Back to Search
Start Over
Luminescence of telomeric fragments of DNA macromolecule.
- Source :
-
Molecular Crystals & Liquid Crystals . 2016, Vol. 639 Issue 1, p151-159. 9p. - Publication Year :
- 2016
-
Abstract
- Optical absorption, fluorescence and phosphorescence spectra of the telomere fragment d(AGGGTTAGGGTTAGGGTTAGGG) (Tel22) were studied and compared with those of the native DNA. Main centers of optical absorption in telomeres are A, T and G nucleic bases and G-quadruplexes. The fluorescence of telomeres is associated mainly with G-bases and other long-wave centers, possibly G-quadruplex structures, whereas their phosphorescence is associated with AT-sequences as it takes place for the native DNA. A significant increase of phosphorescence-to-fluorescence intensity ratio was observed for Tel22 as compared to DNA. Results obtained are promising for the detection of DNA macromolecules containing the extended telomeric sequences. [ABSTRACT FROM AUTHOR]
Details
- Language :
- English
- ISSN :
- 15421406
- Volume :
- 639
- Issue :
- 1
- Database :
- Academic Search Index
- Journal :
- Molecular Crystals & Liquid Crystals
- Publication Type :
- Academic Journal
- Accession number :
- 120212402
- Full Text :
- https://doi.org/10.1080/15421406.2016.1255068