Supplementary Figure 1 from Follicle-Stimulating Hormone Receptor as a Target in the Redirected T-cell Therapy for Cancer

The expression of 18S used as a internal control (housekeeper). cDNA was constructed from total RNA isolated from 10e5 cells (cultured at 60-70% confluence). PCR performed using intron-spanning primers. Validation criteria included water blanks, and NO RT samples. For human 18SrRNA 5’CAGCCACCCGAGATTGAGCA3’ and Rev: 5’TAGTAGCGACGGGCGGTGTG3’ (amplicon 253bp) (Genbank:: NR_003286.2). For mouse ID8 cell line Ribosomal RNA for mouse Eukaryotic small ribosomal subunit [Genbank: NR_003278] primers Fw: 5’AGGGGAGAGCGGGTAAGAGA-3’ and Rev: 5’GGACAGGACTAGGCGGAACA3’ were used (amplicon size of 249bp).