Search

Accurate temperature measurement in one living cell is of great significance for understanding biological functions and regulation. Here, a nanopipet electric thermometer (NET) is established for real-time intracellular temperature measurement. Based on the temperature-controlled ion migration, the temperature change in solution results in altered ion mobilities and ion distributions, which can be converted to the thermoelectric responses of NET in a galvanostatic configuration. The exponential relationship between the voltage and the temperature promises highly sensitive thermoelectric responses up to 11.1 mV K–1, which is over an order of magnitude higher than previous thermoelectric thermometry. Moreover, the NET exhibits superior thermal resolution of 25 mK and spatiotemporal resolution of 100 nm and 0.9 ms as well as excellent stability and reproducibility. Benefiting from these unique features, both thermal fluctuations in steady-state cells and heat generation and dissipation upon drug administration can be successfully monitored, which are hardly achieved by current methods. By using NET, thermal heterogeneities of single cancer cells during immunotherapy were reported first in this work, in which the increased intracellular temperature was demonstrated to be associated with the survival benefit and resistance of cancer cells in immunotherapy. This work not only provides a reliable method for microscopic temperature monitoring but also gains new insights to elucidate the mechanism of immune evasion and therapeutic resistance.

Biological channels can rapidly and continuously modulate ion transport behaviors in response to external stimuli, which play essential roles in manipulating physiological and pathological processes in cells. Here, to mimic the biological channels, a bionic nanochannel is developed by synergizing a cationic silicon-substituted rhodamine (SiRh) with a glass nanopipette for transmembrane single-cell quantification. Taking the fast and reversible nucleophilic addition reaction between glutathione (GSH) and SiRh, the bionic nanochannel shows a fast and reversible response to GSH, with its inner-surface charges changing between positive and negative charges, leading to a distinct and reversible switch in ionic current rectification (ICR). With the bionic nanochannel, spatiotemporal-resolved operation is performed to quantify endogenous GSH in a single cell, allowing for monitoring of intracellular GSH fluctuation in tumor cells upon photodynamic therapy and ferroptosis. Our results demonstrate that it is a feasible tool for in situquantification of the endogenous GSH in single cells, which may be adapted to addressing other endogenous biomolecules in single cells by usage of other stimuli-responsive probes.

Electrochemiluminescence (ECL) imaging, as an optical technology, has been developed at full tilt in the field of life science and nanomaterials. However, the relatively low ECL intensity or the high co-reactant concentration needed in the electrochemical reaction blocks its practical application. Here, we developed an ECL imaging system based on the rGO-TiO2–xcomposite material, where the co-reactant, reactive oxygen species (ROS), is generated in situ under the synergetic effect of of ultrasound (US) and electric irradiation. The rGO-TiO2–xcomposites facilitate the separation of electron (e–) and hole (h+) pairs and inhibit recombination triggered by external US irradiation due to the high electroconductivity of rGO and oxygen-deficient structures of TiO2, thus significantly boosting ROS generation. Furthermore, the increased defects on rGO accelerate the electron transfer rate, improving the electrocatalytic performance of the composite and forming more ROS. This high ultrasonic–electric synergistic efficacy is demonstrated through the enhancement of photon emission. Compared with the luminescence intensity triggered by US irradiation and electric field, an enhancement of ∼20-fold and 10-fold of the US combined with electric field-triggered emission is observed from this composite. Under the optimized conditions, using dopamine (DA) as a model target, the sensitivity of the US combined ECL strategy for detection of DA is two orders of magnitude higher than that of the ECL method. The successful detection of DA at low concentrations makes us believe that this strategy provides the possibility of applying ECL imaging for cellular single-molecule analysis and cancer therapy.

The electrochemical visualization of proteins in the plasma membrane of single fixed cells was achieved with a spatial resolution of 160 nm using scanning electrochemical cell microscopy. The model protein, the carcinoembryonic antigen (CEA), is linked with a ruthenium complex (Ru(bpy)32+)-tagged antibody, which exhibits redox peaks in its cyclic voltammetry curves after a nanopipette tip contacts the cellular membrane. Based on the potential-resolved oxidation or reduction currents, an uneven distribution of membrane CEAs on the cells is electrochemically visualized, which could only be achieved previously using super-resolution optical microscopy. Compared with current electrochemical microscopy, the single-cell scanning electrochemical cell microscopy (SECCM) strategy not only improves the spatial resolution but also utilizes the potential-resolved current from the antibody–antigen complex to increase electrochemical imaging accuracy. Eventually, the electrochemical visualization of cellular proteins at the nanoscale enables the super-resolution study of cells to provide more biological information.

Measuring the activity of low-abundance enzymes, down to a few molecules in one living cell, is important but challenging to elucidate their biological function. Here, an electrochemical molecule trap is established at the tip of a nanopipette with an electrochemical detector, in which the diffusion of the molecules away from the electrochemical detector is prevented by electro-osmotic flow (EOF). Accordingly, a limited amount of enzymes is trapped to continuously catalyze the conversion of the substrate to generate a sufficient amount of the byproduct hydrogen peroxide for electrochemical measurements. The resistive pulse sensing of the enzymes in single liposomes validates the detection sensitivity down to 15 molecules. Using this ultrasensitive electrochemical strategy, the activity of 60 sphingomyelinase molecules inside single unstimulated living J774 cells is measured, which was hardly detected by previous methods. The established electrochemical molecule trap-based sensing approach opens the door toward single-molecule electrochemical detection in one living cell. This success will solve the long-standing problem regarding the study of the activity of low-abundance proteins in cells in their native physiological state and greatly enhance the understanding of the roles of proteins in cellular behavior.

The analysis of biomolecules in a 3D cell model is crucial for the collection of spatial information close to the actual organ. In this work, a highly sensitive platinized open carbon nanocavity electrode is fabricated to investigate reactive oxygen species (ROS) in three regions (proliferating zone, quiescent zone, and necrotic core) of a 3D CT26 cell model. The presence of a nanocavity permits more frequent collisions of ROS on the Pt surface, accelerating electron transfer, and thus pushes the detection limit down to 1 nM. This improved detection sensitivity guarantees the spatial investigation of the ROS distribution in a 3D cell sphere, including a high concentration in the outer proliferating layer even without any external stimulus, a low concentration in the quiescent layer, and almost no ROS at the center. The observation of ROS in the cell sphere without the stimulus reveals the presence of oxygen stress in the 3D cancer cell model, which is obviously different from the previous observation in living cultured 2D cells. This discovery provides direct evidence about the discrepancy about the metabolism in 2D and 3D cells, which could also direct a new study in cell electroanalysis to achieve more actual molecular information in life study.

The recent surge of interest in metal–organic gels (MOGs) has emerged for their soft porous structure, large surface area, and abundant active metal sites, making them a promising candidate for building catalyst matrices. In this work, facilely synthesized Fe(III)-organic gel was directly used as a robust electrode matrix. Detailed studies illustrated that their Fe(III) centers can speed up the electro-oxidation/reduction of the H2O2coreactant to produce reactive oxygen species for enhancing a potential-resolved dual electrochemiluminescence (ECL) emission. Among them, the anodic signal of luminol varied with the cell concentration based on the impedance ECL mechanism, while the cathodic signal of CdS quantum dots traced the VEGF165subtype at cell surface by specific aptamer recognition. Based on this, a ratiometric strategy was proposed for accurate cytosensing by eliminating environmental interference. Moreover, by cooperating these two signals, a novel strategy was developed for direct evaluation of the VEGF165subtype, further realizing rapid drug screening and subtype assessment on different cell lines. This work not only opens up the promising application of MOGs as an effective catalyst matrix but also develops reliable cell assays and protein subtype identification for clinical diagnosis and research.

Here, all-solid scanning electrochemical cell microscopy (SECCM) is first established by filling polyacrylamide (PAM) into nanocapillaries as a solid electrolyte. A solid PAM nanoball at the tip of a nanocapillary contacts graphene and behaves as an electrochemical cell for simultaneously measuring the morphology and electrochemical activity. Compared with liquid droplet-based SECCM, this solid nanoball is stable and does not leave any electrolyte at the contact regions, which permits accurate and continuous scanning of the surface without any intervals. Accordingly, the resolutions in the lateral (x-y) and vertical (z) directions are improved to ∼10 nm. The complete scanning of the wrinkles on graphene records low currents at the two sidewalls of the wrinkles and a relatively high current at the center of the wrinkles. The heterogeneity in the electrochemical activity of the wrinkle illustrates different electron transfer features on surfaces with varied curvatures, which is hardly observed by the current electrochemical or optical methods. The successful establishment of this high spatial electrochemical microscopy overcomes the current challenges in investigating the electrochemical activity of materials at the nanoscale, which is significant for a better understanding of electron transfer in materials.

Local electrochemical impedance spectroscopy (LEIS) has been a versatile technology for characterizing local complex electrochemical processes at heterogeneous surfaces. However, further application of this technology is restricted by its poor spatial resolution. In this work, high-spatial-resolution LEIS was realized using scanning electrochemical cell microscopy (SECCM-LEIS). The spatial resolution was proven to be ∼180 nm based on experimental and simulation results. The stability and reliability of this platform were further verified by long-term tests and Kramers–Kronig transformation. With this technology, larger electric double-layer capacitance (Cdl) and smaller interfacial resistance (Rt) were observed at the edges of N-doped reduced graphene oxide, as compared to those at the planar surface, which may be due to the high electrochemical activity at the edges. The established SECCM-LEIS provides a high-spatial approach for study of the interfacial electrochemical behavior of materials, which can contribute to the elucidation of the electrochemical reaction mechanism at material surfaces.

The chemical reaction in a confined space is known to be accelerated due to a high collision probability; however, the study of this confinement effect in a supersmall space down to femtoliter (fL) is seldom reported. Here, an adjustable volume [from picoliter (pL) to fL] of the aqueous phase is retrained at the tip of a nanopipette by an organic solvent so that the confinement effect on the specific activity of glucose oxidase is investigated. The activity is determined by the amount of hydrogen peroxide generated from the reaction between the oxidase and glucose using a nanoelectrode inside the nanopipette. As compared with the activity in bulk solution (82 U/mg), the activity increases up to 7500 U/mg in a 105 fL space. The 2 orders of magnitude increase in the enzymatic activity is the highest amplification in the volume-confined enzyme reaction as reported. A near-exponential drop in the activity is observed with the increase in the space volume, revealing the dominant enhancement in the confined space at the fL level for the first time. The established electrochemical nanopipettes should not only provide a strategy for the study of the enzymatic activity in supersmall confined space but also help understand the confinement effect of enzyme-catalyzed reactions.

Herein, a single biomolecule is imaged by electrochemiluminescence (ECL) using Ru(bpy)32+-doped silica/Au nanoparticles (RuDSNs/AuNPs) as the ECL nanoemitters. The ECL emission is confined to the local surface of RuDSNs leading to a significant enhancement in the intensity. To prove the concept, a single protein molecule at the electrode is initially visualized using the as-prepared RuDSN/AuNPs nanoemitters. Furthermore, the nanoemitter-labeled antibody is linked at the cellular membrane to image a single membrane protein at one cell, without the interference of current and optical background. The success in single-biomolecule ECL imaging solves the long-lasting task in the ultrasensitive ECL analysis, which should be able to provide more elegant information about the protein in cellular biology.

In a typical intracellular electroanalytical measurement, a nanoelectrode is located inside a living cell and a reference electrode outside the cell. This setup faces a problem to drop a certain potential across the cellular plasma membrane that might interrupt the cellular activity. To solve this problem, a self-referenced nanopipette is assembled by incorporating a reference electrode inside the nanocapillary, with a Pt ring at the tip as the electrochemical surface. The potential applied between the Pt ring and the reference electrode is restricted inside the capillary and thus has a negligible effect on the surrounding cellular environment. Using this new setup, the nanopipette pierces into the nucleus of a single living cell for the measurement of hydrogen peroxide under oxidative stress. It is found that a lesser amount of hydrogen peroxide is measured in the nucleus compared with the cytoplasm, revealing uneven oxidative stress inside the cell. The result will not only greatly improve the current setup for intracellular electrochemical analysis but also provide biological information of the compartment inside the living cell.

Developing an electrochemiluminescence (ECL) coreactant to minimize the biotoxicity and to maximize the enhancement factor is critical to single-cell ECL microscopy. Here, we reported a guanine-rich single-stranded DNA (G-ssDNA)-loaded high-index faceted gold nanoflower (Hi-AuNF) as a synergistic coreactant of Ru(bpy)32+for single-cell ECL imaging. Because of the excellent catalytic performance and huge specific surface area, Hi-AuNF serves as not only an ECL enhancer but also a carrier for G-ssDNA. Guanine in G-ssDNA specifically reacts with Ru(bpy)32+through a so-called “catalytic route” and thus significantly enhances the ECL signal of Ru(bpy)32+. To endow targeting ability to the synergistic coreactant, an aptamer of carcinoembryonic antigen (CEA) is incorporated into the G-ssDNA to form G-ssDNA-Apt for the recognition of human breast adenocarcinoma cells, which overexpress CEA on the cytomembrane. Accordingly, the ECL imaging of CEA on the cytomembrane was realized by using the highly selective Hi-AuNF@G-ssDNA-Apt as the probe as well as the luminophore of Ru(bpy)32+. Compared with the common coreactant tripropylamine with high toxicity and volatility, the Hi-AuNF@G-ssDNA-Apt is considered as a high-performance and biocompatible coreactant, providing exciting opportunities in single-cell imaging and detection.

Cytoplasmic microviscosity (CPMV) plays essential roles in governing the diffusion-mediated cellular processes and has been recognized as a reliable indicator of the cellular response of many diseases and malfunctions. Current CPMV studies are exclusively established by probe-assisted optical methods, which nevertheless necessitate the complicated synthesis and delivery of optical probes into cells and thus the issues of biocompatibility and bio-orthogonality. Using twin nanopipettes integrated with a patch-clamp system, a practical electrochemical single-cell measurement is presented, which is capable of real-time and long-term CPMV detection without cell disruption. Specifically, upon the operation of the twin nanopipettes, the cellular CPMV status, which is correlated to cytoplasmic ionic mobility, could be sensibly transduced viathe ionic current passing through the nanosystem. The average CPMV value of HeLa cells was detected as ca.86 cP. Notably, the correlation between chemotherapy and CPMV alterations makes this approach possible for the real-time and long-term assessment of the evolution of external stimuli, as exemplified by the two natural products taxol and colchicine. Integrated with the patch-clamp setup, this study features the first use of twin nanopipettes for electrochemical CPMV monitoring of single living cells, and it is expected to inspire more interest in the exploitation of dual- and multiple nanopipettes for advanced single-cell analysis.

In this paper, localized electrochemiluminescence (ECL) was visualized from nanoneedle electrodes that achieved very-high-density electrochemical sensing. The localized luminescence at the nanometer-sized tip observed was ascribed to enhanced mass transfer of the luminescence probe at the tip than on the planar surface surrounding the tip, which provided higher luminescence at the tip. The size of the luminescence spots was restricted to 15 μm permitting the electrochemical analysis with a density over 4 × 103spots/mm2. The positive correlation between the luminescence intensity at the tips and the concentration of hydrogen peroxide supported the quantitative ECL analysis using nanoneedle electrodes. The further modification of glucose oxidase at the electrode surface conceptually demonstrated that the concentration of glucose ranging from 0.5 to 5 mM could be quantified using the luminescence at the tips, which could be further applied for the detection of multiple molecules in the complex biosystem. This successful localized ECL offers a specific strategy for the development of very-high-density electrochemical arrays without the complicated chip design.

The traditional recognition of extracellular matrix (ECM) at tissue sections relies on the time-consuming immunofluorescence that could not meet the demand of rapid diagnosis. Herein, we introduce a thickness-resolved electrochemiluminescence (ECL) microscopy to image thin-layer ECM at tissue sections for fast histopathological analysis. The unique surface-confined ECL mechanism enables to unveil the diversity and complexity of multiple tissue structures with varying thicknesses. Notably, the short lifetimes and the limited diffusion of electrogenerated coreactant radicals combined with their chemical reactivity result in a 2-fold increase in ECL intensity on ECM structures compared to the remaining tissue, enabling ECM visualization without specific labeling. The further quantitation of the ECM localization within tissue sections furnishes crucial insights into tumor progression and, more importantly, differentiates carcinoma and paracancerous tissues from patients in less than 30 min. Moreover, the reported electrochemistry-based microscopy is a dynamic approach allowing to investigate the transport, tortuosity, and trafficking properties through the tissues. This thickness-resolved recognition strategy not only opens new avenues for imaging complex samples but also holds promise for expediting tissue pathologic diagnosis, offering a more automated protocol with enhanced quantitative data compared to current intraoperative pathology methods.

Electrochemiluminescence (ECL) microscopy is successfully applied to image cells, micro-/nano-objects, and electrochemical processes at electrode surfaces. The classic ECL tandem system is composed of the [Ru(bpy)3]2+luminophore with the very efficient tripropylamine (TPA) coreactant. The dramatic decrease of the ECL signal observed when recording successive ECL images constitutes a key limitation for the development of ECL microscopy. Herein, we investigated the progressive decrease of the ECL signal of Chinese hamster ovary (CHO) cells. The plasma membranes of CHO cells were labeled with a [Ru(bpy)3]2+derivative, and the ECL images were recorded using the TPA coreactant. We demonstrate that the loss of the ECL signal is related to the electrochemical step because of a progressive lower TPA oxidation current. We tested a cathodic regenerative treatment of the electrode surface, which allowed us to restore the initial TPA oxidation intensity and thus to record a sequence of ECL images without any vanishing of the light signal. The electrochemical approach presented here is an essential step for the development of ECL microscopy of cells.

Heterojunction photocatalysts are widely adopted for efficient water splitting, but ion migration can seriously threaten the stability of heterojunctions, as with the well-known low stability of CdS-Cu2–xS due to intrinsic Cu+ion migration. Here, we utilize Cu+migration to design a stratified CdS-Cu2–xS/MoS2photocatalyst, in which CuI@MoS2(CuI-intercalated within the MoS2basal plane) is created by Cu+migration and intercalation to the adjacent MoS2surface. The epitaxial vertical growth of the CuI@MoS2nanosheets on the surface of one-dimensional core–shell CdS-Cu2–xS nanorods forms catalytic and protective layers to simultaneously enhance catalytic activity and stability. Charge transfer is verified by kinetics measurements with femtosecond time-resolved transient absorption spectroscopy and direct mapping of the surface charge distribution with a scanning ion conductance microscope. This design strategy demonstrates the potential of utilizing hybridized surface layers as effective catalytic and protective interfaces for photocatalytic hydrogen production.

Resistive-pulse sensing is a technique widely used to detect single nanoscopic entities such as nanoparticles and large molecules that can block the ion current flow through a nanopore or a nanopipette. Although the species of interest, e.g., antibodies, DNA, and biological vesicles, are typically produced by living cells, so far, they have only been detected in the bulk solution since no localized resistive-pulse sensing in biological systems has yet been reported. In this report, we used a nanopipette as a scanning ion conductance microscopy (SICM) tip to carry out resistive-pulse experiments both inside immobilized living cells and near their surfaces. The characteristic changes in the ion current that occur when the pipet punctures the cell membrane are used to monitor its insertion into the cell cytoplasm. Following the penetration, cellular vesicles (phagosomes, lysosomes, and/or phagolysosomes) were detected inside a RAW 264.7 macrophage. Much smaller pipettes were used to selectively detect 10 nm Au nanoparticles in the macrophage cytoplasm. The in situresistive-pulse detection of extracellular vesicles released by metastatic human breast cells (MDA-MB-231) is also demonstrated. Electrochemical resistive-pulse experiments were carried out by inserting a conductive carbon nanopipette into a macrophage cell to sample single vesicles and measure reactive oxygen and nitrogen species (ROS/RNS) contained inside them.

The realization of electrochemiluminescence (ECL) detection at the single-molecule level is a longstanding goal of ECL assay that requires a novel ECL probe with significantly enhanced luminescence. Here, the synergistic effect of electrochemiluminescence (ECL) is observed unprecedentedly in a new cyclometalated dinuclear Ir(III) complex [Ir2(dfppy)4(imiphenH)]PF6(1·PF6, PF6–= hexafluorophosphate) in which two {Ir(dfppy)2}+units are bridged by an imiphenH–ligand. The ECL intensity from complex 1·PF6is 4.4 and 28.7 times as high as that of its reference mononuclear complexes 2and 3·PF6, respectively. Theoretical calculation reveals that the S0to S1excitation is a local excitation in 1·PF6with two electron-coupled Ir(III) centers, which contributes to the enhanced ECL. The synergistic effect of ECL in 1·PF6can be used to detect microRNA 21 at the single-molecule level (microRNA 21: UAGCUUAUCAGACUGAUGUUGA), with detectable ECL emission from this complex intercalated in DNA/microRNA 21 duplex as low as 90 helix molecules. The finding of the synergistic effect of ECL will not only provide a novel strategy for the modulation of ECL intensity but also enable the detection of microRNA at the single-molecule level.

Inspired by the mechanism in stimulated emission depletion fluorescence microscopy, we established for the first time electrogenerated chemiluminescence (ECL) generated from indium tin oxide (ITO) submicrometer electrodes in submicrometer wells with aluminum walls. Aluminum is observed to have the ability to absorb ECL from luminol and, thus, removes the ECL from the diffused species away from the electrode surfaces. Accordingly, the size of the individual ECL spots is restricted to 4 μm in diameter, enabling the density of the ECL based array to be over 3 × 104/mm2. The conceptual detection of hydrogen peroxide and glucose exhibits the feasibility in the application of luminol ECL for very high-density biosensing. The realization of this ECL in submicrometer wells and the resultant biosensing offer a new strategy for high-density ECL analysis and might initiate the thought for super-resolution ECL microscopy.

Resistive-pulse sensing with biological or solid-state nanopores and nanopipettes has been widely employed in detecting single molecules and nanoparticles. The analytical signal in such experiments is the change in ionic current caused by the molecule/particle translocation through the pipet orifice. This paper describes a new version of the resistive-pulse technique based on the use of carbon nanopipettes (CNP). The measured current is produced by electrochemical oxidation/reduction of redox molecules at the carbon surface and responds to the particle translocation. In addition to counting single entities, this technique enables qualitative and quantitative analysis of the electroactive material they contain. Using liposomes as a model system, we demonstrate the capacity of CNPs for (1) conventional resistive-pulse sensing of single liposomes, (2) electrochemical resistive-pulse sensing, and (3) electrochemical identification and quantitation of redox species (e.g., ferrocyanide, dopamine, and nitrite) contained in a single liposome. The small physical size of a CNP suggests the possibility of single-entity measurements in biological systems.

Here, the fluctuation of charge-transfer resistance in individual reduced graphene oxide (rGO) microsheets with more redox-induced defects is unprecedentedly visualized using a perturbation electrochemiluminescence (ECL) imaging. This perturbation uses a short and low potential to recover defect-covered rGO microsheets slightly and then introduces a high potential to form more redox-induced defects resulting in an increase of charge-transfer resistance. Also, these defects at rGO microsheets enhance their catalytic feature and the resultant ECL intensity so that the temporal resolution in ECL imaging is improved to 30 ms. Aided by this fast imaging approach, the exponential decrease of ECL intensity at individual graphene microsheets after the oxidation is observed, which reflects the increase of their charge-transfer resistances. Since the charge-transfer resistance at electrode surfaces is mainly affected by the conductivity of electrode materials, the result provides the dynamic information to support the reduction of the electrical conductivity in graphene with more defects.

Electrochemiluminescence (ECL)-based capacitance microscopy using a square-wave voltage is established unprecedentedly to realize the label-free visualization of species on electrode surfaces and cellular plasma membranes. The drop in the local capacitance upon the binding of species to the surface or to a cellular membrane is derived to induce a relatively larger potential drop (Vdl) across the double layer on the local electrode surface, which is utilized to prompt enhanced ECL at the binding position. The square-wave voltage with a frequency of as high as 1.5 kHz is proven to be favorable for the discrimination of the local ECL from the surrounding signal. Using this new detection principle and resultant capacitance microscopy, carcinoembryonic antigens (CEA) at amounts of as low as 1 pg can be visualized. Further application of this approach permits the direct imaging of CEA antigens on single MCF-7 cells through the capacitance change after the formation of the antigen–antibody complex. Successful visualization of the analyte without any ECL tag will allow not only special capacitance microscopy for label-free bioassays but also a novel ECL detection approach for the sensitive detection of biomolecules.