophistication, it is crucial to consider the possible ethical implications of our activities, with an eye toward assessing potential moral obligations for which we should be prepared. If Artificial Life is larger than life, then the ethics of artificial beings should be larger than human ethics.

Ribosomally synthesized and post-translationally modified peptides (RiPPs) represent a significant potential for novel therapeutic applications because of their bioactive properties, stability, and specificity. RiPPs are synthesized on ribosomes, followed by intricate post-translational modifications (PTMs), crucial for their diverse structures and functions. PTMs, such as cyclization, methylation, and proteolysis, play crucial roles in enhancing RiPP stability and bioactivity. Advances in synthetic biology and bioinformatics have significantly advanced the field, introducing new methods for RiPP production and engineering. These methods encompass strategies for heterologous expression, genetic refactoring, and exploiting the substrate tolerance of tailoring enzymes to create novel RiPP analogs with improved or entirely new functions. Furthermore, the introduction and implementation of cutting-edge screening methods, including mRNA display, surface display, and two-hybrid systems, have expedited the identification of RiPPs with significant pharmaceutical potential. This comprehensive review not only discusses the current advancements in RiPP research but also the promising opportunities that leveraging these bioactive peptides for therapeutic applications presents, illustrating the synergy between traditional biochemistry and contemporary synthetic biology and genetic engineering approaches.

Machine learning applied to large compendia of transcriptomic data has enabled the decomposition of bacterial transcriptomes to identify independently modulated sets of genes, such iModulons represent specific cellular functions. The identification of iModulons enables accurate identification of genes necessary and sufficient for cross-species transfer of cellular functions. We demonstrate cross-species transfer of: 1) the biotransformation of vanillate to protocatechuate, 2) a malonate catabolic pathway, 3) a catabolic pathway for 2,3-butanediol, and 4) an antimicrobial resistance to ampicillin found in multiple Pseudomonas species to Escherichia coli. iModulon-based engineering is a transformative strategy as it includes all genes comprising the transferred cellular function, including genes without functional annotation. Adaptive laboratory evolution was deployed to optimize the cellular function transferred, revealing mutations in the host. Combining big data analytics and laboratory evolution thus enhances the level of understanding of systems biology, and synthetic biology for strain design and development.

Synthetic biology dictates the data-driven engineering of biocatalysis, cellular functions, and organism behavior. Integral to synthetic biology is the aspiration to efficiently find, access, interoperate, and reuse high-quality data on genotype-phenotype relationships of native and engineered biosystems under FAIR principles, and from this facilitate forward-engineering strategies. However, biology is complex at the regulatory level, and noisy at the operational level, thus necessitating systematic and diligent data handling at all levels of the design, build, and test phases in order to maximize learning in the iterative design-build-test-learn engineering cycle. To enable user-friendly simulation, organization, and guidance for the engineering of biosystems, we have developed an open-source python-based computer-aided design and analysis platform operating under a literate programming user-interface hosted on Github. The platform is called teemi and is fully compliant with FAIR principles. In this study we apply teemi for i) designing and simulating bioengineering, ii) integrating and analyzing multivariate datasets, and iii) machine-learning for predictive engineering of metabolic pathway designs for production of a key precursor to medicinal alkaloids in yeast. The teemi platform is publicly available at PyPi and GitHub.

An emerging cellular engineering method creates synthetic polymer matrices inside cells. By contrast with classical genetic, enzymatic, or radioactive techniques, this materials-based approach introduces non-natural polymers inside cells, thus modifying cellular states and functionalities. Here, we cover various materials and chemistries that have been exploited to create intracellular polymer matrices. In addition, we discuss emergent cellular properties due to the intracellular polymerization, including nonreplicating but active metabolism, maintenance of membrane integrity, and resistance to environmental stressors. We also discuss past work and future opportunities for developing and applying synthetic cells that contain intracellular polymers. The materials-based approach will usher in new applications of synthetic cells for broad biotechnological applications.

UNLABELLED: Diazotrophic bacteria can reduce atmospheric nitrogen into ammonia enabling bioavailability of the essential element. Many diazotrophs closely associate with plant roots increasing nitrogen availability, acting as plant growth promoters. These associations have the potential to reduce the need for costly synthetic fertilizers if they could be engineered for agricultural applications. However, despite the importance of diazotrophic bacteria, genetic tools are poorly developed in a limited number of species, in turn narrowing the crops and root microbiomes that can be targeted. Here, we report optimized protocols and plasmids to manipulate phylogenetically diverse diazotrophs with the goal of enabling synthetic biology and genetic engineering. Three broad-host-range plasmids can be used across multiple diazotrophs, with the identification of one specific plasmid (containing origin of replication RK2 and a kanamycin resistance marker) showing the highest degree of compatibility across bacteria tested. We then demonstrated modular expression by testing seven promoters and eleven ribosomal binding sites using proxy fluorescent proteins. Finally, we tested four small molecule inducible systems to report expression in three diazotrophs and demonstrated genome editing in Klebsiella michiganensis M5al. ONE-SENTENCE SUMMARY: In this study, broad-host plasmids and synthetic genetic parts were leveraged to enable expression tools in a library of diazotrophic bacteria.

Mosquito-borne illnesses represent a significant global health peril, resulting in approximately one million fatalities annually. West Nile, dengue, Zika, and malaria are continuously expanding their global reach, driven by factors that escalate mosquito populations and pathogen transmission. Innovative control measures are imperative to combat these catastrophic ailments. Conventional approaches, such as eliminating breeding sites and using insecticides, have been helpful, but they face challenges such as insecticide resistance and environmental harm. Given the mounting severity of mosquito-borne diseases, there is promise in exploring innovative approaches using synthetic biology to bolster mosquitoes' resistance to pathogens, or even eliminate the mosquito vectors, as a means of control. This review outlines current strategies, future goals, and the importance of gene editing for global health defenses against mosquito-borne diseases.

Filamentous fungi are critical in the transition to a more sustainable food system. While genetic modification of these organisms has promise for enhancing the nutritional value, sensory appeal, and scalability of fungal foods, genetic tools and demonstrated use cases for bioengineered food production by edible strains are lacking. Here, we develop a modular synthetic biology toolkit for Aspergillus oryzae, an edible fungus used in fermented foods, protein production, and meat alternatives. Our toolkit includes a CRISPR-Cas9 method for gene integration, neutral loci, and tunable promoters. We use these tools to elevate intracellular levels of the nutraceutical ergothioneine and the flavor-and color molecule heme in the edible biomass. The strain overproducing heme is red in color and is readily formulated into imitation meat patties with minimal processing. These findings highlight the promise of synthetic biology to enhance fungal foods and provide useful genetic tools for applications in food production and beyond.

Over the past two decades Biomedical Engineering has emerged as a major discipline that bridges societal needs of human health care with the development of novel technologies. Every medical institution is now equipped at varying degrees of sophistication with the ability to monitor human health in both non-invasive and invasive modes. The multiple scales at which human physiology can be interrogated provide a profound perspective on health and disease. We are at the nexus of creating avatars (herein defined as an extension of digital twins) of human patho/physiology to serve as paradigms for interrogation and potential intervention. Motivated by the emergence of these new capabilities, the IEEE Engineering in Medicine and Biology Society, the Departments of Biomedical Engineering at Johns Hopkins University and Bioengineering at University of California at San Diego sponsored an interdisciplinary workshop to define the grand challenges that face biomedical engineering and the mechanisms to address these challenges. The Workshop identified five grand challenges with cross-cutting themes and provided a roadmap for new technologies, identified new training needs, and defined the types of interdisciplinary teams needed for addressing these challenges. The themes presented in this paper include: 1) accumedicine through creation of avatars of cells, tissues, organs and whole human; 2) development of smart and responsive devices for human function augmentation; 3) exocortical technologies to understand brain function and treat neuropathologies; 4) the development of approaches to harness the human immune system for health and wellness; and 5) new strategies to engineer genomes and cells.

Summary: The manipulation of multiple transcription units for simultaneous and coordinated expression is not only key to building complex genetic circuits to accomplish diverse functions in synthetic biology, but is also important in crop breeding for significantly improved productivity and overall performance. However, building constructs with multiple independent transcription units for fine‐tuned and coordinated regulation is complicated and time‐consuming. Here, we introduce the Multiplex Expression Cassette Assembly (MECA) method, which modifies canonical vectors compatible with Golden Gate Assembly, and then uses them to produce multi‐cassette constructs. By embedding the junction syntax in primers that are used to amplify functional elements, MECA is able to make complex constructs using only one intermediate vector and one destination vector via two rounds of one‐pot Golden Gate assembly reactions, without the need for dedicated vectors and a coherent library of standardized modules. As a proof‐of‐concept, we modified eukaryotic and prokaryotic expression vectors to generate constructs for transient expression of green fluorescent protein and β‐glucuronidase in Nicotiana benthamiana, genome editing to block monoterpene metabolism in tomato glandular trichomes, production of betanin in tobacco and synthesis of β‐carotene in Escherichia coli. Additionally, we engineered the stable production of thymol and carvacrol, bioactive compounds from Lamiaceae family plants, in glandular trichomes of tobacco. These results demonstrate that MECA is a flexible, efficient and versatile method for building complex genetic circuits, which will not only play a critical role in plant synthetic biology, but also facilitate improving agronomic traits and pyramiding traits for the development of next‐generation elite crops. [ABSTRACT FROM AUTHOR]

Multidrug-resistant infections are becoming increasingly prevalent worldwide. One of the fastest-emerging alternative and adjuvant therapies being proposed is phage therapy. Naturally isolated phages are used in the vast majority of phage therapy treatments today. Engineered phages are being developed to enhance the effectiveness of phage therapy, but concerns over their potential escape remain a salient issue. To address this problem, we designed a biocontained phage system based on conditional replication using amber stop codon suppression. This system can be easily installed on any natural phage with a known genome sequence. To test the system, we individually mutated the start codons of three essential capsid genes in phage φX174 to the amber stop codon (UAG). These phages were able to efficiently infect host cells expressing the amber initiator tRNA, which suppresses the amber stop codon and initiates translation at TAG stop codons. The amber phage mutants were also able to successfully infect host cells and reduce their population on solid agar and liquid culture but could not produce infectious particles in the absence of the amber initiator tRNA or complementing capsid gene. We did not detect any growth-inhibiting effects on E. coli strains known to lack a receptor for φX174 and we showed that engineered phages have a limited propensity for reversion. The approach outlined here may be useful to control engineered phage replication in both the lab and clinic. [ABSTRACT FROM AUTHOR]

Malaria control has been one of the defining goals in global health. Recently, strategies that aim to control the insect-borne disease by altering mosquito biology have gained interest. One such strategy currently in development is to engineer mosquitoes equipped with so-called gene drives: elements that increase the likelihood of a specific set of genes to be passed on to the next generation. The strategy encapsulates hopes of technological solutions in global health, as well as expectations for the applications of synthetic biology. Hence, gene drive research operates with the potential of genetically modified mosquitoes: to survive in the wild, to reproduce, and to perform the work expected of them in some future timeline. I examine gene drive research with the concept of potentiality and how establishing it has guided gene drive research. Knowledge and uncertainties about mosquitoes and mosquito ecologies emerged through working with the mosquito as a research animal in the laboratory, as population data, and as a regulatable biotechnology. Mathematical modelling made it possible to establish the potential to move from the lab to the wild. In modelling, the mosquito as a research object could be made to work as part of future projections that assembled different kinds of data. As gene drive research progresses, I suggest that the researchers are also modelling how biotechnology handles uncertainty that is related to the ways producing genetic modification in the lab and producing knowledge about their possible environmental effects and efficacy translates into landscapes and mosquito ecologies in the wild. [ABSTRACT FROM AUTHOR]

β-ionone, an apocarotenoid derived from a C40 terpenoid has an intense, woody smell and a low odor threshold that has been widely used in as an ingredient in food and cosmetics. Yarrowia lipolytica is a promising host for β-ionone production because of its oleaginous nature, its ability to produce high levels of acetyl-CoA (an important precursor for terpenoids), and the availability of synthetic biology tools to engineer the organism. In this study, β-carotene-producing Y. lipolytica strain XK17 was employed for β-ionone biosynthesis. First, we explored the effect of different sources of carotenoid cleavage dioxygenase (CCD) genes on β-ionone production. A high-yielding strain rUinO-D14 with 122 mg/L of β-ionone was obtained by screening promoters combined with rDNA mediated multi-round iterative transformations to optimize the expression of the CCD gene of Osmanthus fragrans. Second, to further develop a high-level production strain for β-ionone, we optimized key genes in the mevalonate pathway by multi-round iterative transformations mediated by non-homologous end joining, combined with a protein tagging strategy. Finally, the introduction of a heterologous oxidoreductase pathway enabled the engineered Y. lipolytica strain to use xylose as a sole carbon source and produce β-ionone. In addition, the potential for use of lignocellulosic hydrolysate as the carbon source for β-ionone production showed that the NHA-A31 strain had a high β-ionone productivity level. This study demonstrates that engineered Y. lipolytica can be used for the efficient, green and sustainable production of β-ionone. [ABSTRACT FROM AUTHOR]

Harnessing DNA as a high‐density storage medium for information storage and molecular recording of signals has been of increasing interest in the biotechnology field. Recently, progress in enzymatic DNA synthesis, DNA digital data storage, and DNA‐based molecular recording has been made by leveraging the activity of the template‐independent DNA polymerase, terminal deoxynucleotidyl transferase (TdT). TdT adds deoxyribonucleotides to the 3′ end of single‐stranded DNA, generating random sequences of single‐stranded DNA. TdT can use several divalent cations for its enzymatic activity and exhibits shifts in deoxyribonucleotide incorporation frequencies in response to changes in its reaction environment. However, there is limited understanding of sequence‐structure‐function relationships regarding these properties, which in turn limits our ability to modulate TdT to further advance TdT‐based tools. Most TdT literature to‐date explores the activity of murine, bovine or human TdTs; studies probing TdT sequence and structure largely focus on strictly conserved residues that are functionally critical to TdT activity. Here, we explore non‐conserved TdT sequence space by surveying the natural diversity of TdT. We characterize a diverse set of TdT homologs from different organisms and identify several TdT residues/regions that confer differences in TdT behavior between homologs. The observations in this study can design rules for targeted TdT libraries, in tandem with a screening assay, to modulate TdT properties. Moreover, the data can be useful in guiding further studies of potential residues of interest. Overall, we characterize TdTs that have not been previously studied in the literature, and we provide new insights into TdT sequence‐function relationships. [ABSTRACT FROM AUTHOR]

Photodynamic therapy (PDT) has been used clinically to treat superficial tumors for decades. However, its effectiveness against deep‐seated tumors has been limited by the inefficient delivery of the key components ‐light, photosensitizer, and oxygen‐ required for the photochemical reactions in PDT. Here, we present a novel platform that enables the photochemical reaction to occur in a self‐driven manner, eliminating the need for external delivery of these components and instead orchestrating their endogenous generation within tumors. This was achieved by genetically modifying probiotic Escherichia coli to host three modules ‐ Lux, Hem1, and KatG ‐ responsible for light production, photosensitizer biosynthesis, and oxygen generation, respectively. The system is self‐driven, relying solely on substrates within E. coli cells and tumors. The modules exhibited prolonged activity for days within in vivo mouse models, enabling metronomic PDT that induced an immune response. This research holds promise for revolutionizing PDT and overcoming the enduring challenges encountered in its application for treating deep‐seated tumors. [ABSTRACT FROM AUTHOR]

Terpenoids are valued chemicals in the pharmaceutical, biotechnological, cosmetic, and biomedical industries. Biosynthesis of these chemicals relies on polymerization of Isopentenyl di-phosphate (IPP) and/or dimethylallyl diphosphate (DMAPP) monomers, which plants synthesize using a cytosolic mevalonic acid (MVA) pathway and a plastidic methyleritritol-4-phosphate (MEP) pathway. Circadian regulation affects MVA and MEP pathway activity at three levels: substrate availability, gene expression of pathway enzymes, and utilization of IPP and DMAPP for synthesizing complex terpenoids. There is a gap in understanding the interplay between the circadian rhythm and the dynamics and regulation of the two pathways. In this paper we create a mathematical model of the MVA and MEP pathways in plants that incorporates the effects of circadian rhythms. We then used the model to investigate how annual and latitudinal variations in circadian rhythm affect IPP and DMAPP biosynthesis. We found that, despite significant fluctuations in daylight hours, the amplitude of oscillations in IPP and DMAPP concentrations remains stable, highlighting the robustness of the system. We also examined the impact of removing circadian regulation from different parts of the model on its dynamic behavior. We found that regulation of pathway substrate availability alone results in higher sensitivity to daylight changes, while gene expression regulation alone leads to less robust IPP/DMAPP concentration oscillations. Our results suggest that the combined circadian regulation of substrate availability, gene expression, and product utilization, along with MVA- and MEP-specific regulatory loops, create an optimal operating regime. This regime maintains pathway flux closely coupled to demand and stable across a wide range of daylight hours, balancing the dynamic behavior of the pathways and ensuring robustness in response to cellular demand for IPP/DMAPP. [ABSTRACT FROM AUTHOR]

ABSTRACT Plants have mechanisms to transport secondary metabolites from where they are biosynthesized to the sites where they function, or to sites such as the vacuole for detoxification. However, current research has mainly focused on metabolite biosynthesis and regulation, and little is known about their transport. Tanshinone, a class diterpenoid with medicinal properties, is biosynthesized in the periderm of Salvia miltiorrhiza roots. Here, we discovered that tanshinone can be transported out of peridermal cells and secreted into the soil environment and that the ABC transporter SmABCG1 is involved in the efflux of tanshinone ⅡA and tanshinone Ⅰ. The SmABCG1 gene is adjacent to the diterpene biosynthesis gene cluster in the S. miltiorrhiza genome. The temporal–spatial expression pattern of SmABCG1 is consistent with tanshinone accumulation profiles. SmABCG1 is located on the plasma membrane and preferentially accumulates in the peridermal cells of S. miltiorrhiza roots. Heterologous expression in Xenopus laevis oocytes demonstrated that SmABCG1 can export tanshinone ⅡA and tanshinone Ⅰ. CRISPR/Cas9‐mediated mutagenesis of SmABCG1 in S. miltiorrhiza hairy roots resulted in a significant decrease in tanshinone contents in both hairy roots and the culture medium, whereas overexpression of this gene resulted in increased tanshinone contents. CYP76AH3 transcript levels increased in hairy roots overexpressing SmABCG1 and decreased in knockout lines, suggesting that SmABCG1 may affect the expression of CYP76AH3, indirectly regulating tanshinone biosynthesis. Finally, tanshinone ⅡA showed cytotoxicity to Arabidopsis roots. These findings offer new perspectives on plant diterpenoid transport and provide a new genetic tool for metabolic engineering and synthetic biology research. [ABSTRACT FROM AUTHOR]

Coacervate microdroplets, arising from liquid–liquid phase separation, have emerged as promising models for primary cells, demonstrating the ability to regulate biomolecular enrichment, create chemical gradients, accelerate confined reactions, and even express proteins. Notably, multiphase coacervation provides a robust framework to replicate hierarchically complex cellular structures, offering valuable insights into cellular organization and function. In this review, we explore the recent advancements in the study of multiphase coacervates, focusing on design strategies, underlying mechanisms, structural control, and their applications in biomimetics. These developments highlight the potential of multiphase coacervates as powerful tools in the field of synthetic biology and material science. [ABSTRACT FROM AUTHOR]

Natural protein–protein communications, such as those between transcription factors (TFs) and RNA polymerases/ribosomes, underpin cell‐free biosensing systems operating on the transcription/translation (TXTL) paradigm. However, their deployment in field analysis is hampered by the delayed response (hour‐level) and the complex composition of in vitro TXTL systems. For this purpose, we present a de novo‐designed ligand‐responsive artificial protein–protein communication (LIRAC) by redefining the connection between TFs and non‐interacting CRISPR/Cas enzymes. By rationally designing a chimeric DNA adaptor and precisely regulating its binding affinities to both proteins, LIRAC immediately transduces target‐induced TF allostery into rapid CRISPR/Cas enzyme activation within a homogeneous system. Consequently, LIRAC obviates the need for RNA/protein biosynthesis inherent to conventional TXTL‐based cell‐free systems, substantially reducing reaction complexity and time (from hours to 10 minutes) with improved sensitivity and tunable dynamic range. Moreover, LIRAC exhibits excellent versatility and programmability for rapidly and sensitively detecting diverse contaminants, including antibiotics, heavy metal ions, and preservatives. It also enables the creation of a multi‐protein communication‐based tristate logic for the intelligent detection of multiple contaminants. Integrated with portable devices, LIRAC has been proven effective in the field analysis of environmental samples and personal care products, showcasing its potential for environmental and health monitoring. [ABSTRACT FROM AUTHOR]

Zellen benutzen transiente, membranlose Organellen um biologische Reaktionsnetzwerke zu regulieren. Stressgranula zum Beispiel sind in der Lage, selektiv mRNA einzulagern, um die Proteinexpression im Fall von Hitze oder oxidativem Stress zu regulieren. Modelle welches diese aktive Verhalten nachstellen sind nützlich um die in vivo Regulierung durch Kompartimentierung besser zu verstehen. Hier benutzen wir aktive komplexe Koazervat‐Tröpfchen als Modell für membranlose Organellen, welche die Aktivität einer katalytischen DNA (DNAzym) räumlich und zeitlich kontrollieren können. Beim Eintritt in die Peptid‐RNA‐Tröpfchen entfaltet sich das DNAzym und verliert seine Fähigkeit, einen Nukleinsäurestrang zu spalten. Wir können die DNAzym Aktivität vorübergehend pausieren, indem wir die Tröpfchenbildung mit einem Treibstoff induzieren. Nach dem Verbrauch des Treibstoffs beginnt die Aktivität des DNAzym wieder von selbst. Wir können uns vorstellen, dass dieses System zur Hoch‐ und Herunterregulierung mehrere Reaktionen in einem Netzwerk benutzt werden könnte, was zu einem besseren Verständnis der Komplexität von zellulären Reaktionswegen führen würde. Mit einem Netzwerk, in welchem das DNAzym reziprok die Eigenschaften des Tröpfchens regulieren kann, hätten wir ein vielversprechendes Instrument für die Konstruktion von synthetischen Zellen. [ABSTRACT FROM AUTHOR]

Cells use transient membraneless organelles to regulate biological reaction networks. For example, stress granules selectively store mRNA to downregulate protein expression in response to heat or oxidative stress. Models mimicking this active behavior should be established to better understand in vivo regulation involving compartmentalization. Here we use active, complex coacervate droplets as a model for membraneless organelles to spatiotemporally control the activity of a catalytic DNA (DNAzyme). Upon partitioning into these peptide‐RNA droplets, the DNAzyme unfolds and loses its ability to catalyze the cleavage of a nucleic acid strand. We can transiently pause the DNAzyme activity upon inducing droplet formation with fuel. After fuel consumption, the DNAzyme activity autonomously restarts. We envision this system could be used to up and downregulate multiple reactions in a network, helping understand the complexity of a cell's pathways. By creating a network where the DNAzyme could reciprocally regulate the droplet properties, we would have a powerful tool for engineering synthetic cells. [ABSTRACT FROM AUTHOR]

Morphogens, locally produced signaling molecules, form a concentration gradient to guide tissue patterning. Tissue patterns emerge as a collaboration between morphogen diffusion and responsive cell behaviors, but the mechanisms through which diffusing morphogens define precise spatial patterns amidst biological fluctuations remain unclear. To investigate how cells respond to diffusing proteins to generate tissue patterns, we develop SYMPLE3D, a 3D culture platform. By engineering gene expression responsive to artificial morphogens, we observe that coupling morphogen signals with cadherin-based adhesion is sufficient to convert a morphogen gradient into distinct tissue domains. Morphogen-induced cadherins gather activated cells into a single domain, removing ectopically activated cells. In addition, we reveal a switch-like induction of cadherin-mediated compaction and cell mixing, homogenizing activated cells within the morphogen gradient to form a uniformly activated domain with a sharp boundary. These findings highlight the cooperation between morphogen gradients and cell adhesion in robust tissue patterning and introduce a novel method for tissue engineering to develop new tissue domains in organoids. Synopsis: A synthetic biology approach termed SYMPLE3D demonstrates that cell adhesion output in response to diffusible proteins can convert a signaling gradient into binarized tissue domains with a sharp boundary. The SYMPLE3D system allows to explore which cellular responses to secreted proteins can robustly generate multicellular patterns. Interlocking of morphogen gradient and cadherin induces a robust pattern of distinct tissue domains with a sharp boundary. Morphogen-induced cadherin gathers receiver cells to remove ectopically-activated cells within a signaling gradient. A switch-like property of cadherin function causes cell mixing inside a morphogen gradient, generating a uniformly-activated tissue domain. A synthetic biology approach termed SYMPLE3D demonstrates that cell adhesion output in response to diffusible proteins can convert a signaling gradient into binarized tissue domains with a sharp boundary. [ABSTRACT FROM AUTHOR]

An increasing population, climate change, and diminishing natural resources present severe threats to global food security, with traditional breeding and genetic engineering methods often falling short in addressing these rapidly evolving challenges. CRISPR/Cas systems have emerged as revolutionary tools for precise genetic modifications in crops, offering significant advancements in resilience, yield, and nutritional value, particularly in staple crops like rice and maize. This review highlights the transformative potential of CRISPR/Cas technology, emphasizing recent innovations such as prime and base editing, and the development of novel CRISPR-associated proteins, which have significantly improved the specificity, efficiency, and scope of genome editing in agriculture. These advancements enable targeted genetic modifications that enhance tolerance to abiotic stresses as well as biotic stresses. Additionally, CRISPR/Cas plays a crucial role in improving crop yield and quality by enhancing photosynthetic efficiency, nutrient uptake, and resistance to lodging, while also improving taste, texture, shelf life, and nutritional content through biofortification. Despite challenges such as off-target effects, the need for more efficient delivery methods, and ethical and regulatory concerns, the review underscores the importance of CRISPR/Cas in addressing global food security and sustainability challenges. It calls for continued research and integration of CRISPR with other emerging technologies like nanotechnology, synthetic biology, and machine learning to fully realize its potential in developing resilient, productive, and sustainable agricultural systems. [ABSTRACT FROM AUTHOR]

Introduction: Cancer is still a major challenge of human health. The abnormality of intracellular cancer-related signal pathways is an important mechanism for the occurrence of cancer. Methods: We used a molecular-senor to act on the endogenous signal molecules within the cell to redirect the abnormal signal flows in the cell to treat cancer. Based on CRISPR-dCas12f procedures, we combined aptamers and ribozymes to construct riboswitches, which served as molecular switches to reprogram sgRNAs, so that CRISPR-dCas12f redirected the intracellular anti-cancer signal flows after sensing specific input signal molecules. In addition, the activated molecular sensors and the inhibitory molecular sensors were constructed by combining transcription factors (VP64) and transcription inhibitors (KRAB) to specifically activate and inhibit target genes of interest. Results: Our experimental results showed that the molecular sensors that we designed and constructed specifically sensed the endogenous signal molecules and then redirect the cancer related signal networks of cancer cells. In addition, corresponding logic gates were constructed to distinguish cancer cells from normal cells and redirect anticancer signal flows to trigger specific cancer immunotherapy. Conclusion: The constructed molecular sensors constructed specifically recognized the signal molecules within the cell and redirected the endogenous signal pathway to reprogram the fate of cancer cells. [ABSTRACT FROM AUTHOR]

Vanilla flavour is widely used in various industries and is the most broadly used flavouring agent in the food industry. The demand for this flavour is, therefore, extremely high, yet vanilla bean extracts can only meet about 1% of the overall demand. Vanillin, the main constituent of vanilla flavour, can easily be obtained through chemical synthesis. Nonetheless, consumer demands for natural products and environmentally friendly industrial processes drive the development of biotechnological approaches for its production. Some microorganisms can naturally produce vanillin when fed with various substrates, including eugenol, isoeugenol, and ferulic acid. The characterisation of the genes and enzymes involved in these bioconversion pathways, as well as progress in the understanding of vanillin biosynthesis in Vanilla orchids, allowed the development of genetic engineering and synthetic biology approaches to increase vanillin production in naturally vanillin-producing microorganisms, or to implement novel vanillin biosynthetic pathways in microbial chassis. This review summarises and discusses these genetic engineering and synthetic biology approaches for the microbial production of vanillin. [ABSTRACT FROM AUTHOR]

The methylotrophic yeast Ogataea polymorpha shows potential in methanol biotransformation that is a promising approach for green biomanufacturing and carbon neutrality. The development of synthetic biology tools has facilitated the metabolic rewiring and production of various chemicals in O. polymorpha. Systems biology could help deepen our understanding of global metabolic systems and support the engineering of synthetic metabolic capabilities in O. polymorpha. Ogataea (Hansenula) polymorpha is a nonconventional yeast with some unique characteristics, including fast growth, thermostability, and broad substrate spectrum. Other than common applications for protein production, O. polymorpha is attracting interest for chemical and protein production from methanol; a promising feedstock for the next-generation biomanufacturing due to its abundant sources and excellent characteristics. Benefiting from the development of synthetic biology, it has been engineered to produce value-added chemicals by extensively rewiring cellular metabolism. This Review discusses recently developed synthetic biology tools of O. polymorpha. The advances of chemicals production and systems biology were reviewed comprehensively. Finally, we look ahead to the developments of biomanufacturing in O. polymorpha to make an overall understanding of this chassis for academia and industry. [ABSTRACT FROM AUTHOR]

Omega fatty acids are important for human health. They are traditionally extracted from animals or plants but can be alternatively produced using oleaginous yeast. Current efforts are producing yeast strains with similar fatty acid distributions and powerful lipogenesis capacity. The next step is to further make the process more competitive. [ABSTRACT FROM AUTHOR]

Microbial fermentation has provided fermented foods and important chemicals such as antibiotics, amino acids, and vitamins. Metabolic engineering of synthetic microbes has expanded the range of compounds produced by fermentation. Petroleum-derived aromatic compounds are widely used in industry as raw materials for pharmaceuticals, dyes, and polymers and are in great demand. This review highlights the current efforts in the microbial production of various aromatic chemicals such as aromatic amines, cinnamic acid derivatives, and flavoring aromatics, including their biosynthesis pathways. In addition, the unique biosynthetic mechanism of pyrazine, a heterocyclic compound, from amino acids is described to expand the use of biomass-derived aromatic compounds. I also discuss our efforts to develop high-performance bioplastics superior to petroleum plastics from the aromatic compounds produced by microbial fermentation. [ABSTRACT FROM AUTHOR]

Cellulases and xylanases are plant cell wall-degrading enzymes (CWDEs) that are critical to sustainable bioproduction based on renewable lignocellulosic biomass to reduce carbon dioxide emission. Currently, these enzymes are mainly produced from filamentous fungi, especially Trichoderma reesei and Penicillium oxalicum. However, an in-depth comparison of these two producers has not been performed. Although both P. oxalicum and T. reesei harbor CWDE systems, they exhibit distinct features regulating the production of these enzymes, mainly through different transcriptional regulatory networks. This review presents the strikingly different modes of genome-wide regulation of cellulase and xylanase biosynthesis in P. oxalicum and T. reesei, including sugar transporters, signal transduction cascades, transcription factors, chromatin remodeling, and three-dimensional organization of chromosomes. In addition, different molecular breeding approaches employed, based on the understanding of the regulatory networks, are summarized. This review highlights the existence of very different regulatory modes leading to the efficient regulation of CWDE production in filamentous fungi, akin to the adage that "every road leads to Rome." An understanding of this divergence may help further improvements in fungal enzyme production through the metabolic engineering and synthetic biology of certain fungal species. [ABSTRACT FROM AUTHOR]

In the past few years, synthetic biologists have established some biological elements and bioreactors composed of nucleotides under the guidance of engineering methods. Following the concept of engineering, the common bioreactor components in recent years are introduced and compared. At present, biosensors based on synthetic biology have been applied to water pollution monitoring, disease diagnosis, epidemiological monitoring, biochemical analysis and other detection fields. In this paper, the biosensor components based on synthetic bioreactors and reporters are reviewed. In addition, the applications of biosensors based on cell system and cell-free system in the detection of heavy metal ions, nucleic acid, antibiotics and other substances are presented. Finally, the bottlenecks faced by biosensors and the direction of optimization are also discussed. [ABSTRACT FROM AUTHOR]

Serine integrases are phage- (or mobile element-) encoded enzymes that catalyse site-specific recombination reactions between a short DNA sequence on the phage genome (attP) and a corresponding host genome sequence (attB), thereby integrating the phage DNA into the host genome. Each integrase has its unique pair of attP and attB sites, a feature that allows them to be used as orthogonal tools for genome modification applications. In the presence of a second protein, the Recombination Directionality Factor (RDF), integrase catalyses the reverse excisive reaction, generating new recombination sites, attR and attL. In addition to promoting attR x attL reaction, the RDF inhibits attP x attB recombination. This feature makes the directionality of integrase reactions programmable, allowing them to be useful for building synthetic biology devices. In this report, we describe the degree of orthogonality of both integrative and excisive reactions for three related integrases (ϕC31, ϕBT1, and TG1) and their RDFs. Among these, TG1 integrase is the most active, showing near complete recombination in both attP x attB and attR x attL reactions, and the most directional in the presence of its RDF. Our findings show that there is varying orthogonality among these three integrases – RDF pairs. ϕC31 integrase was the least selective, with all three RDFs activating it for attR x attL recombination. Similarly, ϕC31 RDF was the least effective among the three RDFs in promoting the excisive activities of the integrases, including its cognate ϕC31 integrase. ϕBT1 and TG1 RDFs were noticeably more effective than ϕC31 RDF at inhibiting attP x attB recombination by their respective integrases, making them more suitable for building reversible genetic switches. AlphaFold-Multimer predicts very similar structural interactions between each cognate integrase – RDF pair. The binding surface on the RDF is much more conserved than the binding surface on the integrase, an indication that specificity is determined more by the integrase than the RDF. Overall, the observed weak integrase/RDF orthogonality across the three enzymes emphasizes the need for identifying and characterizing more integrase – RDF pairs. Additionally, the ability of a particular integrase's preferred reaction direction to be controlled to varying degrees by non-cognate RDFs provides a path to tunable, non-binary genetic switches. [ABSTRACT FROM AUTHOR]

A dominant assumption in pharmacology throughout the 20th century has been that in vivo target occupancy—and attendant pharmacodynamics—depends on the systemic concentration of drug relative to the equilibrium dissociation constant for the drug–target complex. In turn, the duration of pharmacodynamics is temporally linked to the systemic pharmacokinetics of the drug. Yet, there are many examples of drugs for which pharmacodynamic effect endures long after the systemic concentration of a drug has waned to (equilibrium) insignificant levels. To reconcile such data, the drug–target residence time model was formulated, positing that it is the lifetime (or residence time) of the binary drug–target complex, and not its equilibrium affinity per se, that determines the extent and duration of drug pharmacodynamics. Here, we review this model, its evolution over time, and its applications to natural ligand‐macromolecule biology and synthetic drug–target pharmacology. [ABSTRACT FROM AUTHOR]

The flavonoid diosmin (diosmetin 7-O-rutinoside) is used as a therapeutic agent for disorders of the blood vessels such as hemorrhoids and varicose veins. Diosmin is commercially produced using semi-synthetic methods involving the oxidation of hesperidin, the most abundant flavonoid in citrus fruits. However, this method produces byproducts that are toxic to the environment, and new sustainable methods to produce diosmin are required. Here, we used a synthetic biology approach to produce diosmin without generating toxic byproducts through reconstitution of the diosmin biosynthetic pathway in Nicotiana benthamiana. We first established that N. benthamiana leaves co-infiltrated with all seven genes in the flavonoid biosynthesis pathway produced high levels of luteolin, a precursor of diosmetin. We then compared the activity of modification enzymes such as methyltransferases, glucosyltransferases, and rhamnosyltransferases in Escherichia coli and in planta and selected genes encoding enzymes with the highest activity for producing diosmetin, diosmetin 7-O-glucoside, and diosmin, respectively. Finally, we reconstructed the entire diosmin biosynthetic pathway using three constructs containing ten genes encoding enzymes in this pathway, from phenylalanine ammonia lyase to rhamnosyltransferase. N. benthamiana leaves transiently co-expressing all these genes yielded 37.7 µg diosmin per gram fresh weight. To our knowledge, this is the first report of diosmin production in a heterologous plant system without the supply of a precursor. Successful production of diosmin in N. benthamiana opens new avenues for producing other commercially important flavonoids using similar platforms. [ABSTRACT FROM AUTHOR]

Xylose is an abundant, inexpensive and readily available carbohydrate common in minimally processed feedstocks such as seaweed and algae. While a wide variety of marine microbes have evolved to utilize seaweed and algae, only a few currently have the requisite characteristics and genetic engineering tools necessary to entertain the use of these underutilized feedstocks. The rapidly growing Gram‐negative halophilic bacterium Vibrio natriegens is one such chassis. In this study, we engineered and tested xylose induction in V. natriegens as a tool for scalable bioproduction applications. First, we created a sensing construct based on the xylose operon from Escherichia coli MG1665 and measured its activity using a fluorescent reporter and identified that cellular import plays a key role in induction strength and that expression required the XylR transcription factor. Next, we identified that select deletions of the promoter region enhance gene expression, limiting the effect of carbohydrate repression when xylose is used as an inducer in the presence of industrially relevant carbon sources. Lastly, we used the optimized constructs to produce the biopolymer melanin using seawater mimetic media. One of these formulations utilized a nori‐based seaweed extract as an inducer and demonstrated melanin yields comparable to previously optimized methods using a more traditional and costly inducer. Together, the results demonstrate that engineering xylose induction in V. natriegens can provide an effective and lower cost option for timed biosynthesis in scalable biomanufacturing applications using renewable feedstocks. [ABSTRACT FROM AUTHOR]