Search

Polygalacturonases (PG) are the enzymes that cause depolymerization of pectin. In current study, bacterial strain was isolated from rotten sample and then purified. It was screened for endo-polygalacturonase activity using PSAM media. It had shown positive response for endo-PG activity. Bacterial DNA was isolated and 16 S rRNA gene amplification was done using universal primer pair of 8 F and 1492 R. Bacterial strain was also amplified by 16 S rRNA gene for sequencing. BLAST of gene sequence on NCBI database had shown that bacterial isolate was identified as Bacillus pumilus. Endo-polygalacturonase enzyme was produced by submerged fermentation to optimize culture conditions by RSM in JMP-12 software. The optimized parameters had shown maximum endo-polygalacturonase activity of 153.2 U/mL/min after using 3 g of orange peels as substrate, 3 mL of inoculum size, 6.5 pH buffer, 40°C temperature and 3 days of incubation. After optimizing fermentation conditions, endo-polygalacturonase was precipitated using 70 % concentration of ammonium sulfate. This partially precipitated sample was dialyzed with dialysis tube and used to find activity of endo-polygalacturonase (1620.6 U/mL/min). This sample was applied to gel filtration chromatography for further purification. Endo-polygalacturonase activity increased many times 2231.44 U/mL/min after gel filtration. The Molecular weight of endo-polygalacturonase was 46 kDa after SDS PAGE characterization. High Vmax value and alkaliphilic nature of endo-polygalacturonase will make it good candidate for food and feed industry near future. [Display omitted] • A bacterial strain was isolated from rotten sample. • Bacillus pumilus was identified through 16 S rRNA gene sequencing. • Maximum enzyme activity of 153.2 U/mL/min was achieved under optimized conditions. • The characterized endo-polygalacturonase has great potential in industrial applications. • Polygalacturonase had shown maximum activity after column chromatography. [ABSTRACT FROM AUTHOR]

Hysterothylacium aduncum is one of six pathogens responsible for human anisakiasis. Infection with H. aduncum can cause acute abdominal symptoms and allergic reactions and is prone to misdiagnosis in clinical practice. This study aims to enhance the efficiency and accuracy of detecting H. aduncum in food ingredients. We targeted the internal transcribed spacer 1 (ITS 1) regions of Anisakis to develop a visual screening method for detecting H. aduncum using recombinase polymerase amplification (RPA) combined with the CRISPR/Cas12a system. By comparing the ITS 1 region sequences of eight nematode species, we designed specific primers and CRISPR RNA (crRNA). The specificity of RPA primers was screened and evaluated, and the CRISPR system was optimized. We assessed its specificity and sensitivity and performed testing on commercial samples. The results indicated that the alternative primer ADU 1 was the most effective. The final optimized concentrations were 250 nM for Cas12a, 500 nM for crRNA, and 500 nM for ssDNA. The complete test procedure was achievable within 45 min at 37 °C, with a limit of detection (LOD) of 1.27 pg/μL. The amplified product could be directly observed using a fluorescence microscope or ultraviolet lamp. Detection results for 15 Anisakis samples were entirely consistent with those obtained via Sanger sequencing, demonstrating the higher efficacy of this method for detecting and identifying H. aduncum. This visual detection method, characterized by simple operation, visual results, high sensitivity, and specificity, meets the requirements for food safety testing and enhances monitoring efficiency. [ABSTRACT FROM AUTHOR]

Loop-Mediated Isothermal Amplification (LAMP) represents a valuable technique for DNA/RNA detection, known for its exceptional sensitivity, specificity, speed, accuracy, and affordability. This study focused on optimizing a LAMP-based method to detect early signs of Plasmopara halstedii, the casual pathogen of sunflower downy mildew, a severe threat to sunflower crops. Specifically, a set of six LAMP primers (two outer, two inner, and two loop) were designed from P. halstedii genomic DNA, targeting the ribosomal Large Subunit (LSU). These primers were verified by in silico analysis and experimental validation using both target and non-target species' DNAs. Optimizations encompassing reaction conditions (temperature, time) and component concentrations (magnesium, Bst DNA polymerase, primers, and dNTP) were determined. Validation of these optimizations was performed by agarose gel electrophoresis. Furthermore, various colorimetric chemicals (Neutral Red, Hydroxynaphthol Blue, SYBR Safe, Thiazole Green) were evaluated to facilitate method analysis, and the real-time analysis has been optimized, presenting multiple approaches for detecting sunflower downy mildew using the LAMP technique. The analytical sensitivity of the method was confirmed by detecting P. halstedii DNA concentrations as low as 0.5 pg/μl. This pioneering study, establishing P. halstedii detection through the LAMP method, stands as unique in its field. The precision, robustness, and practicality of the LAMP protocol make it an ideal choice for studies focusing on sunflower mildew, emphasizing its recommended use due to its operational ease and reliability. [ABSTRACT FROM AUTHOR]

A general approach is presented for synthesizing alkyne-modified nucleoside triphosphates via the Sonogashira cross-coupling reaction of unprotected halogenated 2ʹ-deoxynucleoside, followed by monophosphorylation and the reaction of the corresponding phosphoromorpholidate with tributylammonium pyrophosphate. A highly efficient approach for the milligram-scale synthesis of base-modified nucleoside triphosphates with an amino acid-like side chain was developed. The present chemical method outweighs the other reported methods of a base-modified nucleoside triphosphates synthesis in terms of it being a protection-free strategy, the shortening of reaction steps, and increased yields (about 70%). The resulting 8-alkynylated dATP was tested as a substrate for DNA polymerases in a primer extension reaction. [ABSTRACT FROM AUTHOR]

The human primase-polymerase PrimPol is a key participant of the mechanism of DNA synthesis restart during replication fork stalling at sites of DNA damage. PrimPol has DNA primase activity and synthesizes DNA primers that are used by processive DNA polymerases to continue replication. Recruitment of PrimPol to the sites of DNA damage, as well as stimulation of catalytic activity, depends on interaction with the replicative protein RPA, which binds single-stranded DNA. The C-terminal domain of PrimPol contains a negatively charged RPA-binding motif (RBM), mutations in which disrupt the interaction between two proteins. The RBM motif also plays a role in the negative regulation of PrimPol interaction with DNA. Deletion of the RBM dramatically increases PrimPol affinity to DNA and stimulates PrimPol activity. The mechanism of RBM-mediated regulation of PrimPol activity is unclear. The relatively strong negative charge of RBM potentially may contribute to the interaction of PrimPol with RPA and DNA. RBM contains two negatively charged regions RBM-A and RBM-B. In this work, we additionally added (substitution V546E) or decreased (substitution D547H) a negative charge in RBM-B PrimPol and characterized these mutant variants biochemically. It was shown that the local change in the RBM-B charge has no effect on the interaction of PrimPol with DNA and RPA, or of the catalytic activity of the enzyme. [ABSTRACT FROM AUTHOR]

Using food ingredients and/or processed food products contaminated with pork, whether unintentionally or intentionally, has become a growing concern and issue. This condition encourages the development of an accurate method for specifically detecting the presence or absence of pork contamination. The research was carried out on two different samples: (1) fresh pork to provide an in-house positive control and (2) samples of pork-based processed meat products (floss, meatballs, corned beef, and sausages), tested using DNA markers. The use of samples originating from processed pork food is to determine the effect of the processing process on DNA fragments and the robustness of the extraction method for the detection process used. The research aimed to detect pork DNA fragments using the quantitative polymerase chain reaction (qPCR) method. The study stages were extracting fresh pork and processed products using an RNA extraction kit, DNA extraction kit, and salt extraction, as well as measuring the purity and concentration of DNA/RNA using a spectrophotometer. The RNA extract was converted into complementary DNA (cDNA), and the DNA extract was analyzed using qPCR with specific primers for pork DNA (Sus scrofa). The results showed that the concentration of RNA and DNA extracts was 71.1–296.025 ng/uL and of various purity. All processed meat product samples and in-house positive controls were amplified in the Ct range of 23–28 ng/uL. In this case, the meat processing had no effect on the DNA of the processed meat products analyzed, so DNA fragments could be detected. DNA qPCR was more time efficient than cDNA qPCR because it did not require an RNA reverse transcription step. [ABSTRACT FROM AUTHOR]

Carbapenem resistance in Acinetobacter baumannii is a critical global health threat attributed to transferrable carbapenemase genes. Carbapenemase genotyping using polymerase chain reaction (PCR) presents a challenge in resource-limited settings because of its technical requirements. This study designed new loop-mediated isothermal amplification (LAMP) primers using multiple sequence alignment-based workflows, validated the primer performance against multiple target variants in silico, and developed novel LAMP assays (LAntRN-OXA23 and LAntRN-ISAba1) to detect the transferable blaOXA-23-like carbapenemase genes and ISAba1 elements in pure cultures and A. baumannii-spiked serum samples. The designed LAMP primers bind to the conserved regions of their highly polymorphic targets, with their in silico performance comparable with other published primers. The in vitro LAMP assays (using 30 PCR-profiled A. baumannii and 10 standard multidrug-resistant gram-negative isolates) have 100% concordance with the PCR-positive clinical samples, limits of detection as low as 1 pg/µL (200 copies/µL), and specificities of 57.89–100%. Both assays produced positive results when testing DNA samples (extracted using a commercial kit) from blaOXA-23-like and ISAba1-blaOXA-51-like PCR-positive A. baumannii-spiked normal human sera (five set-ups per target). In summary, the LAMP assays accurately detected the target genes and have applications in infection management, control, and point-of-care testing in resource-limited healthcare settings. [ABSTRACT FROM AUTHOR]

Mantidis Ootheca (sangpiaoxiao), the egg case of the mantis, is a type of insect-derived traditional medicine widely used in East Asia. However, species identification based on egg morphology is challenging, leading to the distribution of counterfeit and adulterated products. The use of inauthentic ingredients can pose serious health risks to consumers. This study aimed to develop PCR markers that can rapidly and accurately differentiate between authentic and counterfeit Mantidis Ootheca. The mitochondrial cytochrome c oxidase I (COI) region was sequenced in thirteen samples from four mantis species: Tenodera angustipennis, Statilia maculata, Hierodula patellifera, and T. sinensis. Four sets of SCAR primers were designed based on species-specific nucleotide polymorphisms, and a multiplex SCAR assay was developed by combining all sets of the primers. The sequence-characterized amplified region (SCAR) primers successfully produced amplicons for each target species, even with low-DNA templates or templates containing DNA from multiple samples. No amplification was observed for nontarget species. This study presents a novel approach for identifying authentic Mantidis Ootheca species using DNA-based diagnostic marker assays, which enable rapid and precise species identification. The SCAR assays developed in this study will aid in maintaining quality control and promoting the standardization of commercial Mantidis Ootheca products. [ABSTRACT FROM AUTHOR]

Sex identification in avian species is essential for biodiversity conservation and ecological studies. However, the sex of nearly half of the birds could not be identified based on their external appearance. It is difficult to visually identify sex to monitor the ecology and conservation of wild populations. In this study, we designed primer pairs for large white pelican using recombinase-based isothermal amplification combined with a lateral flow dipstick (RAA-LFD) assay for chromo-helicase-DNA binding protein (CHD) genes mapped to W chromosomes and an ultra-conserved element (UCE) located on chromosome 6, respectively. Our result showed that the raaW4-RAA-LFD can detect up to 0.1 ng of genomic DNA (gDNA) templates of female pelicans in 30 min at 39 ℃ and accurately distinguish female from male without any cross reactivity. RaaUCE2-RAA-LFD can amplify both male and female pelicans with a detection limit of 25 pg. To further evaluate the assay, 15 white pelicans of unknown sex were tested using the RAA-LFD assay and conventional polymerase chain reaction (PCR). The results of the raaW4-RAA-LFD assay were consistent with those of the conventional PCR. The developed RAA-LFD assay is equipped with field-deployable instruments and offers a field platform for rapid and reliable sex identification in pelicans. [ABSTRACT FROM AUTHOR]

Background: Consumer awareness of food adulteration is increasing nowadays. Motivated by economic gain, unethical meat producers try to blend halal meat such as beef with non-halal meat like rat meat (RM). Aim: This study aims to develop a real-time polymerase chain reaction (RT-PCR) analysis method to analyze the presence of RM in beef meatballs. Methods: This research was carried out in the following stages: primer design, DNA isolation, analysis of DNA isolates, the optimization of primer annealing temperature, primer specificity test, sensitivity, and repeatability. The validated RT-PCR method was then used to analyze the marketed meatball samples. Results: The result showed that the designed primer targeting on ND2 gene set rat mt-DNA (forward: ACTCCATATCTCTCACCATATTTCC; reverse: GGGTTAGGGTACTTAGGATTGTTAG), had good specificity at an optimal annealing temperature of 56.3oC over the other eight species. The developed RT-PCR method produces a limit detection value of 195.31 pg, coefficient of determination (R2) for linearity of 0.983, amplification efficiency (E) of 100%, and CV value for amplification response of 1.8%. The result showed that the developed RT-PCR method did not detect the presence of RM DNA in eight marketed beef meatball samples. Conclusion: The developed method meets the acceptance criteria for RT-PCR and can be used as a halal authentication method to identify the presence of RM in beef meatballs. [ABSTRACT FROM AUTHOR]

Congenital bilateral absence of vas deferens (CBAVD) is a urological syndrome of Wolffian ducts and is responsible for male infertility and obstructive azoospermia. This study is designed to explore the integrity of exon 10 of CFTR and its role in male infertility in a cohort of CBVAD patients in Pakistan. Genomic DNA was extracted from 17 male patients with CBAVD having clinical symptoms, and 10 healthy controls via phenol-chloroform method. Exon 10 of the CFTR gene was amplified, using PCR with specific primers and DNA screening was done by Sanger sequencing. Sequencing results were analyzed using freeware Serial Cloner, SnapGene, BioEdit and FinchTV. Furthermore, bioinformatics tools were used to analyze the mutations and their impact on the protein function and stability. We have identified 4 mutations on exon 10 of CFTR in 6 out of 17 patients. Two of the mutations were missense variants V456A, K464E, and the other two were silent mutations G437G, S431S. The identified variant V456A was present in 4 of the studied patients. Whereas, the presence of K464E in our patients further weighs on the crucial importance for its strategic location to influence the gene function at post-transcriptional and protein level. Furthermore, Polyphen-2 and SIFT analyze the mutations as harmful and deleterious. The recurrence of V456A and tactically conserved locality of K464E are evidence of their potential role in CBAVD patients and in male infertility. The data can contribute in developing genetic testing and treatment of CBAVD. [ABSTRACT FROM AUTHOR]

Fish substitution in fish products is an important issue in fish markets, as it is a widespread practice. An authentication protocol for Rohu, Thaila and Tilapia was developed by multiplex PCR. Three species-specific and one degenerate common forward primer were designed using the Cytb gene of the mitochondrial genome. These primers for Labeo rohita, Labeo catla and Oreochromis niloticus showed the fragment size of 235 bp, 186 bp and 506 bp on the agarose gel, respectively. The primers for L. rohita and L. catla were sensitive to 0.1 ng of DNA template, while for O. niloticus this value was 1 ng of DNA template. A total of 230 commercial samples (160 fried and 70 processed fish products) were screened, where 60% mislabeling in fried and 30% mislabeling in processed fish were found. This multiplex PCR protocol could give useful insights for food inspection and enforcement of regulatory food control. [ABSTRACT FROM AUTHOR]

Ichthyoplankton monitoring is crucial for stock assessments, offering insights into spawning grounds, stock size, seasons, recruitment, and changes in regional ichthyofauna. This study evaluates the efficiency of multi-marker DNA metabarcoding using mitochondrial cytochrome c oxidase subunit I (COI), 12S rRNA and 16S rRNA gene markers, in comparison to morphology-based methods for fish species identification in ichthyoplankton samples. Two transects with four coastal distance categories were sampled along the southern coast of Portugal, being each sample divided for molecular and morphological analyses. A total of 76 fish species were identified by both approaches, with DNA metabarcoding overperforming morphology—75 versus 11 species-level identifications. Linking species-level DNA identifications with higher taxonomic morphological identifications resolved several uncertainties associated with traditional methods. Multi-marker DNA metabarcoding improved fish species detection by 20–36% compared to using a single marker/amplicon, and identified 38 species in common, reinforcing the validity of our results. PERMANOVA analysis revealed significant differences in species communities based on the primer set employed, transect location, and distance from the coast. Our findings underscore the potential of DNA metabarcoding to assess ichthyoplankton diversity and suggest that its integration into routine surveys could enhance the accuracy and comprehensiveness of fish stock assessments. [ABSTRACT FROM AUTHOR]

Bovine leukemia virus (BLV) is the etiological agent of enzootic bovine leukosis and causes a persistent infection that can leave cattle with no symptoms. Many countries have been able to successfully eradicate BLV through improved detection and management methods. However, with the increasing novel molecular detection methods there have been few efforts to standardize these results at global scale. This study aimed to determine the interlaboratory accuracy and agreement of 11 molecular tests in detecting BLV. Each qPCR/ddPCR method varied by target gene, primer design, DNA input and chemistries. DNA samples were extracted from blood of BLV-seropositive cattle and lyophilized to grant a better preservation during shipping to all participants around the globe. Twenty nine out of 44 samples were correctly identified by the 11 labs and all methods exhibited a diagnostic sensitivity between 74 and 100%. Agreement amongst different assays was linked to BLV copy numbers present in samples and the characteristics of each assay (i.e., BLV target sequence). Finally, the mean correlation value for all assays was within the range of strong correlation. This study highlights the importance of continuous need for standardization and harmonization amongst assays and the different participants. The results underscore the need of an international calibrator to estimate the efficiency (standard curve) of the different assays and improve quantitation accuracy. Additionally, this will inform future participants about the variability associated with emerging chemistries, methods, and technologies used to study BLV. Altogether, by improving tests performance worldwide it will positively aid in the eradication efforts. [ABSTRACT FROM AUTHOR]

The Pinna nobilis, a Mediterranean mollusc, has suffered population declines due to a massive mortality event associated with various factors including the parasite Haplosporidium pinnae. Some populations show resilience, possibly due to local environmental conditions. In this study, a molecular multiplex PCR method was developed using species‐specific primers targeting Internal Transcribed Spacer (ITS) regions of P. nobilis and P. rudis, allowing accurate species identification and hybrid detection. Samples from Mediterranean areas were analysed, including putative hybrids and individuals from five other bivalve species. DNA was isolated, ITS regions were amplified and sequenced, and phylogenetic analyses confirmed species differentiation and primer specificity. The multiplex‐PCR successfully identified P. nobilis, P. rudis, and their hybrids based on distinct amplicon patterns. This study highlights the value of molecular tools in species conservation, especially for monitoring and managing hybridization, supporting effective biodiversity conservation strategies. [ABSTRACT FROM AUTHOR]

This document serves as a diagnostic protocol for Aromia bungii, commonly known as the red necked longhorn beetle. The beetle is originally from East Asia but has been introduced to Japan and Europe. It primarily infests Prunus species and is identified through signs such as larval frass accumulation, exit holes, and the presence of adults. Molecular tests are recommended for identification, especially when morphological examination is not possible. The document also provides a description and identification guide for Aromia bungii, including information on other similar species and details on larvae differentiation. It emphasizes the use of molecular methods for confirmation, particularly in new outbreaks, and offers guidelines for reporting and documentation. The document acknowledges the contributions of various individuals and organizations in its development and provides reference material and sequences for further research. [Extracted from the article]

This document is a diagnostic protocol for Anisogramma anomala, a pathogen that causes eastern filbert blight on European hazelnut trees. It provides information on identifying and detecting the pathogen, including its symptoms and characteristics. The document includes molecular tests for confirmation in critical cases and emphasizes the importance of early detection. It also provides guidance on reporting and documentation, as well as contact information for further information. The appendices provide instructions for isolating the organism and describe the media used for its growth. The document also includes instructions for conducting a real-time PCR test to detect A. anomala, with information on controls, interpretation of results, and performance characteristics. The test has been validated and shown to have high sensitivity and specificity. [Extracted from the article]

The effect of invasive species on existing biological systems has become a major concern in recent years. Countermeasures for invasive species were among the goals of the United Nations Biodiversity Conference (COP15). Cymbella janischii is an alien diatom that recently invaded Japan. Its algal blooms not only spoil the scenery of the river but also raise concerns about its impact on the ecosystem, including damage to fish populations. To monitor the invasion of this species and employ river management, we developed the specific detection assays for this species from environmental DNA, using a polymerase that distinguishes a single base difference at the 3' end of the primer. Three assays for amplifying nuclear-encoded large-subunit rRNA genes (P1, P2, and P3) successfully detected C. janischii without false positives in benthic samples from 12 rivers in Japan. There were no significant differences among the results obtained using the three assays. The three assays showed significant positive correlations with the microscopic observation results, having the advantage of detecting species with low population density. These assays can be performed using inexpensive equipment because they do not necessarily require real-time PCR. However, it can enhance specificity by adding a fluorescent probe to the internal sequence, if necessary. These detection assays can apply to a wide range of environmental samples and are expected to help elucidate the invasive characteristics and ecology of this species. [ABSTRACT FROM AUTHOR]

The spatial pattern of many pathogens that are transmitted by mosquitoes (Diptera: Culicidae) is changing due to globalization and climate change. Thus, surveillance of mosquito vectors is becoming increasingly widespread as basis for risk assessment and control. Species identification by loop‐mediated isothermal amplification (LAMP) assays is simple, fast and reliable. Specific primers for several mosquito species are available (Aedes aegypti, Aedes albopictus, Aedes geniculatus, Aedes japonicus, Aedes koreicus, species of the Anopheles funestus group and An. gambiae complex). In the present work, LAMP assays targeting the rDNA internal transcribed spacer region were developed for Ae. cretinus, a minor sister taxon of Ae. albopictus, and for Culex pipiens/Culex quinquefasciatus and Culex torrentium. The specificities of the primers designed in silico were confirmed by in vitro tests with DNA form non‐target species. Further, the release of DNA from mosquito stages (eggs, larvae, pupae, adults) was investigated, revealing that an incubation for 5 min at 80°C in water is suitable for LAMP. With this method, one specimen (egg, larva, pupa, adult) of a target species could be detected among 49 non‐targets. Thus, the assays are suitable for fast and reliable identification of mosquito species of all life stages by colour change visible to the naked eye, and they are operable under field conditions. [ABSTRACT FROM AUTHOR]

Fluorescence dye-based loop-mediated isothermal amplification (LAMP) is a sensitive nucleic acid detection method, but is limited to single-plex detection and may yield non-specific signals. In this study, we propose a bifunctional probe-based real-time LAMP amplification method for single-plexed or multiplexed detection. The bifunctional probe is derived by modifying the 5′ end of the fluorophore and an internal quencher on one of the LAMP primers; therefore, it can simultaneously be involved in the LAMP process and signal amplification. The fluorescence intensity undergoes a cumulative exponential increase during the incorporation of the bifunctional probe into double-stranded DNA amplicons. The bifunctional probe-based LAMP method is simplified and cost-effective, as the primer design and experimental operations align entirely with the ordinary LAMP. Different from other current probe-based methods, this method does not require additional enzymes, sequences, or special probe structures. Also, it is 10 min faster than several other probe-based LAMP methods. The bifunctional probe-based LAMP method allows the simultaneous detection of the target Vibrio parahaemolyticus DNA and the internal amplification control in a one-pot reaction, demonstrating its potential for multiplexed detection. [ABSTRACT FROM AUTHOR]

Objective: Environmental DNA (eDNA) detection is a transformative tool for ecological surveys which in many cases offers greater accuracy and cost-effectiveness for tracking low-density, cryptic species compared to conventional methods. For the use of targeted quantitative PCR (qPCR)-based eDNA detection, protocols typically require freshly prepared reagents for each sample, necessitating systematic evaluation of reagent stability within the functional context of eDNA standard curve preparation and environmental sample evaluation. Herein, we assessed the effects of long-term storage and freeze–thaw cycles on qPCR reagents for eDNA analysis across six assays. Results: Results demonstrate qPCR plates (containing pre-made PCR mix, primer-probe, and DNA template) remain stable at 4 °C for three days before thermocycling without fidelity loss irrespective of qPCR assay used. Primer-probe mixes remain stable for five months of − 20 °C storage with monthly freeze-thaw cycles also irrespective of qPCR assay used. Synthetic DNA stocks maintain consistency in standard curves and sensitivity for three months under the same conditions. These findings enhance our comprehension of qPCR reagent stability, facilitating streamlined eDNA workflows by minimizing repetitive reagent preparations. [ABSTRACT FROM AUTHOR]

Hb H disease is the most severe form of α-thalassemia compatible with post-natal life. Compound heterozygous α0-thalassemia− SEA deletion/α+-thalassemia− 3.7kb deletion is the commonest cause of Hb H disease in Thailand. Preimplantation genetics testing for monogenic disorders (PGT-M) is an alternative for couples at risk of the disorder to begin a pregnancy with a healthy baby. This study aims to develop a novel PCR protocol for PGT-M of Hb H disease− SEA/−3.7kb using multiplex fluorescent PCR. A novel set of primers for α+-thalassemia− 3.7kb deletion was developed and tested. The PCR protocol for α0-thalassemia− SEA deletion was combined for Hb H disease− SEA/−3.7kb genotyping. The PCR protocols were applied to genomic DNA extracted from subjects with different thalassemia genotypes and on whole genome amplification (WGA) products from clinical PGT-M cycles of the families at risk of Hb Bart's. The results were compared and discussed. The results showed three PCR products from α+-thalassemia− 3.7kb primer set, and three from α0thalassemiaSEA primer set. The results were consistent with the known thalassemia genotypes. The novel -α3.7 primers protocol was also tested on 37 WGA products from clinical PGT-M cycles giving accurate genotyping results and a satisfying amplification efficiency with the ADO rates of 2.7%, 0%, and 0% for HBA2, HBA1, and internal control fragments, respectively. This novel PCR protocol can precisely distinguish Hb H disease− SEA/−3.7kb from other genotypes. Additionally, this is the first PCR protocol for Hb H disease− SEA/−3.7kb which is optimal for PGT-M. [ABSTRACT FROM AUTHOR]

Congenital bilateral absence of vas deferens (CBAVD) is a urological syndrome of Wolffian ducts and is responsible for male infertility and obstructive azoospermia. This study is designed to explore the integrity of exon 10 of CFTR and its role in male infertility in a cohort of CBVAD patients in Pakistan. Genomic DNA was extracted from 17 male patients with CBAVD having clinical symptoms, and 10 healthy controls via phenol-chloroform method. Exon 10 of the CFTR gene was amplified, using PCR with specific primers and DNA screening was done by Sanger sequencing. Sequencing results were analyzed using freeware Serial Cloner, SnapGene, BioEdit and FinchTV. Furthermore, bioinformatics tools were used to analyze the mutations and their impact on the protein function and stability. We have identified 4 mutations on exon 10 of CFTR in 6 out of 17 patients. Two of the mutations were missense variants V456A, K464E, and the other two were silent mutations G437G, S431S. The identified variant V456A was present in 4 of the studied patients. Whereas, the presence of K464E in our patients further weighs on the crucial importance for its strategic location to influence the gene function at post-transcriptional and protein level. Furthermore, Polyphen-2 and SIFT analyze the mutations as harmful and deleterious. The recurrence of V456A and tactically conserved locality of K464E are evidence of their potential role in CBAVD patients and in male infertility. The data can contribute in developing genetic testing and treatment of CBAVD. [ABSTRACT FROM AUTHOR]

Schizophrenia poses a considerable disease burden, notwithstanding its relatively low incidence rate. The escalation in population size and mean age has led to a substantial rise in the incidence of illness linked to schizophrenia, particularly in countries with moderate levels of prosperity. Therefore, it is necessary to find a way to detect and recognize the illness as fast as possible to stop the consequences from occurring and stop symptoms from appearing before they even start. Within this study’s scope, fifteen distinct primers were selected randomly to determine whether or not they could recognize schizophrenia. To accomplish this, a Randomly Amplified Polymorphic DNA-polymerase chain reaction (RAPD-PCR) was conducted utilizing DNA samples obtained from individuals afflicted with the condition and those in good health. The outcomes of the gel electrophoresis and subsequent analysis revealed that solely three primers including C12, E02 and E03 exhibited monomorphic characteristics. However, it was observed that 80% of the primers, precisely eleven out of fifteen, exhibited polymorphism. The results indicated that among the 15 primers tested, the primer labeled as H01 failed to generate any detectable bands. Subsequent examination of the polymorphic primers revealed that the primer efficiency varied between 0 and 0.0755, while the discrimination power ranged from 0 to 20 percent. The study observed variations in the frequency of disease occurrence between patients and healthy individuals. H05 primer utilization yielded three distinct polymorphic bands exhibiting diverse lengths. The band exhibiting the greatest length measured 1190 bp, whereas the other two bands had 480 and 430 bp lengths respectively. The two polymorphic bands exhibited 100% prevalence in the patient population while being completely absent in the healthy control group. Based on the available data, it appears that utilizing this primer to identify schizophrenia is a valid and valuable claim. Overall, DNA-based diagnostics may overlook a number of difficulties as laboratories have the ability to extract DNA from various sources easily. In this scenario, molecular and genetic techniques may be crucial for diagnosing some diseases. [ABSTRACT FROM AUTHOR]

DNA markers and Multiplex-PCR have emerged as methods for species detection in processed meat products. The primary objective of this study is to design multiplex primer sequences for pork, rat, beef, and chicken, generating distinguishable amplicons through agarose gel electrophoresis for halal detection in processed meat products. Primer design involved utilizing mitochondrial genomic data and the NCBI-Primer BLAST site to obtain specific pork and beef primer sequences. In silico simulations, including single and multiplex-PCR, were conducted using Primer Pooler. In vitro validation encompassed Single-PCR and Multiplex-PCR annealing temperature optimization, using samples of chicken, beef, pork, and rat as well as processed meat products like meatballs, sausages, and nuggets. In vitro validation demonstrated that the halal marker gene's multiplex primer efficiently amplified the target sequence, specifically at the optimal annealing temperature of 58°C. Amplicons from beef (1,217 bp), pork (860 bp), rat (622 bp), and chicken (272 bp) primers could be distinguished on a 1.5% agarose gel. The study's results can aid in cost-effective and rapid halal testing and authentication of processed meat products, offering advantages over PCR with a single primer. [ABSTRACT FROM AUTHOR]

Mosquitoes are prime examples of vectors for various diseases such as malaria, the West Nile virus, elephantiasis, dengue fever, and yellow fever. The repeated use of chemical pesticides has created numerous obstacles and environmental risks including mosquito resistance to insecticides. This work aimed at assessing the larvicidal effect of chlorophyllin (a water-soluble substance obtained after removing the phytol tail from chlorophyll) and coumarin as photosensitizers, compared to the microbial insecticide Bacillus thuringiensis israelensis (Bti) and permethrin, a chemical insecticide, against the third larval instar of Culex pipiens larvae monitoring its mode of action and its genotoxic effect. Photosensitizers exposed to sunlight generate reactive oxygen species (ROS), with singlet oxygen (¹O2) capable of killing parasitic organisms primarily in aquatic systems. Our experiments demonstrated a high potential activity of Na-Cu chlorophyllin against mosquito larvae after at least 8 hours of incubation in the dark. The LC50 values were 0.22x10-3, 0.96x10-2, 13.7x10-2, and 4.59x10-1 mg/ l after 24 hours of exposure to chlorophyllin, Bti, permethrin, and coumarin, respectively. The molecular changes after treatment with chlorophyllin were tracked using RAPD-PCR with six arbitrary DNA primers. Results confirmed no significant changes or genetic damage after treatment with chlorophyll derivatives. [ABSTRACT FROM AUTHOR]

To prevent threats from pathogens such as Phytophthora species from international plant trade, molecular identification techniques are needed for rapid, accurate quarantine inspection. Here, for quarantine control in Japan, we developed a simple DNA extraction for plants and a practical detection method that combines multiplexed PCR using primers specific for Phytophthora species, for P. nicotianae, which is the only non-quarantine Phytophthora species, and as internal controls, for plants. For the new genus-level primer set, we modified previously reported genus-specific primers to improve detectability. The new primers were able to detect mycelial DNA of 155 taxa among Phytophthora clades 1–10, with a sensitivity of 100 fg/µL for three representative species, P. ramorum, P. kernoviae and P. nicotianae. In the PCRs using DNA from non-target species, amplification was observed for only three taxa, and for some strains, four taxa in a closely related genus. Duplex and triplex PCR of the genus-specific primers combined with previously reported plant primers verified the success of DNA extraction and PCR detection from diseased plant samples, and in the triplex PCR, whether the pathogen was diagnosed as P. nicotianae or not by the species-specific primer. The new method detected the pathogen in naturally infected and inoculated plants. The amplicons using the genus-specific primer have enough variation to be sequenced to identify the species. This new method can be used immediately for detecting Phytophthora species and for quarantine control in Japan. [ABSTRACT FROM AUTHOR]

Short‐Patch Double Illegitimate Recombination (SPDIR) has been recently identified as a rare mutation mechanism. During SPDIR, ectopic DNA single‐strands anneal with genomic DNA at microhomologies and get integrated during DNA replication, presumably acting as primers for Okazaki fragments. The resulting microindel mutations are highly variable in size and sequence. In the soil bacterium Acinetobacter baylyi, SPDIR is tightly controlled by genome maintenance functions including RecA. It is thought that RecA scavenges DNA single‐strands and renders them unable to anneal. To further elucidate the role of RecA in this process, we investigate the roles of the upstream functions DprA, RecFOR, and RecBCD, all of which load DNA single‐strands with RecA. Here we show that all three functions suppress SPDIR mutations in the wildtype to levels below the detection limit. While SPDIR mutations are slightly elevated in the absence of DprA, they are strongly increased in the absence of both DprA and RecA. This SPDIR‐avoiding function of DprA is not related to its role in natural transformation. These results suggest a function for DprA in combination with RecA to avoid potentially harmful microindel mutations, and offer an explanation for the ubiquity of dprA in the genomes of naturally non‐transformable bacteria. [ABSTRACT FROM AUTHOR]

DNA barcodes can provide accurate identification of plants. We used previously reported DNA primers targeting the internal transcribed spacer (ITS1) region of the nuclear ribosomal cistron, internal transcribed spacer (ITS2), and chloroplast trnL (UAA) intron to identify four trees at Bergen Community College. Two of the four trees were identified as Acer rubrum and Fagus sylvatica. However, Quercus was only identified at the genus level, and the fourth tree did not show similar identification between barcodes. Next-generation sequencing of 16S rRNA genes showed that the predominant bacterial communities in the rhizosphere mainly consisted of the Pseudomonadota, Actinomycetota, Bacteroidota, and Acidobacteriota. A. rubrum showed the most diverse bacterial community while F. sylvatica was less diverse. The genus Rhodoplanes showed the highest relative bacterial abundance in all trees. Fungal ITS sequence analysis demonstrated that the communities predominantly consisted of the Ascomycota and Basidiomycota. Quercus showed the highest fungi diversity while F. sylvatica showed the lowest. Russula showed the highest abundance of fungi genera. Average similarity values in the rhizosphere for fungi communities at the phylum level were higher than for bacteria. However, at the genus level, bacterial communities showed higher similarities than fungi. Similarity values decreased at lower taxonomical levels for both bacteria and fungi, indicating each tree has selected for specific bacterial and fungal communities. This study confirmed the distinctiveness of the microbial communities in the rhizosphere of each tree and their importance in sustaining and supporting viability and growth but also demonstrating the limitations of DNA barcoding with the primers used in this study to identify genus and species for some of the trees. The optimization of DNA barcoding will require additional DNA sequences to enhance the resolution and identification of trees at the study site. [ABSTRACT FROM AUTHOR]

Recently, extracellular vesicles (EVs) have been developed as therapeutic targets for various diseases. Biodistribution is crucial for EVs intended for therapeutic purposes because it can determine the degree of on‐ and off‐target effects. This study aimed to explore techniques to evaluate the biodistribution of unmodified EVs. We devised a novel quantitative polymerase chain reaction (qPCR)‐based assay to detect unmodified EVs by targeting mitochondrial deoxyribonucleic acid (mtDNA), a constituent of EVs. We focused on specific mtDNA regions that exhibited homologous variations distinct from their rodent mtDNA counterparts to establish this analytical approach. Herein, we successfully designed primers and probes targeting human and rodent mtDNA sequences and developed a highly specific and sensitive qPCR method. Furthermore, the quantification range of EVs isolated from various cells differed based on the manufacturer and cell source. IRDye 800CW‐labelled Expi293F EV mimetics were administered to the animals via the tail vein to compare the imaging test and mtDNA‐qPCR results. The results obtained from imaging tests and mtDNA‐qPCR to investigate EV biodistribution patterns revealed differences. The results revealed that our newly developed method effectively determined the biodistribution of unmodified EVs with high sensitivity and reproducibility. [ABSTRACT FROM AUTHOR]

[Objective] The traditional morphological classification combined with the DNA barcode method was used to classify the important natural enemies of the genus Anteris, to identify the resources of the genus (Anteris) in the wild fruit forests of the Xitianshan Mountains in the Ili River Valley of Xinjiang, and to amplify its molecular data in NCBI, so as to facilitate the rapid and accurate identification of subsequent studies, and to lay the foundation for the studies on the biology, molecular biology and ecology of the genus Anteris. [Method] Specimens of the family Scelionidae obtained by net sweeping and yellow disetrapping in the wild fruit forests of Xitianshan Mountain, Ili River Valley, Xinjiang, China, in 2021-2023 were collated, and morphological characteristics were observed under a digital stereomicroscope, and species of the genus Anteris were selected. On the basis of traditional morphometrics identification, the genomic DNA of the species was extracted by using a non-destructive extraction method, and the genes were amplified using universal primers. COI and 28S rDNA sequences were amplified with universal primers, which were used as DNA barcodes of the species, and compared with the COI sequences of other species in the family of Scelionidae on the NCBI website, to analyze the base composition and calculate the genetic distances; A phylogenetic tree based on the maximum likelihood method was constructed, and preliminary phylogenetic analyses were carried out. [Result] We found one new Chinesegenus Anteris, and two new Chinesespecies-Anteris simulans and Anteris szelényii, and provided morphological descriptions of the new genera and species, as well as morphological character pictures We obtained COI and 28S rDNA sequences of the two new species. It could be seen that the intraspecific genetic distances of A. simulans were in the range of 0.000 0.003, and the interspecific genetic distances between A. simulans and A. szelényii with A. bilineata were 0.095 and 0.019, respectively, which were both smaller than the maximum intraspecific genetic distances of A. simulans, which was more closely related to A. bilineata. [Conclusion] The newly discovered A. simulans and A. szelényi in the study further enrich the resource data of Seelionidae in China and the world, and are of great significance for the conservation and utilisation of the taxa of the family Scelionidae. [ABSTRACT FROM AUTHOR]

The human gut microbiota refers to a diverse community of microorganisms that symbiotically exist in the human intestinal system. Altered microbial communities have been linked to many human pathologies. However, there is a lack of rapid and efficient methods to assess gut microbiota signatures in practice. To address this, we established an appraisal system containing 45 quantitative real-time polymerase chain reaction (qPCR) assays targeting gut core microbes with high prevalence and/or abundance in the population. Through comparative genomic analysis, we selected novel species-specific genetic markers and primers for 31 of the 45 core microbes with no previously reported specific primers or whose primers needed improvement in specificity. We comprehensively evaluated the performance of the qPCR assays and demonstrated that they showed good sensitivity, selectivity, and quantitative linearity for each target. The limit of detection ranged from 0.1 to 1.0 pg/µL for the genomic DNA of these targets. We also demonstrated the high consistency (Pearson's r = 0.8688, P < 0.0001) between the qPCR method and metagenomics next-generation sequencing (mNGS) method in analyzing the abundance of selected bacteria in 22 human fecal samples. Moreover, we quantified the dynamic changes (over 8 weeks) of these core microbes in 14 individuals using qPCR, and considerable stability was demonstrated in most participants, albeit with significant individual differences. Overall, this study enables the simple and rapid quantification of 45 core microbes in the human gut, providing a promising tool to understand the role of gut core microbiota in human health and disease. Key points: • A panel of original qPCR assays was developed to quantify human gut core microbes. • The qPCR assays were evaluated and compared with mNGS using real fecal samples. • This method was used to dynamically profile the gut core microbiota in individuals. [ABSTRACT FROM AUTHOR]

Background: The Anopheles dirus complex plays a significant role as a malaria vector in the Greater Mekong Subregion (GMS), with varying degrees of vector competence among species. Accurate identification of sibling species in this complex is essential for understanding malaria transmission dynamics and deploying effective vector control measures. However, the original molecular identification assay, Dirus allele-specific polymerase chain reaction (AS-PCR), targeting the ITS2 region, has pronounced nonspecific amplifications leading to ambiguous results and misidentification of the sibling species. This study investigates the underlying causes of these inconsistencies and develops new primers to accurately identify species within the Anopheles dirus complex. Methods: The AS-PCR reaction and thermal cycling conditions were modified to improve specificity for An. dirus member species identification. In silico analyses with Benchling and Primer-BLAST were conducted to identify problematic primers and design a new set for Dirus complex species identification PCR (DiCSIP). DiCSIP was then validated with laboratory and field samples of the An. dirus complex. Results: Despite several optimizations by reducing primer concentration, decreasing thermal cycling time, and increasing annealing temperature, the Dirus AS-PCR continued to produce inaccurate identifications for Anopheles dirus, Anopheles scanloni, and Anopheles nemophilous. Subsequently, in silico analyses pinpointed problematic primers with high Guanine-Cytosine (GC) content and multiple off-target binding sites. Through a series of in silico analyses and laboratory validation, a new set of primers for Dirus complex species identification PCR (DiCSIP) has been developed. DiCSIP primers improve specificity, operational range, and sensitivity to identify five complex member species in the GMS accurately. Validation with laboratory and field An. dirus complex specimens demonstrated that DiCSIP could correctly identify all samples while the original Dirus AS-PCR misidentified An. dirus as other species when used with different thermocyclers. Conclusions: The DiCSIP assay offers a significant improvement in An. dirus complex identification, addressing challenges in specificity and efficiency of the previous ITS2-based assay. This new primer set provides a valuable tool for accurate entomological surveys, supporting effective vector control strategies to reduce transmission and prevent malaria re-introducing in the GMS. [ABSTRACT FROM AUTHOR]

Background: Malaria transmission in Tanzania is driven by mosquitoes of the Anopheles gambiae complex and Anopheles funestus group. The latter includes An. funestus s.s., an anthropophilic vector, which is now strongly resistant to public health insecticides, and several sibling species, which remain largely understudied despite their potential as secondary vectors. This paper provides the initial results of a cross-country study of the species composition, distribution and malaria transmission potential of members of the Anopheles funestus group in Tanzania. Methods: Mosquitoes were collected inside homes in 12 regions across Tanzania between 2018 and 2022 using Centres for Disease Control and Prevention (CDC) light traps and Prokopack aspirators. Polymerase chain reaction (PCR) assays targeting the noncoding internal transcribed spacer 2 (ITS2) and 18S ribosomal DNA (18S rDNA) were used to identify sibling species in the An. funestus group and presence of Plasmodium infections, respectively. Where DNA fragments failed to amplify during PCR, we sequenced the ITS2 region to identify any polymorphisms. Results: The following sibling species of the An. funestus group were found across Tanzania: An. funestus s.s. (50.3%), An. parensis (11.4%), An. rivulorum (1.1%), An. leesoni (0.3%). Sequencing of the ITS2 region in the nonamplified samples showed that polymorphisms at the priming sites of standard species-specific primers obstructed PCR amplification, although the ITS2 sequences closely matched those of An. funestus s.s., barring these polymorphisms. Of the 914 samples tested for Plasmodium infections, 11 An. funestus s.s. (1.2%), and 2 An. parensis (0.2%) individuals were confirmed positive for P. falciparum. The highest malaria transmission intensities [entomological inoculation rate (EIR)] contributed by the Funestus group were in the north-western region [108.3 infectious bites/person/year (ib/p/y)] and the south-eastern region (72.2 ib/p/y). Conclusions: Whereas An. funestus s.s. is the dominant malaria vector in the Funestus group in Tanzania, this survey confirms the occurrence of Plasmodium-infected An. parensis, an observation previously made in at least two other occasions in the country. The findings indicate the need to better understand the ecology and vectorial capacity of this and other secondary malaria vectors in the region to improve malaria control. [ABSTRACT FROM AUTHOR]

Mushroom poisoning contributes significantly to global foodborne diseases and related fatalities. Amanita mushrooms frequently cause such poisonings; however, identifying these toxic species is challenging due to the unavailability of fresh and intact samples. It is often necessary to analyze residues, vomitus, or stomach extracts to obtain DNA sequences for the identification of species responsible for causing food poisoning. This usually proves challenging to obtain usable DNA sequences that can be analyzed using conventional molecular biology techniques. Therefore, this study aimed to develop a DNA mini-barcoding method for the identification of Amanita species. Following the evaluation and optimization of universal primers for DNA mini-barcoding in Amanita mushrooms, we found that the internal transcribed spacer (ITS) gene sequence primer ITS-a was the most suitable DNA barcode primer for identifying Amanita species. Forty-three Amanita samples were subsequently amplified and sequenced. The sequences obtained were analyzed for intra- and inter-species genetic distances, and a phylogenetic tree was constructed. The findings indicated that the designed primers had strong universality among the Amanita samples and could accurately identify the target gene fragment with a length of 290 bp. Notably, the DNA mini-barcode accurately identified the 43 Amanita samples, demonstrating high consistency with the conventional DNA barcode. Furthermore, it effectively identified DNA from digested samples. In summary, this DNA mini-barcode is a promising tool for detecting accidental ingestion of toxic Amanita mushrooms. It may be used as an optimal barcode for species identification and traceability in events of Amanita-induced mushroom poisoning. Key points: • Development of a DNA mini-barcoding method for Amanita species identification without fresh samples. • The ITS-a primer set was optimized for robust universality in Amanita samples. • The mini-barcode is suitable for screening toxic mushroom species in mushroom poisoning cases. [ABSTRACT FROM AUTHOR]

Polymerase Chain Reaction (PCR) amplification is widely used for retrieving information from DNA storage. During the PCR amplification process, nonspecific pairing between the 3' end of the primer and the DNA sequence can cause cross-talk in the amplification reaction, leading to the generation of interfering sequences and reduced amplification accuracy. To address this issue, we propose an efficient coding algorithm for PCR amplification information retrieval (ECA-PCRAIR). This algorithm employs variable-length scanning and pruning optimization to construct a codebook that maximizes storage density while satisfying traditional biological constraints. Subsequently, a codeword search tree is constructed based on the primer library to optimize the codebook, and a variable-length interleaver is used for constraint detection and correction, thereby minimizing the likelihood of nonspecific pairing. Experimental results demonstrate that ECA-PCRAIR can reduce the probability of nonspecific pairing between the 3' end of the primer and the DNA sequence to 2–25%, enhancing the robustness of the DNA sequences. Additionally, ECA-PCRAIR achieves a storage density of 2.14–3.67 bits per nucleotide (bits/nt), significantly improving storage capacity. [ABSTRACT FROM AUTHOR]

Molecular studies of fungi within the order Laboulbeniales (Ascomycota, Pezizomycotina) have been hampered for years because of their minute size, inability to grow in axenic culture, and lack of reliable and cost-efficient DNA extraction protocols. In particular, the genus Laboulbenia is notorious for low success with DNA extraction and polymerase chain reaction (PCR) amplification. This is attributed to the presence of melanin, a molecule known to inhibit PCR, in the cells. We evaluated the efficacy of a standard single cell-based DNA extraction protocol by halving the recommended amount of reagents to reduce the cost per extraction and adding bovine serum albumin (BSA) during the multiple displacement amplification step to reverse the effect of melanin. A total of 196 extractions were made, 111 of which were successful. We found that halving the reagents used in the single cell-based extraction kit did not significantly affect the probability of successful DNA extraction. Using the halved protocol reduces cost and resource consumption. Moreover, there was no significant difference in the probability of successfully extracting DNA based on whether BSA was added or not, suggesting that the amount of melanin present in cells of the thallus has no major inhibitory effect on PCR. We generated 277 sequences from five loci, but amplification of the internal transcribed spacer region, the mitochondrial small subunit rDNA, and protein-coding genes remains challenging. The probability of successfully extracting DNA from Laboulbeniales was also impacted by specimen storage methods, with material preserved in > 95% ethanol yielding higher success rates compared to material stored in 70% ethanol and dried material. We emphasize the importance of proper preservation of material and propose the design of Laboulbeniales-specific primers to overcome the problems of primer mismatches and contaminants. Our new insights apply not only to the genus Laboulbenia; Laboulbeniales generally are understudied, and the vast majority of species remain unsequenced. New and approachable molecular developments will benefit the study of Laboulbeniales, helping to elucidate the true diversity and evolutionary relationships of these peculiar microfungi. [ABSTRACT FROM AUTHOR]

Areca palm velarivirus 1 (APV1) is one of the main pathogen causing yellow leaf disease, and leading to considerable losses in the Areca palm industry. The detection methods for APV1 are primarily based on phenotype determination and molecular techniques, such as polymerase chain reaction (PCR). However, a single PCR has limitations in accuracy and sensitivity. Therefore, in the present study, we established a dual RT-PCR APV1-detection system with enhanced accuracy and sensitivity using two pairs of specific primers, YLDV2-F/YLDV2-R and YLDV4-F/YLDV4-R. Moreover, two cDNA fragments covering different regions of the viral genome were simultaneously amplified, with PCR amplicon of 311 and 499 bp, respectively. The dual RT-PCR detection system successfully amplified the two target regions of the APV1, demonstrating high specificity and sensitivity and compensating for the limitations of single-primer detection methods. We tested 60 Areca palm samples from different geographical regions, highlighting its advantages in that the dual RT-PCR system efficiently and accurately detected APV1 in samples across diverse areas. The dual RT-PCR APV1 detection system provides a rapid, accurate, and sensitive method for detecting the virus and offers valuable technical support for research in preventing and managing yellow leaf diseases caused by APV1 in Areca palms. Moreover, the findings of this study can serve as a reference for establishing similar plants viral detection systems in the future. [ABSTRACT FROM AUTHOR]

Seafood mislabeling threatens customer rights and causes economic loss worldwide. The information on seafood misrepresentation in Thailand is still lacking, and the investigation and monitoring program must be well established. This study investigated the mislabeling status of imported seafood in Thailand using the DNA barcoding technique. A total of 45 imported seafood products from five distributors were included. Scientific, common, local, and market names of seafood samples were obtained from FAO and Fishbase databases. DNA was extracted, and PCR was performed using a universal primer targeting the COI gene. Species of each sample were identified with over 98% similarity based on COI sequence analysis. DNA sequence revealed 11 mislabeled samples. Among substituted species, Pangasianodon hypophthalmus and Thunnus maccoyii were found to be endangered species according to IUCN status. Products obtained from Brand-C showed the highest mislabeling rate (42.85%). The phylogenetic analysis adopted with the TIM2+F+I+G4 model showed the sequenced DNA similar to the NCBI database reference sequence. Overall, mislabeled products of imported seafood were found at the rate of 24.44%, suggesting that strict surveillance for seafood substitution should be implemented in Thailand. [ABSTRACT FROM AUTHOR]

The present study was conducted utilizing collected thrips individuals from 39 localities in cereal production areas of Lakes of Region, Turkey during 2016–2017. Thrips individuals were sampled from plant foliage and ears using the destructive sample method (randomly in each field) and strike method (in each field, 100 beats). Specimens were transferred with a fine brush to 1.5 ml eppendorf tubes containing 95% ethanol and stored at -20 °C until analysis. Specimens were retrieved after the first step of DNA extraction and mounted onto slides using Canada balsam. Mitochondrial DNA Cytochrome Oxidase I gene location is used in the diagnosis of thrips. Polymerase Chain Reaction was performed using universal primers. 629–641 bp was obtained in the Cytochrome Oxidase I gene region of 59 individuals, including Haplothrips cerealis and Haplothrips tritici after morphological identification. Molecular characterization revealed that all the sequenced specimens were Haplothrips tritici. [ABSTRACT FROM AUTHOR]

Mitochondrial DNA replication is initiated by the transcription of mitochondrial RNA polymerase (mtRNAP), as mitochondria lack a dedicated primase. However, the mechanism determining the switch between continuous transcription and premature termination to generate RNA primers for mitochondrial DNA (mtDNA) replication remains unclear. The pentatricopeptide repeat domain of mtRNAP exhibits exoribonuclease activity, which is required for the initiation of mtDNA replication in Drosophila. In this review, we explain how this exonuclease activity contributes to primer synthesis in strand-coupled mtDNA replication, and discuss how its regulation might co-ordinate mtDNA replication and transcription in both Drosophila and mammals. [ABSTRACT FROM AUTHOR]

Molecular tools are an indispensable part of ecology and biodiversity sciences and implemented across all biomes. About a decade ago, the use and implementation of environmental DNA (eDNA) to detect biodiversity signals extracted from environmental samples opened new avenues of research. Initial eDNA research focused on understanding population dynamics of target species. Its scope thereafter broadened, uncovering previously unrecorded biodiversity via metabarcoding in both well‐studied and understudied ecosystems across all taxonomic groups. The application of eDNA rapidly became an established part of biodiversity research, and a research field by its own. Here, we revisit key expectations made in a land‐mark special issue on eDNA in Molecular Ecology in 2012 to frame the development in six key areas: (1) sample collection, (2) primer development, (3) biomonitoring, (4) quantification, (5) behaviour of DNA in the environment and (6) reference database development. We pinpoint the success of eDNA, yet also discuss shortfalls and expectations not met, highlighting areas of research priority and identify the unexpected developments. In parallel, our retrospective couples a screening of the peer‐reviewed literature with a survey of eDNA users including academics, end‐users and commercial providers, in which we address the priority areas to focus research efforts to advance the field of eDNA. With the rapid and ever‐increasing pace of new technical advances, the future of eDNA looks bright, yet successful applications and best practices must become more interdisciplinary to reach its full potential. Our retrospect gives the tools and expectations towards concretely moving the field forward. [ABSTRACT FROM AUTHOR]

To evaluate the impact of Titanium dioxide nanoparticles on pigments, minerals, and essential oil of Mentha spicata L. five treatments of biologically and chemically synthesized TiO2NPs were applied to spearmint leaves. Results showed that 50 mg/L BNT-treated plants had the highest contents of chlorophyll (a) and total chlorophyll, while 25 mg/l CNT-treated plants recorded the highest carotenoids and micronutrients (Fe, Mn, Cu, Na, and Zn) contents. Spearmint oil constituents were determined by Gas Chromatography-Mass spectroscopy (GC-MS), which demonstrated the positive effect of TiO2NPs on improving the spearmint oil constituents, as some therapeutic compounds appeared in CNT, BNT, CNTN, and PC compared to the negative control. Also, the percentage of some compounds increased in all treatments, while the percentage of the toxic compound isopulegone decreased or disappeared at all. Random Amplified Polymorphic DNA (RAPD) markers were also used for the assessment of genetic variation between different treatments of Titanium dioxide nanoparticles on Mentha spicata L. in comparison with the control. A total of 10 arbitrary sequence primers were evaluated. All 10 primers used for the RAPD analysis showed consistent band patterns. In total, scorable bands were observed with the primers. The total number of amplicons produced per primer varied from 7 for OPA-09 and OPB-10 to as many as 13 bands for OPA-4. The average number of bands per primer was 9.9. Out of 99 bands, 31 were polymorphic (31.31%). The average number of polymorphic RAPD bands was 3.1 per primer. The highest similarity (94%) with the negative control was recorded in spearmint leaf treated with Titanium dioxide nanoparticles that were chemical source-derived amended with nitrogen, while spearmint leaf treated with Titanium dioxide nanoparticles that biological source-derived amended with nitrogen was found to show the least similarity (88%) with the negative control. In this concern, RAPD results have been suggested to be useful fast methods for comparing genetic changes and variation in plants. Overall, the results of the present investigation indicated that the foliar application of TiO2NPs (CNT, BNT, and CNTN) on Mentha spicata L. has a significant positive effect on micronutrients and pigment contents, besides improving the spearmint oil quality. The differences within treatments were also affirmed by the genetic markers of the RAPD technique. [ABSTRACT FROM AUTHOR]

Toward the construction of robotic and cybernetic systems with molecular reactions, development of a reaction that can rapidly generate single-stranded DNA (ssDNA) molecules in response to an input signal is an essential demand. This study explored the cascading of DNA generation reactions employing DNA polymerase and nicking endonuclease to achieve significant amplification of ssDNA molecules serving as signals to direct and fuel the operation of DNA-based systems. The modular architecture allows for interconnection with other reactions through primer-binding sequence or template design, making it adaptable to various molecular robotic components. The research aims to contribute to the development of efficient and reliable amplification circuits for molecular robotics and cybernetics. The cascading reactions, implemented up to three layers, exhibit enhanced amplification rates and sensitivities at physiological temperatures, enabling stable hybridization with complementary sequences. The investigation reveals the potential of the proposed approach to bridge the molecular quantity gap and restore signals in molecular systems including molecular robots and related applications. The experimental validation demonstrates the feasibility of achieving up to 100,000-fold amplification in response to low concentrations of primers within two hours, driving the structural transformation of DNA probes and nanomotors, while suppressing non-specific leak amplification, thereby showcasing practical applicability. The study's findings address fundamental challenges in ssDNA amplification and opens avenues for creating intelligent systems composed of molecular components with increased sensitivity and responsiveness. [ABSTRACT FROM AUTHOR]

A significant challenge and threat to public health have been created by the COVID-19 pandemic for the entire global population. The study aimed to compare the SARS-CoV-2 RNA detection capabilities of available primers and probes to identify the most reliable, efficient, and affordable method. From 200 previously detected samples of SARS CoV-2, 94 samples were selected randomly and used for the optimization of our primers and probes. We compared our results with two kits that have been approved by the health authority. In addition, we evaluated the detectability of each gene. The study compared the diagnostic performance of different gene combinations for COVID-19 detection using kits A and B and a novel approach combining RdRp, N, and E genes. Results showed that the combined approach exhibited superior discriminatory power, particularly with the inclusion of the E gene, boasting area under the curve (AUC) values of 83.3%, 79.1%, and 93.7% for the respective genes. Kit B, with Orf1ab and N genes, outperformed Kit A (RdRp and S genes), with AUC values of 81.2% and 90.6% versus 80.2% and 75%, respectively. The chart representation highlighted gene detection frequencies across various cycle threshold (Ct) ranges, demonstrating robust identification within the 20.1-30 Ct range across all kits and genes, emphasizing the reliability of detection within specific intervals. Combining RdRp, N, and E genes showed the highest accuracy for COVID-19 diagnosis, particularly with the E gene. Detection was most reliable within the 20.1-30 Ct range across all gene combinations and kits. [ABSTRACT FROM AUTHOR]

Background: This study investigates the genetic characteristics of Capillaria isolates from the infected fish, Bagrus bajad, and their relation to human Capillaria philippinensis using Random Amplified Polymorphic DNA (RAPD-PCR) analysis. Fifteen fish Capillaria were isolated and compared to identified human C. philippinensis using six primers: M-are, M-1, G-7, G-11, G-15, and G-18. Results: All six primers successfully amplified DNA, highlighting their efficacy in distinguishing between human and fish Capillaria isolates. The analysis revealed distinctive banding patterns between fish and human isolates, with variations in size and number of DNA fragments. Additionally, genetic similarity analysis showed intriguing patterns of relatedness, with certain pairs exhibiting high similarity percentages. Comparative assessment of RAPD polymorphism demonstrated consistent findings of 100% polymorphism across all primers. The Unweighted Pair Group Method with Arithmetic Mean Algorithm (UPGMA) evaluated the closest relationship between human and fish isolates. These results underscore the utility of RAPD analysis in delineating the genetic diversity among Capillaria isolates from different hosts. Conclusion: Overall, this study contributes to our understanding of the genetic variability and relatedness among Capillaria isolates, shedding light on their evolutionary dynamics and zoonotic potential. [ABSTRACT FROM AUTHOR]

A targeted metabologenomic method was developed to selectively discover terminal oxazole‐bearing natural products from bacteria. For this, genes encoding oxazole cyclase, a key enzyme in terminal oxazole biosynthesis, were chosen as the genomic signature to screen bacterial strains that may produce oxazole‐bearing compounds. Sixteen strains were identified from the screening of a bacterial DNA library (1,000 strains) using oxazole cyclase gene‐targeting polymerase chain reaction (PCR) primers. The PCR amplicon sequences were subjected to phylogenetic analysis and classified into nine clades. 1H−13C coupled‐HSQC NMR spectra obtained from the culture extracts of the hit strains enabled the unequivocal detection of the target compounds, including five new oxazole compounds, based on the unique 1JCH values and chemical shifts of oxazole: lenzioxazole (1) possessing an unprecedented cyclopentane, permafroxazole (2) bearing a tetraene conjugated with carboxylic acid, tenebriazine (3) incorporating two modified amino acids, and methyl‐oxazolomycins A and B (4 and 5). Tenebriazine displayed inhibitory activity against pathogenic fungi, whereas methyl‐oxazolomycins A and B (4 and 5) selectively showed anti‐proliferative activity against estrogen receptor‐positive breast cancer cells. This metabologenomic method enables the logical and efficient discovery of new microbial natural products with a target structural motif without the need for isotopic labeling. [ABSTRACT FROM AUTHOR]

A targeted metabologenomic method was developed to selectively discover terminal oxazole‐bearing natural products from bacteria. For this, genes encoding oxazole cyclase, a key enzyme in terminal oxazole biosynthesis, were chosen as the genomic signature to screen bacterial strains that may produce oxazole‐bearing compounds. Sixteen strains were identified from the screening of a bacterial DNA library (1,000 strains) using oxazole cyclase gene‐targeting polymerase chain reaction (PCR) primers. The PCR amplicon sequences were subjected to phylogenetic analysis and classified into nine clades. 1H−13C coupled‐HSQC NMR spectra obtained from the culture extracts of the hit strains enabled the unequivocal detection of the target compounds, including five new oxazole compounds, based on the unique 1JCH values and chemical shifts of oxazole: lenzioxazole (1) possessing an unprecedented cyclopentane, permafroxazole (2) bearing a tetraene conjugated with carboxylic acid, tenebriazine (3) incorporating two modified amino acids, and methyl‐oxazolomycins A and B (4 and 5). Tenebriazine displayed inhibitory activity against pathogenic fungi, whereas methyl‐oxazolomycins A and B (4 and 5) selectively showed anti‐proliferative activity against estrogen receptor‐positive breast cancer cells. This metabologenomic method enables the logical and efficient discovery of new microbial natural products with a target structural motif without the need for isotopic labeling. [ABSTRACT FROM AUTHOR]

The high prevalence of antibiotic resistant bacteria (ARB) in several environments is a great concern threatening human health. Particularly, wastewater treatment plants (WWTP) become important contributors to the dissemination of ARB to receiving water bodies, due to the inefficient management or treatment of highly antibiotic-concentrated wastewaters. Hence, it is vital to develop molecular tools that allow proper monitoring of the genes encoding resistances to these important therapeutic compounds (antibiotic resistant genes, ARGs). For an accurate quantification of ARGs, there is a need for sensitive and robust qPCR assays supported by a good design of primers and validated protocols. In this study, eleven relevant ARGs were selected as targets, including aadA and aadB (conferring resistance to aminoglycosides); ampC, blaTEM, blaSHV, and mecA (resistance to beta-lactams); dfrA1 (resistance to trimethoprim); ermB (resistance to macrolides); fosA (resistance to fosfomycin); qnrS (resistance to quinolones); and tetA(A) (resistance to tetracyclines). The in silico design of the new primer sets was performed based on the alignment of all the sequences of the target ARGs (orthology grade > 70%) deposited in the Kyoto Encyclopedia of Genes and Genomes (KEGG) database, allowing higher coverages of the ARGs' biodiversity than those of several primers described to date. The adequate design and performance of the new molecular tools were validated in six samples, retrieved from both natural and engineered environments related to wastewater treatment. The hallmarks of the optimized qPCR assays were high amplification efficiency (> 90%), good linearity of the standard curve (R2 > 0.980), repeatability and reproducibility across experiments, and a wide linear dynamic range. The new primer sets and methodology described here are valuable tools to upgrade the monitorization of the abundance and emergence of the targeted ARGs by qPCR in WWTPs and related environments. [ABSTRACT FROM AUTHOR]