Back to Search Start Over

Genome-wide search of the genes tagged with the consensus of 33.6 repeat loci in buffalo Bubalus bubalis employing minisatellite-associated sequence amplification

Authors :
Deepali Pathak
Iqbal Parwez
Rana Samad
Sher Ali
Jyoti Srivastava
Sudhir Kumar
Source :
Chromosome research : an international journal on the molecular, supramolecular and evolutionary aspects of chromosome biology. 18(4)
Publication Year :
2010

Abstract

Minisatellites have been implicated with chromatin organization and gene regulation, but mRNA transcripts tagged with these elements have not been systematically characterized. The aim of the present study was to gain an insight into the transcribing genes associated with consensus of 33.6 repeat loci across the tissues in water buffalo, Bubalus bubalis. Using cDNA from spermatozoa and eight different somatic tissues and an oligo primer based on two units of consensus of 33.6 repeat loci (5′ CCTCCAGCCCTCCTCCAGCCCT 3′), we conducted minisatellite-associated sequence amplification (MASA) and identified 29 mRNA transcripts. These transcripts were cloned and sequenced. Blast search of the individual mRNA transcript revealed sequence homologies with various transcribing genes and contigs in the database. Using real-time PCR, we detected the highest expression of nine mRNA transcripts in spermatozoa and one each in liver and lung. Further, 21 transcripts were found to be conserved across the species; seven were specific to bovid whereas one was exclusive to the buffalo genome. The present work demonstrates innate potentials of MASA in accessing several functional genes simultaneously without screening the cDNA library. This approach may be exploited for the development of tissue-specific mRNA fingerprints in the context of genome analysis and functional and comparative genomics.

Details

ISSN :
15736849
Volume :
18
Issue :
4
Database :
OpenAIRE
Journal :
Chromosome research : an international journal on the molecular, supramolecular and evolutionary aspects of chromosome biology
Accession number :
edsair.doi.dedup.....ba066bd28457a3c4c98ea241be3f216b