Back to Search
Start Over
First Report of Polymorphisms and Genetic Characteristics of Prion-like Protein Gene (PRND) in Cats.
- Source :
-
Animals (2076-2615) . Dec2024, Vol. 14 Issue 23, p3438. 16p. - Publication Year :
- 2024
-
Abstract
- Simple Summary: Cats are important subjects in the study of feline spongiform encephalopathy (FSE), but the genetic factors contributing to their susceptibility have yet to be identified. Since the prion-like protein gene (PRND) is known to play a significant role in prion disease susceptibility among the prion protein gene family, investigating the genetic characteristics of the PRND gene in cats is essential. In this study, we identified 13 novel genetic variations. Using in silico tools, we found that four non-synonymous single nucleotide polymorphisms (SNPs)—c.76G>A (A26T), c.97A>G (I33V), c.251A>G (Q84R), and c.469C>A (L157I)—have the potential to disrupt protein structure and function. Linkage analysis revealed strong associations between PRND SNPs c.97A>G and c.251A>G and the PRNP InDel c.214_240delCCCCACGCCGGCGGAGGCTGGGGTCAG (p.76_84delPHAGGGWGQ), suggesting a shared genetic influence on disease susceptibility. This is the first study to investigate the genetic characteristics of the PRND gene in cats, and this analysis is expected to provide valuable baseline data for future functional studies. Prion diseases are fatal neurodegenerative disorders caused by the misfolding of the normal cellular prion protein (PrPC) into its infectious isoform (PrPSc). Although prion diseases in humans, sheep, goats, and cattle have been extensively studied, feline spongiform encephalopathy (FSE) remains poorly understood. Genetic factors, particularly polymorphisms in the prion protein gene (PRNP) and prion-like protein gene (PRND), have been linked to prion disease susceptibility in various species. However, no studies have yet investigated the PRND gene in cats with respect to prion diseases. Therefore, we investigated polymorphisms in the feline PRND gene and analyzed their genetic characteristics. We sequenced the coding region of the PRND gene using samples from 210 domestic cats and determined the genotype and allele frequencies of PRND polymorphisms. We identified thirteen novel single nucleotide polymorphisms (SNPs), including six non-synonymous variants and one insertion/deletion (InDel) in the feline PRND gene. Four of the non-synonymous SNPs were predicted to have deleterious effects on the Doppel protein's structure and function. Notably, the SNP c.97A>G (I33V) showed potential structural clashes, and the others formed additional hydrogen bonds. The LD analysis revealed strong genetic associations between the PRND SNPs and the PRNP InDel, suggesting linkage between these loci in cats. This study identifies novel PRND polymorphisms in domestic cats and provides new insights into the genetic factors underlying feline susceptibility to prion diseases. The strong genetic linkage between PRND and PRNP polymorphisms, coupled with predictions of detrimental effects on Doppel protein structure, suggests that PRND gene variants could influence prion disease progression in cats. These findings provide a foundational framework for future studies on the functional implications of PRND polymorphisms in FSE. To the best of our knowledge, this study is the first report on the genetic characteristics of PRND polymorphisms in cats. [ABSTRACT FROM AUTHOR]
Details
- Language :
- English
- ISSN :
- 20762615
- Volume :
- 14
- Issue :
- 23
- Database :
- Academic Search Index
- Journal :
- Animals (2076-2615)
- Publication Type :
- Academic Journal
- Accession number :
- 181661213
- Full Text :
- https://doi.org/10.3390/ani14233438