Search

In order to achieve efficient and durable oil-water emulsion separation, the membranes possessing high separation efficiency and mechanical strength attract extensive attention and are in great demand. In present study, a kind of polytetrafluoroethylene (PTFE)-based bilayer membrane was fabricated by electrospinning fibrous PTFE (fPTFE) on an expanded PTFE (ePTFE) substrate. The morphological observation revealed that the fibrous structure of the fPTFE layer could be tailored by controlling the formulation of spinning solution. The addition of appropriate polyoxyethylene (PEO) would make the fibers in the fPTFE layer finer and more uniform. As a result, the compounded membrane exhibited a small pore size of approximately 1.25 µm and a substantial porosity nearing 80%. This led to super-hydrophobicity, characterized by a high water contact angle (WCA) of 149.8°, and facilitated rapid oil permeation. The water-in-oil emulsion separation experiment further confirmed that the compounded membrane not only had a high separation efficiency closing 100%, but such an outstanding separation capacity could be largely retained, either through multiple cycles of use or through strong acid (pH=1), strong alkali (pH=12), or high-temperature (100 °C) treatment. Additionally, the mechanical behavior of the bilayer membrane was basically contributed by that of each layer in terms of their volume ratio. More significantly, the poor creep resistance of fPTFE layer was suppressed by compounding with ePTFE substrate. Hence, this study has laid the groundwork for a novel approach to create PTFE-based compounded membranes with exceptional overall characteristics, showing promise for applications in the realm of emulsion separation. [ABSTRACT FROM AUTHOR]

To investigate the flow characteristics in front chamber and rear chamber in pump mode and pump as turbine mode, a 3D computational model of a centrifugal pump was established, including the front and rear chamber. Based on Realizable k-ε turbulence model, numerical calculations of incompressible flow were carried out for internal viscous flow in two operating modes. Further analysis was conducted on the flow stability and hydraulic losses under two modes using energy gradient theory and entropy production theory. The numerical simulation results are within reasonable error compared to the experimental results in pump operation mode, which ensures the reliability of the numerical calculation method. The results indicate that the volumetric efficiency in both two modes is on an upward trend with increasing flow, but the volumetric efficiency of the pump mode is more significantly affected by changes in flow; the distribution patterns of dimensionless circumferential velocity and dimensionless radial velocity in the front and rear chambers under two operating modes are similar, but the distribution pattern of dimensionless radial velocity in the front chamber in turbine mode is significantly different from other operating conditions; flow instability is most likely to occur at the outlet of impeller, and the energy loss in clearance of wear-rings is greater than that in the pump chamber. [ABSTRACT FROM AUTHOR]

Using the unsteady Bernoulli equation for the piping system and the angular momentum equation for the rotor, derives here a theoretical model to predict the startup performance of a pump as turbine (PAT). This model is effective for predicting the instantaneous evolution characteristics of the main performance parameters of PAT during startup, and these changings are initially faster and then slowly as a whole. The effect of the rotor moment of inertia and the final stabilized rotational speed of PAT on evolution characteristics of parameters is opposite. The rotational speed, head, hydraulic power, and conversion efficiency show a upward rising trend with the startup time, whereas the flow rate and hydraulic head loss display a downward trend. [ABSTRACT FROM AUTHOR]

This study aims to explore the plasma polymerization reaction of fluorocarbon gases, with specific focus on three monomers: tetrafluoromethane, hexafluoroethane, and octafluorocyclobutane. Optical emission spectroscopy was employed to observe species within the glow discharge, while detecting plasma species in fluorocarbon plasma polymerization. Fluorocarbon plasma polymerized films surface morphology and roughness were scrutinized using scanning electron microscopy and atomic force microscopy. Chemical bonding on film surfaces was probed using X-ray photoelectron spectroscopy. Experimental outcomes highlight the essential role of chemical interactions between fluorocarbon plasma and monomers, with film surface composition inferred from fluorocarbon ratio analysis. These analyses improve the understanding of fluorocarbon-to-carbon ratio and duty cycle contributions to plasma polymerized film growth, which promises advancements in the ability to tailor fluorocarbon films to specific applications. [ABSTRACT FROM AUTHOR]

In order to improve the efficiency of the self-priming pump in the outdoor emergency rescue mobile pump truck, this paper took the key energy conversion component-impeller as the target and used the orthogonal experimental design method to optimize its hydraulic performance. Firstly the numerical calculations were compared with the experimental results to confirm the reliability of the calculation method. Then, L9 (34) orthogonal design was applied to investigate the influence of the impeller diameter, the blade outlet width, the blade wrap angle and the number of blades on the hydraulic performance of the self-priming pump. Through range analysis, the order of influence of each influencing factor on the head and efficiency of the self-priming pump was determined, and finally obtained the optimal parameter combination scheme. The results show that the optimized self-priming pump exceeds the head of the prototype pump at all flow conditions, and the efficiency curve at high flow conditions is significantly improved and has a wide high efficiency zone. [ABSTRACT FROM AUTHOR]

Arginase has shown promising potential in treating cancers by arginine deprivation therapy; however, low enzymatic activity and stability of arginase are impeding its development. This study was aimed to improve the enzymological properties of a marine bacterial arginase by carboxymethyl chitosan (CMCS) conjugation. An arginase producing marine bacterium Priestia megaterium strain P6 was isolated and identified. The novel arginase PMA from the strain was heterologously expressed, purified, and then conjugated to CMCS by ionic gelation with calcium chloride as the crosslinking agent. Enzymological properties of both PMA and CMCS-PMA conjugate were determined. The optimum temperature for PMA and CMCS-PMA at pH 7 were 60 °C and 55 °C, respectively. The optimum pH for PMA and CMCS-PMA at 37 °C were pH 10 and 9, respectively. CMCS-PMA showed higher thermostability than PMA over 55–70 °C and higher pH stability over pH 4–11 with the highest pH stability at pH 7. At 37 °C and pH of 7, i.e., around the human blood temperature and pH, CMCS-PMA was higher than the free PMA in enzymatic activity and stability by 24% and 21%, respectively. CMCS conjugation not only changed the optimum temperature, optimum pH, and enzymatic activity of PMA, but also improved its pH stability and temperature stability, and thus made it more favorable for medical application. [ABSTRACT FROM AUTHOR]

To study the effect of the width-to-narrow ratio on the forward and reverse flow characteristics of the Tesla valve, five different models of the Tesla valve with different width-to-narrow ratios are established in this paper. The numerical calculations of forward and reverse flow under different working conditions are carried out by the CFD method in the laminar flow regime, and the reliability of the numerical calculation method is verified by comparing it with the experimental results. The results show that: in forward flow, the main flow-through channel is not related to the width-to-narrow ratio, the flow rate of the straight channel increases with the increase of the width-to-narrow ratio, and the static pressure in the diversion section is in the shape of "∞"; while in reverse flow, the main flow-through channel is weakly related to the width-to-narrow ratio, the flow rate of the arc channel is not increased with the increase of the width-to-narrow ratio, and the static pressure in the diversion section is in the shape of "bench". As the width-to-narrow ratio decreases, the pressure drop during forward and reverse flow becomes more significant. [ABSTRACT FROM AUTHOR]

In order to reveal the influence of starting acceleration on starting process of a pump as turbine system, this paper carries out a numerical calculation of the three-dimensional viscous unsteady flow of pump as turbine circulating piping system under three starting acceleration conditions, and obtains the external and internal flow characteristics of each overflow component during the starting process, and also analyzes the energy loss of each component in the piping system in depth with the help of entropy production method and Q criterion method. The results show that during system start-up, the flow rate and outlet static pressure curves of the pump as turbine are hysteresis relative to the rotational speed, the head curve is similar to a linear rise during slow and medium speed start-up, while it shows a parabolic rise during rapid start-up, the entropy production and vorticity in the impeller domain of the pump as turbine are mainly distributed between the blades, and the distribution decreases during start-up. In addition, the pump similarity law does not apply to the performance prediction during the transient start of the pump as turbine. [ABSTRACT FROM AUTHOR]

Newborn neurons from the subventricular zone (SVZ) are essential to functional recovery following ischemic stroke. However, the number of newly generated neurons after stroke is far from enough to support a potent recovery. Adiponectin could increase neurogenesis in the dentate gyrus of hippocampus in neurodegenerative diseases. However, the effect of adiponectin on the neurogenesis from SVZ and the functional recovery after ischemic stroke was unknown, and the underlying mechanism was not specified either. The middle cerebral artery occlusion model of mice was adopted and adiponectin was administrated once a day from day 3 to 7 of reperfusion. The levels of BDNF and p-STAT3 were detected by western blotting on day 7 of reperfusion. The virus-encoded BDNF shRNA with GFAP promoter and a STAT3 inhibitor Stattic were used, respectively. Neurogenesis was evidenced by the expression of doublecortin and 5-bromo-2ʹ-deoxyuridine (BrdU) labelling and brain atrophy was revealed by Nissl staining on day 28 of reperfusion. Neurological functional recovery was assessed by the adhesive removal test and the forepaw grip strength. We found that adiponectin increased both the doublecortin-positive cells and NeuN/BrdU double-positive cells around the injured area on day 28 of reperfusion, along with the improved long-term neurological recovery. Mechanistically, adiponectin increased the protein levels of p-STAT3 and BDNF in astrocytes on day 7 of reperfusion, while silencing BDNF diminished the adiponectin-induced neurogenesis and functional recovery. Moreover, inhibition of STAT3 not only prevented the increase of BDNF but also the improved neurogenesis and functional recovery after stroke. In conclusion, adiponectin enhances neurogenesis and functional recovery after ischemic stroke via STAT3/BDNF pathway in astrocytes. [ABSTRACT FROM AUTHOR]

Nowadays, the physicians usually predict functional outcomes of stroke based on clinical experiences and big data, so we wish to develop a model to accurately identify imaging features for predicting functional outcomes of stroke patients. Using magnetic resonance imaging of ischemic and hemorrhagic stroke patients, we developed and trained a VGG-16 convolutional neural network (CNN) to predict functional outcomes after 28-day hospitalization. A total of 44 individuals (24 men and 20 women) were recruited from Taoyuan General Hospital and China Medical University Hsinchu Hospital to enroll in the study. Based on "modified Rankin Scale (mRS)" and "National Institutes of Health Stroke Scale (NIHSS)" assessments, men, women, and mixed men and women were trained separately to evaluate the differences of the results, and we have shown that VGG-16 demonstrated high accuracy in predicting the functional outcomes of stroke patients. The new deep-learning approach has provided an automated decision support system for personalized recommendations and treatments, assisting the physicians to predict functional outcomes of stroke patients in clinical practice. [ABSTRACT FROM AUTHOR]

The exploitation of active ingredients from plant volatile organic compounds as natural gaseous fungicides shows remarkable potential for controlling fungal decay in postharvest agroproducts. Although 1-octanol is a common component of cereal volatiles, its antifungal potency against spoilage fungi in postharvest grains remains unclear. In this study, we studied the effectiveness of 1-octanol against Aspergillus flavus growth in postharvest grains and its mechanisms of action. 1-Octanol vapor and liquid contact dose-dependently inhibited A. flavus spore germination and mycelial growth at a low concentration. The simulated storage experiment demonstrated that 300 μL/L of 1-octanol vapor completely controlled A. flavus growth in wheat, corn, and paddy grains with 20% moisture content. 1-Octanol treatment irreversibly damaged the conidial and mycelial morphology of A. flavus and caused electrolyte leakage due to reduced plasma membrane integrity. It induced apoptosis along with morphological abnormalities, phosphatidylserine externalization, mitochondrial membrane potential depolarization, intracellular reactive oxygen species accumulation, and DNA fragmentation in A. flavus cells. Metabolomic analysis revealed that 1-octanol treatment disrupted the biosynthesis of unsaturated fatty acids, ATP-binding cassette transporters, amino acid metabolism, and glycerophospholipid metabolism. This study demonstrated the promising application potential of 1-octanol as a biofumigant for preventing fungal spoilage of postharvest cereal grains. Key points: • (1) 1-Octanol inhibits Aspergillus flavus growth in the vapor phase and liquid contact; • (2) 1-Octanol damages membrane integrity and induces apoptosis of A. flavus; • (3) Metabolomic changes in A. flavus mycelia were analyzed after 1-octanol treatment. [ABSTRACT FROM AUTHOR]

After reviewing Grunsky operator and Faber operator acting on Dirichlet space, we discuss the boundedness of Faber operator on BMOA, a new subject which turns out to be closely related to the BMO theory of the universal Teichmüller space. In particular, we show that the Faber operator acts as a bounded operator on BMOA if the symbol conformal map stays nearly to the base point in the BMO-Teichmüller space. Meanwhile, we obtain several results on quasiconformal mappings, BMO-Teichmüller space and chord-arc curves as well. As by-products, this provides a complex analysis approach to the boundedness of the Cauchy integral acting on BMO functions on a chord-arc curve near to the unit circle in the BMO-Teichmüller space. [ABSTRACT FROM AUTHOR]

The exchanged folded hyerpcube is a brand-new interconnection network proposed by Qi et al. This paper considers the case such that n = 1 + s + t, and the exchanged folded hypercube is denoted by EFH(s, t). The bus topology is one of the most well-known topologies in WDM optical networks. A bus-topology WDM optical network with N terminals can be described by a linear array graph Ln, where N = 2n. In this article, the routing and wavelength allotment problem for embedding EFH(s, t) communication pattern on Ln is studied. To address this problem, the author proposed an embedding scheme as well as a wavelength allotment algorithm. Moreover, the number of allotted wavelengths is shown to be 2s+t + 2s+t− 2 + ⌊2t/3⌋. [ABSTRACT FROM AUTHOR]

Chemical control of fungal spoilage of postharvest cereal grains is an important strategy for the management of grain storage. Here, the potential antifungal activity of 1-nonanol, a main component of cereal volatiles, against Aspergillus flavus was studied. The growth of A. flavus was completely inhibited by 0.11 and 0.20 μL/mL 1-nonanol at vapor and liquid contact phases, respectively. Metabolomic analysis identified 135 metabolites whose expression was significantly different between 1-nonanol-treated and untreated A. flavus. These metabolites were involved in the tricarboxylic acid cycle, amino acid biosynthesis, protein degradation and absorption, aminoacyl-tRNA biosynthesis, mineral absorption, and in interactions with ABC transporters. Biochemical validation confirmed the disruptive effect of 1-nonanol on A. flavus growth, as indicated by the leakage of intracellular electrolytes, decreased succinate dehydrogenase, mitochondrial dehydrogenase, and ATPase activity, and the accumulation of reactive oxygen species. We speculated that 1-nonanol could disrupt cell membrane integrity and mitochondrial function and might induce apoptosis of A. flavus mycelia. Simulated grain storage experiments showed that 1-nonanol vapor, at a concentration of 264 μL/L, completely inhibited A. flavus growth in wheat, corn, and paddy grain with an 18% moisture content. This study provides new insights into the antifungal mechanism of 1-nonanol against A. flavus, indicating that it has a promising potential as a bio-preservative to prevent fungal spoilage of postharvest grains. Key points: • 1-Nonanol showed higher antifungal activity against A. flavus. • The antifungal mechanisms of 1-nonanol against A. flavus were revealed. • 1-Nonanol could damage cell membrane integrity and mitochondrial function. [ABSTRACT FROM AUTHOR]

Non-Hermitian parity-time (P T ) and anti-parity-time (APT )-symmetric systems exhibit novel quantum properties and have attracted increasing interest. Although many counterintuitive phenomena in P T - and APT -symmetric systems were previously studied, coherence flow has been rarely investigated. Here, we experimentally demonstrate single-qubit coherence flow in P T - and APT -symmetric systems using an optical setup. In the symmetry unbroken regime, we observe different periodic oscillations of coherence. Particularly, we observe two complete coherence backflows in one period in the P T -symmetric system, while only one backflow in the APT -symmetric system. Moreover, in the symmetry broken regime, we observe the phenomenon of stable value of coherence flow. We derive the analytic proofs of these phenomena and show that most experimental data agree with theoretical results within one standard deviation. This work opens avenues for future study on the dynamics of coherence in P T - and APT -symmetric systems. The gain and loss inherent in non-Hermitian quantum systems can modify the flow of coherence between subsystems, which may be lost or recovered from the environment. Here, the coherence flow in PT-symmetric and anti-PT symmetric systems is investigated experimentally and theoretically. [ABSTRACT FROM AUTHOR]

Endometriosis (EMS) is a disease that shows immune dysfunction and chronic inflammation characteristics, suggesting a role of complement system in its pathophysiology. To find out the hub genes and pathways involved in the pathogenesis of EMs, three raw microarray datasets were recruited from the Gene Expression Omnibus database (GEO). Then, a series of bioinformatics technologies including gene ontology (GO), Hallmark pathway enrichment, protein–protein interaction (PPI) network and gene co-expression correlation analysis were performed to identify hub genes. The hub genes were further verified by the Real-time quantitative polymerase chain reaction (RT-PCR) and Western Blot (WB). We identified 129 differentially expressed genes (DEGs) in EMs, of which 78 were up-regulated and 51 were down-regulated. Through GO functional enrichment analysis, we found that the DEGs are mainly enriched in cell adhesion, extracellular matrix remodeling, chemokine regulation, angiogenesis regulation, epithelial cell proliferation, et al. In Hallmark pathway enrichment analysis, coagulation pathway showed great significance and the terms in which included the central complement factors. Moreover, the genes were dominating in PPI network. Combined co-expression analysis with experimental verification, we found that the up-regulated expression of complement (C1S, C1QA, C1R, and C3) was positively related to tissue factor (TF) in EMs. In this study, we discovered the over expression complement and the positive correlation between complement and TF in EMs, which suggested that interaction of complement and coagulation system may play a role within the pathophysiology of EMS. [ABSTRACT FROM AUTHOR]

Hollow nanofiber multiple-gas microsensors containing a ceramic package in parallel were developed via doping metal oxides in tin oxide (SnO2) and electrospinning and calcination. Different metal oxides including nickel oxide (NiO), copper oxide (CuO), and indium oxide (In2O3) were doped into SnO2 individually as sensing films for the detection of acetone (CH3COCH), ammonia (NH3), and hydrogen sulfide (H2S) with high selectivity. After heating and calcination, the hollow electrospun nanofibers formed with high specific surface area and porosity resulting in increased sensing area and enhancing the rate of surface chemical reaction and responsivity. The experiments show that the optimal local operation temperature of the activated sensors was 330 °C. High responsivity of the packaged gas sensors was obtained with high accuracy and repeatability. Gas sensitivities were 0.071, 0.075, and 0.09 for sensors of acetone, ammonia, and hydrogen sulfide, respectively, at concentrations of 1 ppm. The response and recovery times of the acetone, ammonia, and hydrogen sulfide gas sensors were 4 and 8 s, 5 and 9 s, and 5 and 12 s, respectively. [ABSTRACT FROM AUTHOR]

In Ding's LISH procedure, the lymph nodes alongside the ileocolic artery are dissected, but these are not the regional lymph nodes of transverse colon cancer, according to the definition of the American Joint Committee on Cancer staging manual [[3]]. Laparoscopic surgery, Transverse colon cancer, Lymph node dissection Keywords: Laparoscopic surgery; Transverse colon cancer; Lymph node dissection EN Laparoscopic surgery Transverse colon cancer Lymph node dissection 419 420 2 04/12/23 20230501 NES 230501 Supplementary Information The online version contains supplementary material available at https://doi.org/10.1007/s10151-022-02668-z. [Extracted from the article]

Threshold pressure gradient has great importance in efficient tight gas field development as well as for research and laboratory experiments. This experimental study is carried out to investigate the threshold pressure gradient in detail. Experiments are carried out with and without back pressure so that the effect of pore pressure on threshold pressure gradient may be observed. The trend of increasing or decreasing the threshold pressure gradient is totally opposite in the cases of considering and not considering the pore pressure. The results demonstrate that the pore pressure of tight gas reservoirs has great influence on threshold pressure gradient. The effects of other parameters like permeability and water saturation, in the presence of pore pressure, on threshold pressure gradient are also examined which show that the threshold pressure gradient increases with either a decrease in permeability or an increase in water saturation. Two new correlations of threshold pressure gradient on the basis of pore pressure and permeability, and pore pressure and water saturation, are also introduced. Based on these equations, new models for tight gas production are proposed. The gas slip correction factor is also considered during derivation of this proposed tight gas production models. Inflow performance relationship curves based on these proposed models show that production rates and absolute open flow potential are always be overestimated while ignoring the threshold pressure gradients. [ABSTRACT FROM AUTHOR]

The irreducible water saturation (Swir) is a significant parameter for relative permeability prediction and initial hydrocarbon reserves estimation. However, the complex pore structures of the tight rocks and multiple factors of the formation conditions make the parameter difficult to be accurately predicted by the conventional methods in tight gas reservoirs. In this study, a new model was derived to calculate Swir based on the capillary model and the fractal theory. The model incorporated different types of immobile water and considered the stress effect. The dead or stationary water (DSW) was considered in this model, which described the phenomena of water trapped in the dead-end pores due to detour flow and complex pore structures. The water film, stress effect and formation temperature were also considered in the proposed model. The results calculated by the proposed model are in a good agreement with the experimental data. This proves that for tight sandstone gas reservoirs the Swir calculated from the new model is more accurate. The irreducible water saturation calculated from the new model reveals that Swir is controlled by the critical capillary radius, DSW coefficient, effective stress and formation temperature. [ABSTRACT FROM AUTHOR]

Physisorption of bromopentafluorobenzene (C6F5Br) on graphene can occur due to the unique σ-hole and π-hole characters of C6F5Br and the rich π-electrons region of graphene, leading to the formation of three types of π-hole···π and σ-hole···π interactions. The π-hole···π interactions are even stronger than the σ-hole···π interactions. The property of graphene was significantly affected by such physisorption. [ABSTRACT FROM AUTHOR]

Blueberry is an important health food, as it contains vitamins, anthocyanins, and antioxidative enzymes. However, post-harvest life of this fruit is very short, and its quality (in terms of microbial growth, antioxidant value, and decay rate) deteriorates rapidly during storage. In this work, air cold plasma at atmospheric pressure was evaluated as a pre-treatment approach for prolonging the shelf life and improving the quality of blueberries. After plasma treatment for 10 min, the number of bacteria and fungi decreased by 93.0% and 25.8%, respectively, which might be due to the increases in DNA damage and guanine oxidation. Accordingly, the blueberry decay rates reduced by 17.7%, 14.3%, and 5.2% in the plasma treatment groups of 6, 8, and 10 min, respectively, after 20 days of storage. Interestingly, the contents of sugar, vitamin C, and total anthocyanin as well as the superoxide dismutase activity level showed the maximum increases of 1.5-fold, 1.5-fold, 2.2-fold, and 79.3%, respectively, following different plasma discharge treatments and storage times compared with those in the control groups. Furthermore, in the treated samples, the degradation times for these four parameters to decrease to control levels were longer compared to the samples without treatment. These results indicated that air cold plasma at atmospheric pressure has excellent potential as a method for enhancing the quality and shelf life of fresh produce in the food industry. [ABSTRACT FROM AUTHOR]

The ventilation work is an important step to be completed before the start of the positive pressure explosion-proof robot. The existing explosion-proof technology uses constant pressure inflation, which will cause explosive gas to accumulate in the corner area of the cavity for a long time. In order to solve this problem, a ventilation method with periodic pulse intake is proposed. Based on the finite element method, the cleaning and ventilation process of the positive pressure explosion-proof robot is simulated and analyzed. The concentration of explosive gas in the robot cavity with time under constant pressure intake and pulse intake with different periods and amplitudes is compared. The simulation results show that the pulse intake is beneficial to the ventilation of the corner position. The period and amplitude of the pulse intake has an effect on the ventilation efficiency, when the period is the same, the greater the amplitude of the pulse intake, the higher the ventilation efficiency; when the amplitude is the same, the smaller the period of the pulse intake, the higher the ventilation efficiency. After experimental verification, the validity of the simulation results is proved. This study helps to improve the ventilation efficiency of positive-pressure explosion-proof robots and provides guidance for practical applications. [ABSTRACT FROM AUTHOR]

The lead-free perovskites derivatives of Cs3Sb2X9 (X = Cl, Br, I) have been synthesized, but their photocatalytic properties are not explored. To evaluate the feasibility for the visible light catalytic performance, we calculate the structural, electronic, optical and charge transfer properties of Cs3Sb2X9, based on the hybrid density functional theory of HSE06 with the projector augmented wave potential. The results show the decrease of band energy gaps and the redshift of absorption edges from X = Cl to I. The absolute potential of the valence band maximum and conduction band minimum is determined to justify the feasibility of the photocatalytic water splitting or CO2 reduction. The calculated carrier mobilities reveal that the high electron mobilities of Cs3Sb2I9 are beneficial to the reducing powers for hydrogen generation and CO2 reduction. The present results indicate that Cs3Sb2I9 is appropriate for the photocatalytic water splitting to produce hydrogen or the CO2 reduction driven by the visible light. [ABSTRACT FROM AUTHOR]

The electrode configuration determines the thermophysical field during the electroslag remelting (ESR) process and affects the final microstructure of the ingot. In this work, ingot with a diameter of 400 mm was prepared with two electrode configuration modes of single power ESR process, namely one electrode (OE) and two series-connected electrodes (TSCE). Finite element simulation was employed to calculate the electromagnetic field, flow field and temperature field of the ESR system. The results show that the temperature of the slag pool and the metal pool of the TSCE process is lower and more uniform than that of the OE process. The calculated temperature distribution of the ingot could be indirectly verified from the shape of the metal pool by the experiment. The experimental results show that the depth of the metal pool in the OE ingot is about 160 mm, while the depth of the TSCE ingot is nearly 40 mm shallower than that of the OE ingot. Microstructural comparisons indicate that coarse eutectic carbides are formed in the center of the OE ingot, whereas more even eutectic carbides appear in the center of the TSCE ingot. In general, compared with the OE process, the TSCE process is preferred to remelt high speed steel ingots. [ABSTRACT FROM AUTHOR]

The Cambrian strata in Tarim basin is mainly evaporate platform facies dolomite. Due to the lack of trilobite fossils, it is hardly to achieve isochronous stratigraphic division and correlation. The Xiaoerbulake outcrop and Fang 1 well are typical surface and subsurface Cambrian sections in Tarim Basin respectively. Shayilike, Awatage and Xiaqiulitage Groups were regarded as the complete Upper -Middle Cambrian previously which composed of dolomite. The carbon isotope values range from –15.5 to 2‰, and three negative excursions are found (N1, N2 and N3). Comparing with the Global Standard Chronostratigraphic Scale for the Middle and Upper Cambrian System, the fifth stage and the Drumian of the third Series, the ninth and the tenth Stage of Furongian Series can be recognized, while the Guzhangian and Paibian are lost. As a result, the Cambrian Formation in Tarim Basin can be divided accurate to stage scale. [ABSTRACT FROM AUTHOR]

An arbitrated quantum multi-proxy blind signature scheme, which is based on four-qubit cluster states, is proposed in this paper. This scheme satisfies all the characteristics of a multi-proxy blind signature scheme. To guarantee the security of this scheme, some quantum technologies such as quantum key distribution (QKD) protocol, eavesdropping check, quantum one-time pad and quantum secure direct communication (QSDC) protocol are used. Analysis results show that our scheme is secure. [ABSTRACT FROM AUTHOR]

The exchanged crossed cube, denoted by ECQ(s,t), is a novel graph with fewer edges and smaller diameter compared to other variations of the corresponding hypercube. The ring topology, denoted by Rn, is one of the most popular topologies in Wavelength division multiplexing optical networks. This paper addresses the routing and wavelength assignment problem for realizing ECQ(s,t) communication pattern on Rn, where n=s+t+1. We propose an embedding scheme. Base on the embedding scheme, a wavelength assignment algorithm using 2s+t-2+⌊2t/3⌋ wavelengths is devised. We show that the wavelength assignment algorithm uses no more than 1.25 times of wavelengths compared to the optimal wavelength number, i.e., it is a factor 1.25 approximation algorithm. Moreover, the number of additional required wavelengths is no more than ⌊2t-1/3⌋. [ABSTRACT FROM AUTHOR]

Disseminated visceral coccidiosis (DVC) is a widely distributed intestinal and extraintestinal disease of cranes caused by eimeriid coccidia and has lethal pathogenicity to several crane species. Here, feces of 164 black-necked cranes collected in Dashanbao Black-necked Crane National Nature Reserve, China, were examined to determine the prevalence of coccidial oocysts. Of the 164 fecal samples, 76 (46.3%) were positive for oocysts of Eimeria, including E. gruis in 59 (35.9%), E. reichenowi in 52 (31.7%), and E. bosquei in 47 (28.7%) by microscopic observation. Sixty-eight (89.5%) of these positive samples included two or more morphologically identifiable species of Eimeria. The nearly full length 18S rRNA gene (18S rRNA; about 1.8 kb) and partial mitochondrial cytochrome c oxidase I gene (COX1; about 1.3 kb) from oocysts of each morphologically distinct species of Eimeria were amplified, sequenced, and analyzed. BLAST searches using these new 18S rRNA sequences for E. gruis, E. reichenowi, or E. bosquei showed the most similar sequences were those of E. gruis (98.7–99.7% identity), E. reichenowi (97.9–100% identity), or E. gruis (98.6–99.6% identity) isolated from different species of Grus. BLAST searches using the new COX1 sequences for the three species of Eimeria showed that no nucleotide sequences of Eimeria and Isospora coccidia in GenBank have more than 83.0% identity with these species. Identities among the new COX1 sequences were 91.8% for E. gruis and E. reichenowi, 94.5% for E. gruis and E. bosquei, and 91.3% for E. reichenowi and E. bosquei. Phylogenetic analysis based on 18S rRNA or COX1 sequences indicated that Eimeria spp. in black-necked cranes were clustered together with other previously identified Eimeria species from different cranes. [ABSTRACT FROM AUTHOR]

The paper presents a novel hydraulic fracturing model for the characterization and simulation of the complex fracture network in shale gas reservoirs. We go beyond the existing method that uses planar or orthogonal conjugate fractures for representing the ''complexity'' of the network. Bifurcation of fractures is performed utilizing the Lindenmayer system based on fractal geometry to describe the fracture propagation pattern, density and network connectivity. Four controlling parameters are proposed to describe the details of complex fractures and stimulated reservoir volume (SRV). The results show that due to the multilevel feature of fractal fractures, the model could provide a simple method for contributing reservoir volume calibration. The primary- and second-stage fracture networks across the overall SRV are the main contributions to the production, while the induced fracture network just contributes another 20% in the late producing period. We also conduct simulation with respect to different refracturing cases and find that increasing the complexity of the fracture network provides better performance than only enhancing the fracture conductivity. [ABSTRACT FROM AUTHOR]

This paper presents an approach to optimize the shape of a general rotary cutter for five-axis flank milling of ruled and non-ruled surfaces. Based on the observation that tool shape optimization is equivalent to repositioning the control points of its B-spline meridian, the optimization of tool surface is reduced to that of a B-spline curve. Then, the meridian of rotary tool surface is represented by cubic B-spline curve, and it is used to obtain the analytic tool envelope surface. Subsequently, the flank milling error is measured by the distance between a point sampled from envelope surface and the design surface. On this basis, shape optimization of a general rotary cutter is formulated as an optimization problem from the perspective of approximating the tool envelope surface to the designed surface. Two examples are given to confirm the validity of the proposed method. The approach also applied to multi-pass five-axis flank milling. [ABSTRACT FROM AUTHOR]

Background and Aims: Peutz-Jeghers syndrome (PJS) is an autosomal-dominant genetic disease caused by mutations in the tumor suppressor gene, STK11, which is characterized by gastrointestinal hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing both gastrointestinal and extraintestinal malignancies.Methods and Results: We treated a PJS patient without a positive family history, who possessed typical clinical manifestations including polyp canceration. In order to explore the genotype of this patient, blood samples were collected from all the available family members. The whole coding region and the flanking regions of the STK11 gene were amplified by polymerase chain reaction and analyzed by Sanger sequencing. Molecular analysis of the STK11 gene here revealed a 23-nucleotide deletion (c.426-448delCGTGCCGGAGAAGCGTTTCCCAG) in exon 3, resulting in a change of 13 codons and a truncating protein (p.S142SfsX13). This mutation was not found in normal individuals in this family including her parents or in 100 control individuals. Protein structure prediction indicated a dramatic loss of the kinase domain and complete loss of the C-terminal regulatory domain.Conclusions: The results presented here enlarge the spectrum of STK11 mutation both disease-causing and malignancy-causing. [ABSTRACT FROM AUTHOR]

The evaluation of seismic passive earth pressure is an important aspect in designing safe retaining walls. In this paper, a slice analysis method is adopted to study the nonlinear distribution of seismic passive earth pressure while considering most of the possible parameters. The closed-form expressions for the resultant force of seismic passive earth pressure, earth pressure distribution, and its application position are obtained. The explicit solution for the critical failure angle of seismic passive earth pressure is proposed by simplifying the relation between the resultant force and the failure angle based on a graphical analysis method. Under certain conditions, the present method correlates with classical passive earth pressure theories. By comparing the present method with test results and previously published solutions, the results are found to be consistent. The influence of the seismic coefficients on seismic passive earth pressure is also studied. [ABSTRACT FROM AUTHOR]

A brush-distributed metal oxidation sensing nanostructure is developed by growing zinc oxide (ZnO) nanorods on electrospun titanium dioxide (TiO) nanofibers to improve ions adsorption of lead and copper. A pair of inductive plane coils are designed to measure inductive variation induced by the adsorbed ion concentration. The brush-distributed ZnO-TiO nanofibers are fabricated by using electrospinning and hydrothermal methods that are deposited on the PVDF-formed nanofiber membrane to enhance copper and lead ions adsorption efficiency. The sensitivity has been promoted based on the van der Waals force and produced hydroxyl from grown surface nanorods. The TiO structure was examined by checking XRD patterns. These diffraction peaks are indexed as the (101), (004), (200), and (105) of anatase TiO and are consistent with the standard data (JCPDS No. 78-2486). The circular coils are designed and simulated using the finite element method to sense metal ions by measuring concentration-dependent magnetic flux variation. The developed ZnO-TiO ion sensing composites include the following advantages: simple fabrication process, low cost, high selectivity, highly effective adsorption, specific surface area and porosity, rapid response, and good repeatability and reproducibility. [ABSTRACT FROM AUTHOR]

A compound sensing structure based on nanoflower-like ZnO-SnO coated on the top of nanoporous anodic aluminum oxide (AAO) layer to form ZnO-SnO-AAO composite as a gas sensing structure is developed for detecting ethanol and methanol simultaneously. The ZnO-SnO powders were synthesized by hydrothermal synthesis method. The SnO was grown densely and uniformly that has unique loose and porous nano structures to increase the accessible surface area for improving gas diffusion and mass transport. A solenoid-type heater was designed to surround the sensing column for controlling operation temperature to promote gas sensitivity. The ethanol and methanol responses of ZnO-SnO-AAO are high because the porous AAO greatly improves the specific adsorption surface area, and the ZnO produces more electron donor states or oxygen vacancies to enhance oxygen adsorption as well as the heterojunction of SnO and ZnO grains offers access to facile electronic interaction to enhance the surface reaction between adsorbed oxygen and current-carrying electrons. By analyzing a series of temperature-varied cyclic tests, the optimal operation temperatures of 180 °C for sensing ethanol and 260 °C for sensing methanol were obtained to have the strongest output responses. The developed ZnO-SnO-AAO gas sensing composites include the advantages: simple fabrication process, low cost, high specific surface area and porosity, rapid detection, high sensitivity, stable stability, and good repeatability. [ABSTRACT FROM AUTHOR]

This paper attempts to study the irreducibility on complete prefix code (CPC-irreducibility) of a Markov shift over a free group, a topological mixing property first considered for shift spaces over free semigroups that induces chaotic behavior such as the existence of a dense set of periodic points. An example shows that the (d , c) -reduction, an effective algorithm of determination of CPC-irreducibility of Markov shifts over free semigroups (Ban et al. in J Stat Phys 177:1043–1062, 2019), fails for general Markov shifts over free groups. This paper reveals an algorithm for determining the CPC-irreducibility of Markov shifts over both free semigroups and groups. Furthermore, such an examination is finitely checkable, and an upper bound for the complexity of the algorithm is provided. [ABSTRACT FROM AUTHOR]

To implement various artificial intelligence and automation applications in smart factories, edge computing and industrial Internet of Things (IIoT) devices must be widely deployed, so as to increase the demand of coping with huge-scale and high-diversity data. Through deployment of fifth-generation (5G) networks (providing wide broadband, low latency, and massive machine type communications), industrial wireless networks, cloud, and fixed/mobile end devices in smart factories are interoperated in a harmony. However, with the huge-scale deployment of 5G networks and the IIoT in smart factories, threats and attacks against various vulnerabilities increase enormously, and cause considerable security and privacy challenges. Consequently, this article investigates crucial security and privacy issues for 5G-IIoT smart factories in three entities (i.e., physical layer, data layer and application layer), and further surveys recent approaches based on deep learning, reinforcement learning, and blockchain. In addition, this article provides future perspectives and challenges along this line of research. [ABSTRACT FROM AUTHOR]

Accurate determination of fatty acid contents is routinely required in microalgal and yeast biofuel studies. A method of rapid in situ fatty acid methyl ester (FAME) derivatization directly from wet fresh microalgal and yeast biomass was developed in this study. This method does not require prior solvent extraction or dehydration. FAMEs were prepared with a sequential alkaline hydrolysis (15 min at 85 °C) and acidic esterification (15 min at 85 °C) process. The resulting FAMEs were extracted into n-hexane and analyzed using gas chromatography. The effects of each processing parameter (temperature, reaction time, and water content) upon the lipids quantification in the alkaline hydrolysis step were evaluated with a full factorial design. This method could tolerate water content up to 20 % ( v/ v) in total reaction volume, which equaled up to 1.2 mL of water in biomass slurry (with 0.05-25 mg of fatty acid). There were no significant differences in FAME quantification ( p > 0.05) between the standard AOAC 991.39 method and the proposed wet in situ FAME preparation method. This fatty acid quantification method is applicable to fresh wet biomass of a wide range of microalgae and yeast species. [ABSTRACT FROM AUTHOR]

This paper focuses on the analysis of two particular models, from deterministic and random perspective respectively, for spreading processes. With a proper encoding of propagation patterns, the spread rate of each pattern is discussed for both models by virtue of the substitution dynamical systems and branching process. In view of this, we are empowered to draw a comparison between two spreading processes according to their spreading models, based on which explanations are proposed on a higher frequency of a pattern in one model than the other. These results are then supported by the numerical evidence later in the article. [ABSTRACT FROM AUTHOR]

Objective: Whether external or plating fixation is more appropriate for high-energy tibial plateau fractures is still being disputed, our aim was to test the hypothesis whether external fixation can provide a fair outcome with fewer complications, when compared to the results with previously reported data of plating fixation for high-energy tibial plateau fractures. Methods: An Ovid of Medline, Embase, and Cochrane Library search was conducted for the relevant English orthopedic journals, and eligible studies, including twenty-four case series and one comparative study containing 885 patients associated with 892 fractures, were enrolled. Results: The results showed there were a higher proportion of men, open fractures, malunion, knee instability, and posttraumatic arthritis occurred in external fixation group than those in plating group ( P = 0.007, P = 0.000, P = 0.024, P = 0.006, P = 0.000, respectively), while valgus deformity happened at a significantly higher rate in plate group ( P = 0.014). No significant differences were found between the two groups in terms of age, Schatzker type, follow-up, mean time to union, mean range of knee motion, and rate of reoperation. With regard to the functional and radiological outcome assessment, despite what assessment tools were used, most of these studies presented less than 90 % good/excellent results in their high-energy fracture series. Besides, there was a trend for patients in plating group to have a higher risk than those in external fixation group in terms of heterotopic ossification and local irritation (1.23 vs 0.17 %, 4 vs 1.94 %, accordingly). Conclusions: Although lack of good quality randomized control trials, there are rather enough samples supporting the current available results. Meanwhile, future multicentered, randomized, controlled studies should be implemented to test these outcomes. [ABSTRACT FROM AUTHOR]

A method for fabricating a microlens array composite optical film by a seamless roller mold of self-assembly is presented. The roller with a lot of random cavities is used to produce a polyethylene terephthalate (PET) composite optical film with 3D random microlens arrays using the ultraviolet (UV) roll-to-roll printing. The luminance gain and haze are 1.247 and 86 %, respectively, giving the PET composite optical film the properties of a brightness enhancement film and a diffuser. Solid glass beads (SBs) are used for parameter testing for self-assembly. Then, 3 M glass bubble beads (BBs) are used to fabricate a seamless roller mold. The optimal parameters of the self-assembly process for the SB are a coating speed of 135 mm/h with a 39 % volume ratio, and those for the BB are a coating speed of 30 mm/h with a 3 % volume ratio. Finally, the PET optical film is used in the green energy lighting testing of a commercial bicycle light-emitting diode (LED). The results show increased lighting angle and light uniformity, making it similar to traditional tungsten light. [ABSTRACT FROM AUTHOR]

Nanoparticles are widely used in biomedical applications and cancer treatments due to their minute scale, multi-function, and long retention time. Among the various nanoparticles, the unique optical property derived from the localized surface plasmon resonance effect of metallic nanoparticles is a primary reason that metallic nanoparticles are researched and applied. Copper and Iron nanoparticles have the potential to generate hydroxyl radicals in excess H2O2 via Fenton or Fenton-like reactions. On the other hand, gold nanoparticles equipped with a photosensitizer can transfer the energy of photons to chemical energy and enhance the production of singlet oxygen, which is suitable for cancer treatment. With the actions of these two reactive oxygen species in the tumor microenvironment, cell apoptosis can further be induced. In this work, we first synthesized dual metal nanoparticles with poly[styrene-alt-(maleic acid, sodium salt)(Cu ferrite oxide-polymer) by a simple one-step hydrothermal reduction reaction. Then, gold(III) was reduced and doped into the structure, which formed a triple metal structure, Au-doped Cu ferrite nanoparticles (Au/Cu ferrite oxide-polymer NPs). The metal ratio of the product could be controlled by manipulating the Fe/Cu ratio of reactants and the sequence of addition of reactants. The core–shell structure was verified by transmission electron microscopy. Moreover, the hydroxyl radical and singlet oxygen generation ability of Au/Cu ferrite oxide-polymer was proved. The chemodynamic and photodynamic effect was measured, and the in vitro ROS generation was observed. Furthermore, the behavior of endocytosis by cancer cells could be controlled by the magnetic field. The result indicated that Au/Cu ferrite oxide-polymer core–shell nanoreactor is a potential agent for chemodynamic/photodynamic synergetic therapy. [ABSTRACT FROM AUTHOR]

High-entropy alloys have been proved to be potential candidate materials in the biomedical field due to their balanced mechanical properties and excellent biocompatibility. The effects of atomic ratios on the as-cast microstructural evolution, mechanical properties, and electrochemical property of TiZrTaNbSn high-entropy alloys were studied systematically. The crystal structure of TiZrTaNbSn high-entropy alloys is single BCC phase, and the microstructural evolution is based on atomic ratio. The dendric structure, peritectic structure, pseudo eutectic and equiaxed grain, which are associated with element segregation, can be obtained by non-equal atomic ratio. Ti30Zr20Ta20Nb20Sn10 alloy demonstrates a high compressive strength and fracture strain, which are 2,571.8 MPa and 12%, respectively, and the fracture behavior is quasi-cleavage faults. The Ti45Z35Ta5Nb5Sn10, Ti30Zr20Ta20Nb20Sn10 and Ti35Zr25Ta15Nb15Sn10 alloys show excellent corrosion resistance according to Nyquist diagram, polarization curves and corrosion morphology. Compared with TiZrTaNbSn alloy, the corrosion rate of Ti45Zr35Ta5Nb5Sn10 alloy increases by about 98.9%. It can be concluded that non-equal atomic ratios are effective for microstructure control and performance optimization. [ABSTRACT FROM AUTHOR]

Therefore, the wording of the Methods, subsection "Construct drug similarity network based on side effects" closely resembles the method description in Reference 57 designed for symptom-based similarity detection, but this reference was not cited in this section. To construct drug similarity network based on side effects, the Authors used the data and the method reported by Zhou et al. whose paper is cited as Reference 57 in the Article. [Extracted from the article]

Abstract: The exploitation of plant volatile organic compounds as biofumigants to control postharvest decaying of agro-products has received considerable research attention. Our previous study reported that 1-nonanol, the main constituent of cereal volatiles, can inhibit Aspergillus flavus growth and has the potential as a biofumigant to control the fungal spoilage of cereal grains. However, the antifungal mechanism of 1-nonanol against A. flavus is still unclear at the molecular level. In this study, the minimum inhibitory concentration and minimum fungicidal concentration of 1-nonanol against A. flavus spores were 2 and 4 μL/mL, respectively. Scanning electron microscopy revealed that the 1-nonanol can distort the morphology of A. flavus spore. Annexin V-FITC/PI double staining showed that 1-nonanol induced phosphatidylserine eversion and increased membrane permeability of A. flavus spores. Transcriptional profile analysis showed that 1-nonanol treatment mainly affected the expression of genes related to membrane damage, oxidative phosphorylation, blockage of DNA replication, and autophagy in A. flavus spores. Flow cytometry analysis showed that 1-nonanol treatment caused hyperpolarization of mitochondrial membrane potential and accumulation of reactive oxygen species in A. flavus spores. 4′,6-diamidino-2-phenylindole staining showed that treatment with 1-nonanol destroyed the DNA. Biochemical analysis results confirmed that 1-nonanol exerted destructive effects on A. flavus spores by decreasing intracellular adenosine triphosphate content, reducing mitochondrial ATPase activity, accumulating hydrogen peroxide and superoxide anions, and increasing catalase and superoxide dismutase enzyme activities. This study provides new insights into the antifungal mechanisms of 1-nonanol against A. flavus.• 1-Nonanol treatment resulted in abnormal morphology of A. flavus spores.• 1-Nonanol affects the expression of key growth-related genes of A. flavus.• The apoptosis of A. favus spores were induced after exposed to 1-nonanol.Key points: The exploitation of plant volatile organic compounds as biofumigants to control postharvest decaying of agro-products has received considerable research attention. Our previous study reported that 1-nonanol, the main constituent of cereal volatiles, can inhibit Aspergillus flavus growth and has the potential as a biofumigant to control the fungal spoilage of cereal grains. However, the antifungal mechanism of 1-nonanol against A. flavus is still unclear at the molecular level. In this study, the minimum inhibitory concentration and minimum fungicidal concentration of 1-nonanol against A. flavus spores were 2 and 4 μL/mL, respectively. Scanning electron microscopy revealed that the 1-nonanol can distort the morphology of A. flavus spore. Annexin V-FITC/PI double staining showed that 1-nonanol induced phosphatidylserine eversion and increased membrane permeability of A. flavus spores. Transcriptional profile analysis showed that 1-nonanol treatment mainly affected the expression of genes related to membrane damage, oxidative phosphorylation, blockage of DNA replication, and autophagy in A. flavus spores. Flow cytometry analysis showed that 1-nonanol treatment caused hyperpolarization of mitochondrial membrane potential and accumulation of reactive oxygen species in A. flavus spores. 4′,6-diamidino-2-phenylindole staining showed that treatment with 1-nonanol destroyed the DNA. Biochemical analysis results confirmed that 1-nonanol exerted destructive effects on A. flavus spores by decreasing intracellular adenosine triphosphate content, reducing mitochondrial ATPase activity, accumulating hydrogen peroxide and superoxide anions, and increasing catalase and superoxide dismutase enzyme activities. This study provides new insights into the antifungal mechanisms of 1-nonanol against A. flavus.• 1-Nonanol treatment resulted in abnormal morphology of A. flavus spores.• 1-Nonanol affects the expression of key growth-related genes of A. flavus.• The apoptosis of A. favus spores were induced after exposed to 1-nonanol. [ABSTRACT FROM AUTHOR]

Purpose: To identify the secreted proteins of murine embryos grown in vitro. Methods: Two-cell mouse embryos ( n = 432) were randomly allocated to culture to the blastocyst stage in protein-free and in protein-supplemented (3 % BSA) media. Proteins were separated by SDS-PAGE; bands were visualized by coomassie staining, followed by in-gel trypsin digestion and liquid chromatography-tandem mass spectrometry. RT-PCR and confocal microscopy were used to confirm gene/protein expression in blastocysts. Results: Of all individually identified proteins, 34 and 23 were found in embryos cultured without and with BSA, respectively, and 20 were common. Identified proteins having an N-terminal secretory sequence or transmembrane domains located on the extracellular backbone were postulated as secreted proteins. Gene and protein expression for two selected molecules were confirmed. Functional analysis revealed over-represented processes related to lipid metabolism, cyclase activity, and cell adhesion/membrane functions. Conclusions: This study provided evidence to further characterize secreted proteins by mouse embryos grown from the 2-cell to the blastocyst stage in vitro. Because of homology between murine and human, these results may provide information to be translated to the clinical setting. [ABSTRACT FROM AUTHOR]

The impact of both initial and parameter errors on the spring predictability barrier (SPB) is investigated using the Zebiak-Cane model (ZC model). Previous studies have shown that initial errors contribute more to the SPB than parameter errors in the ZC model. Although parameter errors themselves are less important, there is a possibility that nonlinear interactions can occur between the two types of errors, leading to larger prediction errors compared with those induced by initial errors alone. In this case, the impact of parameter errors cannot be overlooked. In the present paper, the optimal combination of these two types of errors [i.e., conditional nonlinear optimal perturbation (CNOP) errors] is calculated to investigate whether this optimal error combination may cause a more notable SPB phenomenon than that caused by initial errors alone. Using the CNOP approach, the CNOP errors and CNOP-I errors (optimal errors when only initial errors are considered) are calculated and then three aspects of error growth are compared: (1) the tendency of the seasonal error growth; (2) the prediction error of the sea surface temperature anomaly; and (3) the pattern of error growth. All three aspects show that the CNOP errors do not cause a more significant SPB than the CNOP-I errors. Therefore, this result suggests that we could improve the prediction of the El Niño during spring by simply focusing on reducing the initial errors in this model. [ABSTRACT FROM AUTHOR]

Several near-infrared (NIR) fluorescent dyes based on aminocyanine have been designed, synthesized, and used for preparation of NIR fluorescent microspheres. Their spectral properties and pH-dependent optical characteristics were investigated. It was found that different substitution at the central position of the dyes led to diverse optical properties, with especially large effects on their spectroscopic properties. Spectroscopic responses of the fluorescent dyes to changes of pH were different. Under acidic conditions, the wavelengths of maximum absorption of the N-substituted cyanine dyes were clearly red shifted. Dyes with an N-substituted piperazidine ring were the most sensitive. The fluorescent microspheres retained the properties of the parent dyes, making them suitable for applications in biological studies. [ABSTRACT FROM AUTHOR]

The removal of recalcitrant chemicals in wastewater treatment systems is an increasingly relevant issue in industrialized countries. The elimination of persistent xenobiotics such as endocrine-disrupting chemicals (EDCs) emitted by municipal and industrial sewage treatment plants remains an unsolved challenge. The existing efficacious physico-chemical methods, such as advanced oxidation processes, are resource-intensive technologies. In this work, we investigated the possibility to remove phenolic EDCs [i.e., bisphenol A (BPA)] by means of a less energy and chemical consuming technology. To that end, cheap and resistant oxidative enzymes, i.e., laccases, were immobilized onto silica nanoparticles. The resulting nanobiocatalyst produced at kilogram scale was demonstrated to possess a broad substrate spectrum regarding the degradation of recalcitrant pollutants. This nanobiocatalyst was applied in a membrane reactor at technical scale for tertiary wastewater treatment. The system efficiently removed BPA and the results of long-term field tests illustrated the potential of fumed silica nanoparticles/laccase composites for advanced biological wastewater treatment. [ABSTRACT FROM AUTHOR]

This paper investigates the analytical envelope surface model formed by specially designed cutting edge under cutter runout error, including axis offset error and tilt error, in five-axis flank milling. This model, which is independent of the machine tool type, is determined by the tangency condition in envelope theory. First, the cutter runout is defined by four parameters, namely offset distance, offset direction angle, locating angle, and tilt angle. Then, the cutting edge represented by cubic B-spline curve is used as the generator of cutter rotation surface to formulate the closed-form envelope surface model. In particular, the runout error and feedrate are both integrated into the model. In addition, we study special cases of the analytical model and the runout effect on envelope surface. Finally, computer example validates the feasibility of the proposed model with runout. We find that envelope surface formed by cutter edge is different from each other at the existence of runout, and envelope surface dedicated to final machined surface is generated by the composition of some segments of cutter edges. The results can be applied to tool path optimization in five-axis flank milling and NC simulation with cutter runout. [ABSTRACT FROM AUTHOR]