Search

Our increasing understanding of the etiology of celiac disease, previously considered a simple food hypersensitivity disorder caused by an immune response to cereal gluten proteins, challenges established concepts of autoimmunity. HLA is a chief genetic determinant, and certain HLA-DQ allotypes predispose to the disease by presenting posttranslationally modified (deamidated) gluten peptides to CD4 T cells. The deamidation of gluten peptides is mediated by transglutaminase 2. Strikingly, celiac disease patients generate highly disease-specific autoantibodies to the transglutaminase 2 enzyme. The dual role of transglutaminase 2 in celiac disease is hardly coincidental. This paper reviews the genetic mapping and involvement of MHC class II genes in disease pathogenesis, and discusses the evidence that MHC class II genes, via the involvement of transglutaminase 2, influence the generation of celiac disease-specific autoantibodies. [ABSTRACT FROM AUTHOR]

Compared to the major histocompatibility complex (MHC) of typical mammals, the chicken BF/BL region is small and simple, with most of the genes playing central roles in the adaptive immune response. However, some genes of the chicken MHC are almost certainly involved in innate immunity, such as the complement component C4 and the lectin-like receptor/ligand gene pair BNK and Blec. The poorly expressed classical class I molecule BF1 is known to be recognised by natural killer (NK) cells and, analogous to mammalian immune responses, the classical class I molecules BF1 and BF2, the CD1 homologs and the butyrophilin homologs called BG may be recognised by adaptive immune lymphocytes with semi-invariant receptors in a so-called adaptate manner. Moreover, the TRIM and BG regions next to the chicken MHC, along with the genetically unlinked Y and olfactory/scavenger receptor regions on the same chromosome, have multigene families almost certainly involved in innate and adaptate responses. On this chicken microchromosome, the simplicity of the adaptive immune gene systems contrasts with the complexity of the gene systems potentially involved in innate immunity. [ABSTRACT FROM AUTHOR]

Major histocompatibility complex class I (MHC I) molecules are critically involved in defense against pathogens, and their high polymorphism is advantageous to a range of immune responses, especially in duck displaying biased expression of one MHC I gene. Here, we examined MHC I polymorphism in two duck (Anas platyrhynchos) breeds from China: Shaoxing (SX) and Jinding (JD). Twenty-seven unique UAA alleles identified from the MHC I genes of these breeds were analyzed concerning amino acid composition, homology, and phylogenetic relationships. Based on amino acid sequence homology, allelic groups of Anas platyrhynchos MHC I (Anpl-MHC I) were established and their distribution was analyzed. Then, highly variable sites (HVSs) in peptide-binding domains (PBD) were estimated and located in the three-dimensional structure of Anpl-MHC I. The UAA alleles identified showed high polymorphism, based on full-length sequence homology. By adding the alleles found here to known Anpl-MHC I genes from domestic ducks, they could be divided into 17 groups and four novel groups were revealed for SX and JD ducks. The UAA alleles of the two breeds were not divergent from the MHC I of other duck breeds, and HVSs were mostly located in the peptide-binding groove (PBG), suggesting that they might determine peptide-binding characteristics and subsequently influence peptide presentation and recognition. The results from the present study enrich Anpl-MHC I polymorphism data and clarify the distribution of alleles with different peptide-binding specificities, which might also accelerate effective vaccine development and help control various infections in ducks. [ABSTRACT FROM AUTHOR]

Dengue is the most prevalent arthropod-borne viral illness in humans worldwide. Single-nucleotide polymorphisms (SNPs) in genes involved in the immune response, such as dendritic cell-specific intercellular adhesion molecule-3-grabbing non-integrin (DC-SIGN), IgG Fc receptor II-A (FcγRIIa), vitamin D receptor (VDR), and tumor necrosis factor alpha (TNF-α), were previously reported to be associated with susceptibility to dengue disease in different human populations. Therefore, due to the relevant association of host immune and genetic status with disease susceptibility/severity of dengue, this work aims to verify the frequency of anti-dengue virus antibodies and some dengue-associated risk SNPs in a population in Minas Gerais State, Southeast Brazil. A total of 1560 individuals were genotyped for polymorphisms in DC-SIGN (rs4804803), FcγRIIa (rs1801274), VDR (rs7975232), and TNF-α (rs1800629). The presence of anti-dengue antibodies (IgM and/or IgG) in these samples was also assayed. Anti-dengue antibodies were detected at an overall frequency of 16.86%, indicating a virus infection in asymptomatic individuals. The genotypic frequencies of all SNPs studied did not differ between the asymptomatic and control groups. Regarding the allelic frequencies of the four SNPs analyzed, a higher frequency was detected of the G allele of FcγRIIa/rs1801274 in the asymptomatic individuals when compared to that in the control group (p = 0.03). Therefore, the results showed a high prevalence of asymptomatic individuals in Minas Gerais State, with a potential association between the presence of the G allele of FcγRIIa/rs1801274 and protection against symptomatic disease. [ABSTRACT FROM AUTHOR]

Current T cell epitope prediction tools are a valuable resource in designing targeted immunogenicity experiments. They typically focus on, and are able to, accurately predict peptide binding and presentation by major histocompatibility complex (MHC) molecules on the surface of antigen-presenting cells. However, recognition of the peptide-MHC complex by a T cell receptor (TCR) is often not included in these tools. We developed a classification approach based on random forest classifiers to predict recognition of a peptide by a T cell receptor and discover patterns that contribute to recognition. We considered two approaches to solve this problem: (1) distinguishing between two sets of TCRs that each bind to a known peptide and (2) retrieving TCRs that bind to a given peptide from a large pool of TCRs. Evaluation of the models on two HIV-1, B*08-restricted epitopes reveals good performance and hints towards structural CDR3 features that can determine peptide immunogenicity. These results are of particular importance as they show that prediction of T cell epitope and T cell epitope recognition based on sequence data is a feasible approach. In addition, the validity of our models not only serves as a proof of concept for the prediction of immunogenic T cell epitopes but also paves the way for more general and high-performing models. [ABSTRACT FROM AUTHOR]

Susceptibility to malaria infection has been associated with host genetic polymorphisms that differs between groups. We hypothesize that Toll-interacting proteins ( TOLLIP), vitamin D receptor (VDR) and tumor necrosis factor-α (TNF) genes are significant contributors to susceptibility and disease severity in Plasmodium falciparum (Pf) infection. Our aim is to explore the genomic diversity and haplotype frequency of these genes, as well as extrapolate possible association with markers of severity, between malaria-infected and healthy controls. Genomic DNA samples extracted from the blood of 107 malaria-infected patients and 190 uninfected controls were analyzed, with no difference in genotypic or allelic frequencies of TOLLIP and VDR polymorphisms. However, a significant difference in the genotypic ( p = 2.20E-16) and allelic frequencies ( p = 2.20E-16) of the TNF-α (snp rs1800629) polymorphism was found. The preponderance of the mutant variant among the malaria-infected show a possible impaired capacity to mount an effective immune response, potentially confirmed by our association results. This result calls for analysis of clearly delineated uncomplicated versus severe disease groups, including serum assays, providing a basis to conclude that susceptibility to malaria infection and potential contribution to disease severity is significantly associated with polymorphisms of the tumor necrosis factor-α but not TOLLIP or VDR genes. [ABSTRACT FROM AUTHOR]

Invariant natural killer T ( iNKT) cells constitute a unique subset of innate-like T cells that have been shown to have crucial roles in a variety of immune responses. iNKT cells are characterized by their expression of both NK cell markers and an invariant T cell receptor (TCR) α chain, which recognizes glycolipids presented by the MHC class I-like molecule CD1d. Despite having a limited antigen repertoire, the iNKT cell response can be very complex, and participate in both protective and harmful immune responses. The protective role of these cells against a variety of pathogens has been particularly well documented. Through the use of these pathogen models, our knowledge of the breadth of the iNKT cell response has been expanded. Specific iNKT cell antigens have been isolated from several different bacteria, from which iNKT cells are critical for protection in mouse models. These responses can be generated by direct, CD1d-mediated activation, or indirect, cytokine-mediated activation, or a combination of the two. This can lead to secretion of a variety of different Th1, Th2, or Th17 cytokines, which differentially impact the downstream immune response against these pathogens. This critical role is emphasized by the conservation of these cells between mice and humans, warranting further investigation into how iNKT cells participate in protective immune responses, with the ultimate goal of harnessing their potential for treatment. [ABSTRACT FROM AUTHOR]

The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes ( PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion ( t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers ( t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future. [ABSTRACT FROM AUTHOR]

The viability of coral reefs worldwide has been seriously compromised in the last few decades due in part to the emergence of coral diseases of infectious nature. Despite important efforts to understand the etiology and the contribution of environmental factors associated to coral diseases, the mechanisms of immune response in corals are just beginning to be studied systematically. In this study, we analyzed the set of conserved immune response genes of the Caribbean reef-building coral Pseudodiploria strigosa by Illumina-based transcriptome sequencing and annotation of healthy colonies challenged with whole live Gram-positive and Gram-negative bacteria. Searching the annotated transcriptome with immune-related terms yielded a total of 2782 transcripts predicted to encode conserved immune-related proteins that were classified into three modules: (a) the immune recognition module, containing a wide diversity of putative pattern recognition receptors including leucine-rich repeat-containing proteins, immunoglobulin superfamily receptors, representatives of various lectin families, and scavenger receptors; (b) the intracellular signaling module, containing components from the Toll-like receptor, transforming growth factor, MAPK, and apoptosis signaling pathways; and (3) the effector module, including the C3 and factor B complement components, a variety of proteases and protease inhibitors, and the melanization-inducing phenoloxidase. P. strigosa displays a highly variable and diverse immune recognition repertoire that has likely contributed to its resilience to coral diseases. [ABSTRACT FROM AUTHOR]

Major histocompatibility complex (MHC) is the best characterized genetic region controlling disease resistance and immune responses in chicken. MHC genes are also involved in various non-immune functions such as productive traits and reproductive success. The genetic diversity of MHC in an Iranian indigenous chicken (Khorasan) was studied, and association of the MHC alleles with production traits was determined. The MHC polymorphism was ascertained by genotyping the LEI0258 microsatellite locus by PCR-based fragment analysis. LEI0258 microsatellite marker is a genetic indicator for MHC, which is located on microchromosome 16 and strongly associated with serologically defined MHC haplotypes. A total of 25 different LEI0258 alleles (185-493 bp) and 76 genotypes were identified in 313 chickens. An allele of 361 bp had the highest frequency (26.44 %), and alleles of 207 and 262 bp had the lowest (0.16 %). High level of heterozygosity (87 %) and good genotype frequency fit to the Hardy-Weinberg equilibrium was observed in this population ( P = 0.238). The association study also revealed a significant influence of MHC alleles on body weight, egg weight, egg laying intensity, and weight of sexual maturity in Khorasan population ( P < 0.05). The information obtained from this study indicates a high MHC genetic diversity and the association of MHC alleles with important production traits in Khorasan chicken. These data would be applicable in designing breeding and genetic resource conservation for indigenous chicken populations. [ABSTRACT FROM AUTHOR]

We investigated how the equine fetus prepares its pre-immune humoral repertoire for an imminent exposure to pathogens in the neonatal period, particularly how the primary hematopoietic organs are equipped to support B cell hematopoiesis and immunoglobulin (Ig) diversity. We demonstrated that the liver and the bone marrow at approximately 100 days of gestation (DG) are active sites of hematopoiesis based on the expression of signature messenger RNA (mRNA) (c-KIT, CD34, IL7R, CXCL12, IRF8, PU.1, PAX5, NOTCH1, GATA1, CEBPA) and protein markers (CD34, CD19, IgM, CD3, CD4, CD5, CD8, CD11b, CD172A) of hematopoietic development and leukocyte differentiation molecules, respectively. To verify Ig diversity achieved during the production of B cells, V(D)J segments were sequenced in primary lymphoid organs of the equine fetus and adult horse, revealing that similar heavy chain VDJ segments and CDR3 lengths were most frequently used independent of life stage. In contrast, different lambda light chain segments were predominant in equine fetal compared to adult stage, and surprisingly, the fetus had less restricted use of variable gene segments to construct the lambda chain. Fetal Igs also contained elements of sequence diversity, albeit to a smaller degree than that of the adult horse. Our data suggest that the B cells produced in the liver and bone marrow of the equine fetus generate a wide repertoire of pre-immune Igs for protection, and the more diverse use of different lambda variable gene segments in fetal life may provide the neonate an opportunity to respond to a wider range of antigens at birth. [ABSTRACT FROM AUTHOR]

Like other vertebrate Toll-like receptors (TLRs), the TLRs of teleost fish can be subdivided into six major families, each of which recognize a general class of molecular patterns. However, there also are a number of Tlrs with unknown function, the presence of which seems unique to the bony fish, among which is Tlr20. We identified full-length complementary DNA (cDNA) sequences for tlr20 of zebrafish and common carp, two closely related fish species. Zebrafish have six copies of tlr20, whereas carp express only a single copy. Both zebrafish Tlr20 (at least Tlr20a-d) and carp Tlr20 have 26 leucine-rich repeats (LRRs). Three-dimensional modeling indicates a best fit to the crystal structure of TLR8. Phylogenetic analyses place Tlr20 in the TLR11 family closest to Tlr11 and Tlr12, which sense ligands from protozoan parasites in the mouse. Conservation of genes on zebrafish chromosome 9, which carries tlr20, with genes on mouse chromosome 14, which carries tlr11, indicates Tlr11 could be a possible ortholog of Tlr20. Confocal microscopy suggests a subcellular localization of Tlr20 at the endoplasmatic reticulum. Although in vitro reporter assays could not identify a ligand unique to Tlr20, in vivo infection experiments indicate a role for Tlr20 in the immune response of carp to protozoan parasites ( Trypanoplasma borreli). Carp tlr20 is mainly expressed in peripheral blood leukocytes (PBL) with B lymphocytes, in particular, expressing relatively high levels of Tlr20. In vitro stimulation of PBL with T. borreli induces an upregulation of tlr20, supportive of a role for Tlr20 in the immune response to protozoan parasites. [ABSTRACT FROM AUTHOR]

The interferon-γ-inducible lysosomal thiol reductase (GILT) has been demonstrated to play an important role in the processing and presentation of MHC class II-restricted antigen (Ag) by catalyzing disulfide bond reduction. In this study, a rainbow trout cDNA (designated as rGILT) was cloned and identified from Oncorhynchus mykiss. The open reading frame of rGILT consists of 759 bases encoding a protein of 253 amino acids with an estimated molecular mass of 28.23 kDa and a theoretical isoelectric point of 4.94. The rGILT exhibited a characteristic GILT signature sequence CQHGX 2ECX 2NX 4C and CXXC motif. Phylogenetic analysis suggested that rGILT had been derived from a common ancestor with other GILT proteins. RT-PCR results showed that rGILT and rIFN-γ (rainbow trout IFN-γ) mRNA was expressed in a tissue-specific manner and obviously up-regulated in splenocytes and the cells from head kidney after induction with LPS. Recombinant rGILT fused with His6 tag was efficiently expressed in Escherichia coli BL21 (DE3) and purified by Ni-NTA affinity chromatography. Further study revealed that rGILT was capable of catalyzing the reduction of the interchain disulfide bonds from intact IgG. This study shows that rGILT may be involved in the immune response to bacteria challenge and maintain first line of innate immune defense at basal level in O. mykiss. It also provides the basis for investigating on the role of GILT using O. mykiss as an animal model for related studies. [ABSTRACT FROM AUTHOR]

Major histocompatibility complex class II (MHCII) molecules play an important role in cell-mediated immunity. They present specific peptides derived from endosomal proteins for recognition by T helper cells. The identification of peptides that bind to MHCII molecules is therefore of great importance for understanding the nature of immune responses and identifying T cell epitopes for the design of new vaccines and immunotherapies. Given the large number of MHC variants, and the costly experimental procedures needed to evaluate individual peptide-MHC interactions, computational predictions have become particularly attractive as first-line methods in epitope discovery. However, only a few so-called pan-specific prediction methods capable of predicting binding to any MHC molecule with known protein sequence are currently available, and all of them are limited to HLA-DR. Here, we present the first pan-specific method capable of predicting peptide binding to any HLA class II molecule with a defined protein sequence. The method employs a strategy common for HLA-DR, HLA-DP and HLA-DQ molecules to define the peptide-binding MHC environment in terms of a pseudo sequence. This strategy allows the inclusion of new molecules even from other species. The method was evaluated in several benchmarks and demonstrates a significant improvement over molecule-specific methods as well as the ability to predict peptide binding of previously uncharacterised MHCII molecules. To the best of our knowledge, the NetMHCIIpan- 3. 0 method is the first pan-specific predictor covering all HLA class II molecules with known sequences including HLA-DR, HLA-DP, and HLA-DQ. The NetMHCpan- 3. 0 method is available at . [ABSTRACT FROM AUTHOR]

The identification of peptides binding to major histocompatibility complexes (MHC) is a critical step in the understanding of T cell immune responses. The human MHC genomic region (HLA) is extremely polymorphic comprising several thousand alleles, many encoding a distinct molecule. The potentially unique specificities remain experimentally uncharacterized for the vast majority of HLA molecules. Likewise, for nonhuman species, only a minor fraction of the known MHC molecules have been characterized. Here, we describe a tool, MHCcluster, to functionally cluster MHC molecules based on their predicted binding specificity. The method has a flexible web interface that allows the user to include any MHC of interest in the analysis. The output consists of a static heat map and graphical tree-based visualizations of the functional relationship between MHC variants and a dynamic TreeViewer interface where both the functional relationship and the individual binding specificities of MHC molecules are visualized. We demonstrate that conventional sequence-based clustering will fail to identify the functional relationship between molecules, when applied to MHC system, and only through the use of the predicted binding specificity can a correct clustering be found. Clustering of prevalent HLA-A and HLA-B alleles using MHCcluster confirms the presence of 12 major specificity groups (supertypes) some however with highly divergent specificities. Importantly, some HLA molecules are shown not to fit any supertype classification. Also, we use MHCcluster to show that chimpanzee MHC class I molecules have a reduced functional diversity compared to that of HLA class I molecules. MHCcluster is available at . [ABSTRACT FROM AUTHOR]

L-ficolin (ficolin-2) is a complement-activating pattern-recognition lectin taking part in the innate immune response. Both its serum concentration and sugar binding capacity are influenced by single nucleotide polymorphisms (SNP) of the corresponding FCN2 gene. Cost-effective and simple procedures, based on polymerase chain reaction (PCR) or PCR-restriction fragment length polymorphism for an investigation of four FCN2 SNPs are proposed: −64 A > C (rs7865453), −4 A > G (rs17514136; both located in the promoter region), +6359 C > T (rs17549193), +6424 G > T (rs7851696; both in exon 8). Variant alleles of −64 and +6424 (in strong linkage disequlibrium) are known to be associated with low L-ficolin level or activity. In contrast, variant alleles at positions −4 and +6359 (also in strong linkage disequlibrium) correspond to higher values. Since several L-ficolin clinical associations have been reported, FCN2 genotyping seems to be a valuable tool for disease association studies. [ABSTRACT FROM AUTHOR]

The major histocompatibility complex (MHC) genes are the most polymorphic genes found in the vertebrate genome, and they encode proteins that play an essential role in the adaptive immune response. Many songbirds (passerines) have been shown to have a large number of transcribed MHC class I genes compared to most mammals. To elucidate the reason for this large number of genes, we compared 14 MHC class I alleles (α1-α3 domains), from great reed warbler, house sparrow and tree sparrow, via phylogenetic analysis, homology modelling and in silico peptide-binding predictions to investigate their functional and genetic relationships. We found more pronounced clustering of the MHC class I allomorphs (allele specific proteins) in regards to their function (peptide-binding specificities) compared to their genetic relationships (amino acid sequences), indicating that the high number of alleles is of functional significance. The MHC class I allomorphs from house sparrow and tree sparrow, species that diverged 10 million years ago (MYA), had overlapping peptide-binding specificities, and these similarities across species were also confirmed in phylogenetic analyses based on amino acid sequences. Notably, there were also overlapping peptide-binding specificities in the allomorphs from house sparrow and great reed warbler, although these species diverged 30 MYA. This overlap was not found in a tree based on amino acid sequences. Our interpretation is that convergent evolution on the level of the protein function, possibly driven by selection from shared pathogens, has resulted in allomorphs with similar peptide-binding repertoires, although trans-species evolution in combination with gene conversion cannot be ruled out. [ABSTRACT FROM AUTHOR]

Excessive activation of innate immune response contributes to the pathogenesis of acute-on-chronic hepatitis B liver failure (ACLF-HBV). miR-146a was recently found to be implicated in the regulation of innate immunity. In this study, we explored the biological significance of a single-nucleotide polymorphism (rs2910164) within the miR-146a gene in the risk of acquiring ACLF-HBV. We completed a hospital-based case-control study including 717 cases of HBV-infected patients-251 cases of ACLF-HBV and 466 cases of chronic hepatitis B. Whole blood samples were collected for isolation of DNA and peripheral blood mononuclear cells (PBMCs). The association between genotypes and risk of ACLF-HBV was analyzed by multivariate unconditional logistic regression, with adjustment for sex and age. Our results showed that the GG homozygote was a protective genotype in terms of susceptibility to ACLF-HBV, with odds ratio = 0.496, 95 % confidence interval = 0.309-0.797, P = 0.004 compared with CC+GC genotypes. The amount of mature miR-146a in PBMCs was significantly higher in the GG homozygote group than those in the CC and CG genotype groups of ACLF-HBV patients. The GG genotype group also represented lower serum level of TNF-α and higher survival rate (follow-up period = 4 months). In conclusion, The GG genotype within the pre-miR-146a is reversely associated with susceptibility of ACLF-HBV in the studied Chinese population. This may be partially explained by the relatively higher amount of mature miR-146a and the lower serum level of TNF-α in this genotype group. [ABSTRACT FROM AUTHOR]

Regulators of G protein signaling (RGS) are key regulators of G protein signaling. RGS proteins of the R4 RGS group are composed of a mere RGS domain and are mainly involved in immune response modulation. In both human and mouse, most genes encoding the R4 RGS proteins are located in the same region of chromosome 1. We show here that the RGS1/ RGS16 neighborhood constitutes a synteny group well conserved across tetrapods and closely linked to the MHC paralogon of chromosome 1. Genes located in the RGS1/ RGS16 region have paralogs close to the MHC on chromosome 6 or close to the other MHC paralogons. In amphioxus, a cephalochordate, these genes possess orthologs that are located in the same scaffolds as a number of markers defining the proto-MHC in this species (Abi-Rached et al., Nat Genet 31:100-115, ). We therefore propose that the RGS1/ RGS16 region provides useful markers to investigate the origins and the evolution of the MHC. In addition, we show that some genes of the region appear to have immune functions not only in human, but also in Xenopus. [ABSTRACT FROM AUTHOR]

High-mobility group box protein 1 ( HMGB1) gene has a universal sentinel function for nucleic acid-mediated innate immune responses and acts as a pathogenic mediator in the inflammatory disease. In an effort to identify the functional single-nucleotide polymorphism (SNP) in the 3′-untranslated region (UTR) of the bovine HMGB1 gene that affects the binding to its target microRNA, first, the expression of HMGB1 mRNA in different genotypes and its candidate bta-miR-223 was investigated. Quantitative real-time polymerase chain reaction results showed that the relative expression of HMGB1 mRNA in cows with the genotype GG is significantly higher than those in cows with the genotype AA ( P < 0.05). The expression of bta-miR-223 was significantly upregulated by 1.95-fold ( P < 0.05) in the bovine mastitis-infected mammary gland tissues compared with that in the healthy tissues. Subsequently, luciferase assay indicated that the HMGB1 expression was directly targeted by bta-miR-223 in human embryo kidney 293 T (HEK 293T) cells. One novel SNP (g. +2776 A > G) in the HMGB1 3′-UTR, altering the binding of HMGB1 and bta-miR-223, was found to be associated with somatic count scores in cows. Taken together, the g. +2776 A > G-GG was an advantageous genotype which can be used as a candidate functional marker for mastitis resistance breeding program. [ABSTRACT FROM AUTHOR]

Introduction of a novel influenza virus into the human population leads to the occurrence of pandemic events, such as the one caused by pandemic influenza A (H1N1) 2009 virus. The severity of infections caused by this virus in young adults was greater than that observed in patients with seasonal influenza. Fatal cases have been associated with an abnormal innate, proinflammatory immune response. A critical role for natural killer cells during the initial responses to influenza infections has been suggested. In this study, we assessed the association of killer-cell immunoglobulin-like receptors (KIRs) with disease severity by comparing KIR gene content in patients with mild and severe pandemic influenza virus infections to a control group. We found that activator (KIR3DS1 and KIR2DS5) and inhibitory (KIR2DL5) genes, encoded in group B haplotypes containing the cB01, cB03 and tB01 motifs, are associated with severe pandemic influenza A (H1N1) 2009 infections. Better understanding of how genetic variability contributes to influenza virus pathogenesis may help to the development of immune intervention strategies aiming at controlling the severity of disease. [ABSTRACT FROM AUTHOR]

Estimation of quantitative genetic parameters is important for improving salmonid broodstock management in commercial and government hatcheries. Using a replicated 2 × 2 factorial breeding design (48 families and 192 individuals), we partitioned early immune response transcription variation into additive genetic, non-additive genetic, and maternal components in juvenile Chinook salmon ( Oncorhynchus tshawytscha). Transcription of four cytokine genes ( IL1, TNF-α, IL-8, IL8-R) and two control genes ( IgM and RPS-11) was measured relative to an endogenous control ( EF1a) before and 24 h after immune stimulation with Vibrio vaccine. Additive genetic variation was not significant for cytokine transcription and heritability ranged from 0.44 (in pre-challenge IL1) to 0.04 (in post-challenge TNF-α). Non-additive genetic variance was significant in post-challenge IL1 (18 %) and TNF-α (12 %) while maternal effects contributed to pre-challenge cytokine transcription. Cytokine transcription co-expressed within but not between pre- and post-challenge states. The lack of additive genetic effects indicates that cytokine transcription is not a likely candidate for selection programs to improve immune function in Chinook salmon. Our results add to the growing evidence that non-additivity in salmon is common and contributes to our understanding of the genetic architecture of transcription. This indicates that transcription variation may act to maintain genetic variation and facilitate rapid adaptive response in salmonids. [ABSTRACT FROM AUTHOR]

T-cell immunoglobulin domain and mucin domain containing protein 1 (TIM1), also known as a cellular receptor for hepatitis A virus (HAVCR1) or a molecule induced by ischemic injury in the kidney (KIM1), is involved in the regulation of immune responses. We investigated a natural selection history of TIM1 by comparative sequencing analysis in 24 different primates. It was found that TIM1 had become a pseudogene in multiple lineages of the New World monkey. We also investigated T cell lines originated from four different New World monkey species and confirmed that TIM1 was not expressed at the mRNA level. On the other hand, there were ten amino acid sites in the Ig domain of TIM1 in the other primates, which were suggested to be under positive natural selection. In addition, mucin domain of TIM1 was highly polymorphic in the Old World monkeys, which might be under balanced selection. These data suggested that TIM1 underwent a lineage-specific evolutionary pathway in the primates. [ABSTRACT FROM AUTHOR]

The major histocompatibility complex (MHC) plays a central role in the adaptive immune response. The MHC region is characterised by a high gene density, and most of these genes display considerable polymorphism. Next to humans, non-human primates (NHP) are well studied for their MHC. The present nomenclature report provides the scientific community with the latest nomenclature guidelines/rules and current implemented nomenclature revisions for Great Ape, Old and New World monkey species. All the currently published MHC data for the different Great Ape, Old and New World monkey species are archived at the Immuno Polymorphism Database (IPD)-MHC NHP database. The curators of the IPD-MHC NHP database are, in addition, responsible for providing official designations for newly detected polymorphisms. [ABSTRACT FROM AUTHOR]

The SIV-infected rhesus macaque ( Macaca mulatta) is the most established model of AIDS disease systems, providing insight into pathogenesis and a model system for testing novel vaccines. The understanding of cellular immune responses based on the identification and study of Major Histocompatibility Complex (MHC) molecules, including their MHC:peptide-binding motif, provides valuable information to decipher outcomes of infection and vaccine efficacy. Detailed characterization of Mamu- B*039:01, a common allele expressed in Chinese rhesus macaques, revealed a unique MHC:peptide-binding preference consisting of glycine at the second position. Peptides containing a glycine at the second position were shown to be antigenic from animals positive for Mamu- B*039:01. A similar motif was previously described for the D mouse MHC allele, but for none of the human HLA molecules for which a motif is known. Further investigation showed that one additional macaque allele, present in Indian rhesus macaques, Mamu- B*052:01, shares this same motif. These 'G2' alleles were associated with the presence of specific residues in their B pocket. This pocket structure was found in 6% of macaque sequences but none of 950 human HLA class I alleles. Evolutionary studies using the 'G2' alleles points to common ancestry for the macaque sequences, while convergent evolution is suggested when murine and macaque sequences are considered. This is the first detailed characterization of the pocket residues yielding this specific motif in nonhuman primates and mice, revealing a new supertype motif not present in humans. [ABSTRACT FROM AUTHOR]

Interleukins (ILs) are key mediators of the immune response and inflammatory process. Plasma levels of IL-10, IL-1Ra, and IL-6 are associated with metabolic conditions, show large inter-individual variations, and are under strong genetic control. Therefore, elucidation of the genetic variants that influence levels of these ILs provides useful insights into mechanisms of immune response and pathogenesis of diseases. We conducted a genome-wide association study (GWAS) of IL-10, IL-1Ra, and IL-6 levels in 707 non-diabetic African Americans using 5,396,780 imputed and directly genotyped single nucleotide polymorphisms (SNPs) with adjustment for gender, age, and body mass index. IL-10 levels showed genome-wide significant associations ( p < 5 × 10) with eight SNPs, the most significant of which was rs5743185 in the PMS1 gene ( p = 2.30 × 10). We tested replication of SNPs that showed genome-wide significance in 425 non-diabetic individuals from West Africa, and successfully replicated rs17365948 in the YWHAZ gene ( p = 0.02). IL-1Ra levels showed suggestive associations with two SNPs in the ASB3 gene ( p = 2.55 × 10), ten SNPs in the IL-1 gene family ( IL1F5, IL1F8, IL1F10, and IL1Ra, p = 1.04 × 10 to 1.75 × 10), and 23 SNPs near the IL1A gene ( p = 1.22 × 10 to 1.63 × 10). We also successfully replicated rs4251961 ( p = 0.009); this SNP was reported to be associated with IL-1Ra levels in a candidate gene study of Europeans. IL-6 levels showed genome-wide significant association with one SNP ( RP11-314E23.1; chr6:133397598; p = 8.63 × 10). To our knowledge, this is the first GWAS on IL-10, IL-1Ra, and IL-6 levels. Follow-up of these findings may provide valuable insight into the pathobiology of IL actions and dysregulations in inflammation and human diseases. [ABSTRACT FROM AUTHOR]

Human cord blood cell-derived IgM antibodies are important for the neonate immune responses and construction of germline-based immunoglobulin libraries. Several previous studies of a relatively small number of sequences found that they exhibit restrictions in the usage of germline genes and in the diversity of the variable heavy chain complementarity determining region 3 compared to adults. To further characterize such restrictions on a larger scale and to compare the early B-cell diversity to adult IgM repertoires, we performed 454 sequencing and IMGT/HighV-QUEST analysis of cord blood IG libraries from two babies and determined germline gene usage, V-D-J rearrangement, VHCDR3 diversity, and somatic mutations to characterize human neonate repertoire. Most of the germline subgroups were identified with frequencies comparable to those present in the adult IgM repertoire except for the IGHV1-2 gene that was preferentially expressed in the cord blood cells. The gene usage diversity contributed to 1,430 unique IGH V-D-J rearrangement patterns while the exonuclease trimming and N region addition at the V-D-J junctions along with gene diversity created a wide range of VHCDR3 with different lengths and sequence variability. We observed a lower degree of somatic mutations in the CDR and framework regions of antibodies from cord blood cells compared to adults. These results provide insights into the characteristics of human cord blood antibody repertoires, which have gene usage diversity and VHCDR3 lengths similar to that of the adult IgM repertoire but differ significantly in some of the gene usages, V-D-J rearrangements, junctional diversity, and somatic mutations. [ABSTRACT FROM AUTHOR]

Variation within major histocompatibility complex (MHC) genes is important in recognizing pathogens and initiating an immune response. These genes are relevant in enhancing our understanding of how species cope with rapid environmental changes and concomitant fluctuations in selective pressures such as invasive, infectious diseases. Disease-based models suggest that diversity at MHC is maintained through balancing selection arising from the coevolution of hosts and pathogens. Despite intensive balancing selection, sequence motifs or even identical MHC alleles can be shared across multiple species; three potential mechanisms have been put forth to explain this phenomenon: common ancestry, convergent evolution, and random chance. To understand the processes that maintain MHC similarity across divergent species, we examined the variation at two orthologous MHC-DRB genes in widespread North American Musteloid species, striped skunks ( Mephitis mephitis), and raccoons ( Procyon lotor). These species are often sympatric and exposed to a similar suite of diseases (e.g., rabies, canine distemper, and parvovirus). Given their exposure to similar selective pressures from pathogens, we postulated that similar DRB alleles may be present in both species. Our results indicated that similar motifs are present within both species, at functionally relevant polymorphic sites. However, based on phylogenetic analyses that included previously published MHC sequences of several closely related carnivores, the respective MHC-DRB alleles do not appear to have been maintained through common ancestry and unlikely through random chance. Instead, the similarities observed between the two mesocarnivore species may rather be due to evolutionary convergence. [ABSTRACT FROM AUTHOR]

Recent reports have revealed that cynomolgus macaques obtained from different geographic origins may be more or less suitable for particular studies depending on the specific question(s) being addressed, e.g. Mauritian cynomolgus macaques are particularly suitable for detailed immunological studies against a limited genetic background while less conserved populations may be more appropriate to predict breadth of vaccine coverage in the genetically diverse human population. We have characterised MHC haplotypes in 90 Indonesian cynomolgus macaques using microsatellite and reference strand conformational analysis. Thirty unique haplotypes were defined in the cohort, emphasising the high degree of diversity in this population of cynomolgus macaques. The majority of haplotypes were present at a frequency of ≤6%. Transcription profiles indicated that each haplotype was associated with two to eight transcribed class I alleles. The results corroborate previous reports of the extensive MHC diversity of Indonesian cynomolgus macaques and provide additional data to inform colony management decisions. Further, definition of the MHC diversity of the population satisfies one of the prerequisites to MHC association studies and detailed immunological investigations in this outbred non-human primate species. [ABSTRACT FROM AUTHOR]

Cynomolgus macaques are widely used as a primate model for human diseases associated with an immunological process. Because there are individual differences in immune responsiveness, which are controlled by the polymorphic nature of the major histocompatibility (MHC) locus, it is important to reveal the diversity of MHC in the model animal. In this study, we analyzed 26 cynomolgus macaques from five families for MHC class I genes. We identified 32 Mafa-A, 46 Mafa-B, 6 Mafa-I, and 3 Mafa-AG alleles in which 14, 20, 3, and 3 alleles were novel. There were 23 MHC class I haplotypes and each haplotype was composed of one to three Mafa-A alleles and one to five Mafa-B alleles. Family studies revealed that there were two haplotypes which contained two Mafa-A1 alleles. These observations demonstrated further the complexity of MHC class I locus in the Old World monkey. [ABSTRACT FROM AUTHOR]

CD300, triggering receptor expressed on myeloid cells (TREM), and TREM-like (TREML) receptors are important regulators of the mammalian immune response. Homologs of these receptors, which occur in activating and inhibitory transmembrane forms as well as soluble variants, are found throughout the jawed vertebrates. Specific ligands for most members of these receptor families remain elusive. We report here that at least 11 separate receptors from the CD300, TREM, and TREML families engage in robust and specific interactions with major polar lipids found in prokaryotic and eukaryotic cell membranes. Both soluble and membrane-bound receptor forms exhibit lipid interactions in the solid phase as well as in a physiological signaling context. Overlapping but distinctive patterns of receptor specificity suggest that the CD300/TREM system as a whole may discriminate immunological stimuli based on lipid signatures, thereby influencing downstream responses. [ABSTRACT FROM AUTHOR]

The infection of red-bellied tamarins ( Saguinus labiatus) with GB virus B (GBV-B) is an important surrogate model of hepatitis C virus infection in man. To fully exploit the value of this model, we have characterised MHC class I G and class II DRB alleles in eight tamarins representing a cross-section of a UK breeding colony. The results indicated a high degree of classes I and II DRB allele sharing. Each animal transcribed three to four putative surface-expressed class I alleles and two to four class II DRB alleles. Most animals also transcribed at least one class I allele predicted to result in a C-terminal truncated protein. These results represent the first description of MHC polymorphism in this species and provide a foundation for characterisation of MHC diversity in breeding populations of red-bellied tamarins. The data will facilitate the identification of associations between MHC polymorphism and control of viral infections, and detailed dissection of cellular immune responses against GBV-B. [ABSTRACT FROM AUTHOR]

The programmed, stepwise acquisition of immunocompetence that marks the development of the fetal immune response proceeds during a period when both T cell receptor and immunoglobulin (Ig) repertoires exhibit reduced junctional diversity due to physiologic terminal deoxynucleotidyl transferase (TdT) insufficiency. To test the effect of N addition on humoral responses, we transplanted bone marrow from TdT-deficient (TdT) and wild-type (TdT) BALB/c mice into recombination activation gene 1-deficient BALB/c hosts. Mice transplanted with TdT cells exhibited diminished humoral responses to the T-independent antigens α-1-dextran and (2,4,6-trinitrophenyl) hapten conjugated to AminoEthylCarboxymethyl-FICOLL, to the T-dependent antigens NPCGG and hen egg lysozyme, and to Enterobacter cloacae, a commensal bacteria that can become an opportunistic pathogen in immature and immunocompromised hosts. An exception to this pattern of reduction was the T-independent anti-phosphorylcholine response to Streptococcus pneumoniae, which is normally dominated by the N-deficient T15 idiotype. Most of the humoral immune responses in the recipients of TdT bone marrow were impaired, yet population of the blood with B and T cells occurred more rapidly. To further test the effect of N-deficiency on B cell and T cell population growth, transplanted TdT-sufficient and -deficient BALB/c IgM and congenic TdT-sufficient CB17 IgM bone marrow were placed in competition. TdT cells demonstrated an advantage in populating the bone marrow, the spleen, and the peritoneal cavity. TdT deficiency, which characterizes fetal lymphocytes, thus appears to facilitate filling both central and peripheral lymphoid compartments, but at the cost of altered responses to a broad set of antigens. [ABSTRACT FROM AUTHOR]

Natural-killer group 2 member D (NKG2D) is an activating receptor that plays an important role in the immune response mediated by NK cells, γδ T cells, and CD8 T cells. In humans, MHC class I chain-related genes and UL-16 binding protein (ULBP)/retinoic acid early transcript 1 (REAT1) gene family encode ligands for NKG2D. The rhesus and crab-eating macaques, which belong to the Old World monkeys, are widely used as non-human primate models in medical researches on the immunological process. In the present study, we investigated the polymorphisms of ULBP4/ RAET1E, a member of the ULBP/RAET1 family, and found 25 and 14 alleles from the rhesus and crab-eating macaques, respectively, of which diversities were far more extended than in humans. A phylogenetic study suggested that the allelic diversification of ULBP4/RAET1E predated the divergence of rhesus and crab-eating macaques. [ABSTRACT FROM AUTHOR]

Myxovirus-resistance (Mx) proteins are produced by host cells in response to type I interferons, and some members of the Mx gene family in mammals have been shown to limit replication of influenza and other viruses. According to an early report, chicken Mx1 variants encoding Asn at position 631 have antiviral activity, whereas variants with Ser at 631 lack activity in experiments evaluating Mx1 complementary DNA (cDNA) expressed ectopically in a cell line. We evaluated whether the Mx1 631 dimorphism influenced pathogenesis of highly pathogenic avian influenza virus (HPAIV) infection in chickens of two commercial broiler lines, each segregating for Asn631 and Ser631 variants. Following intranasal infection with HPAIV strain A/Chicken/Queretaro/14588-19/1995 H5N2, chickens homozygous for Asn631 allele were significantly more resistant to disease based on early mortality, morbidity, or virus shedding than Ser631 homozygotes. Higher amounts of splenic cytokine transcripts were observed in the Ser631 birds after infection, consistent with higher viral loads seen in this group and perhaps contributing to their higher morbidity. Nucleotide sequence determination of Mx1 cDNAs demonstrated that the Asn631 variants in the two chicken lines differed at several amino acid positions outside 631. In vitro experiments with a different influenza strain (low pathogenicity) failed to demonstrate an effect of Mx1 Asn631 on viral replication suggesting that in vivo responses may differ markedly from in vitro, or that choice of virus strain may be critical in demonstrating effects of chicken Mx1. Overall, these studies provide the first evidence that Mx1 has antiviral effects in chickens infected with influenza virus. [ABSTRACT FROM AUTHOR]

The Simian immunodeficiency virus (SIV)-infected Indian rhesus macaque ( Macaca mulatta) is the most established model of HIV infection and AIDS-related research, despite the potential that macaques of Chinese origin is a more relevant model. Ongoing efforts to further characterize the Chinese rhesus macaques' major histocompatibility complex (MHC) for composition and function should facilitate greater utilization of the species. Previous studies have demonstrated that Chinese-origin M. mulatta (Mamu) class I alleles are more polymorphic than their Indian counterparts, perhaps inferring a model more representative of human MHC, human leukocyte antigen (HLA). Furthermore, the Chinese rhesus macaque class I allele Mamu -A1*02201, the most frequent allele thus far identified, has recently been characterized and shown to be an HLA-B7 supertype analog, the most frequent supertype in human populations. In this study, we have characterized two additional alleles expressed with high frequency in Chinese rhesus macaques, Mamu -A1*02601 and Mamu -B*08301. Upon the development of MHC-peptide-binding assays and definition of their associated motifs, we reveal that these Mamu alleles share peptide-binding characteristics with the HLA-A2 and HLA-A3 supertypes, respectively, the next most frequent human supertypes after HLA-B7. These data suggest that Chinese rhesus macaques may indeed be a more representative model of HLA gene diversity and function as compared to the species of Indian origin and therefore a better model for investigating human immune responses. [ABSTRACT FROM AUTHOR]

Major histocompatibility complex (MHC) genes are important for vertebrate immune response and typically display high levels of diversity due to balancing selection from exposure to diverse pathogens. An understanding of the structure of the MHC region and diversity among functional MHC genes is critical to understanding the evolution of the MHC and species resilience to disease exposure. In this study, we characterise the structure and diversity of class II MHC genes in little spotted kiwi Apteryx owenii, a ratite bird representing the basal avian lineage (paleognaths). Results indicate that little spotted kiwi have a more complex MHC structure than that of other non-passerine birds, with at least five class II MHC genes, three of which are expressed and likely to be functional. Levels of MHC variation among little spotted kiwi are extremely low, with 13 birds assayed having nearly identical MHC genotypes (only two genotypes containing four alleles, three of which are fixed). These results suggest that recent genetic drift due to a species-wide bottleneck of at most seven birds has overwhelmed past selection for high MHC diversity in little spotted kiwi, potentially leaving the species highly susceptible to disease. [ABSTRACT FROM AUTHOR]

Polymorphic variability in immune response genes, such as IL12B, encoding the IL-12p40 subunit is associated with susceptibility to severe malaria in African populations. Since the role of genetic variation in conditioning severe malaria in Thai adults is largely unexplored, the functional association between IL12B polymorphisms [i.e. IL12Bpro (rs17860508) and IL12B 3′ UTR T/G (rs3212227)], severe malaria and cytokine production was examined in patients with Plasmodium falciparum infections ( n = 355) recruited from malaria endemic areas along the Thai–Myanmar border in northwest Thailand. Circulating IL-12p40 ( p = 0.049) and IFN-γ ( p = 0.051) were elevated in patients with severe malaria, while only IL-12p40 was significantly higher in severe malaria patients with hyperparasitaemia ( p = 0.046). Carriage of the IL12Bpro1.1 genotype was associated with enhanced severity of malaria (OR, 2.34; 95% CI, 0.94–5.81; p = 0.066) and hyperparasitaemia (OR, 3.42; 95% CI, 1.17–9.87; p = 0.025) relative to the IL12Bpro2.2 genotype (wild type). Individuals with the IL12Bpro1.1 genotype also had the lowest IL-12p40 ( p = 0.002) and the highest IFN-γ ( p = 0.004) levels. Construction of haplotypes revealed that carriage of the IL12Bpro-2/3′ UTR-T haplotype was associated with protection against severe malaria (OR, 0.51; 95% CI, 0.29–0.90; p = 0.020) and reduced circulating IFN-γ ( p = 0.06). Thus, genotypic and haplotypic variation at IL12Bpro and IL12B 3′ UTR in this population influences susceptibility to severe malaria and functional changes in circulating IL-12p40 and IFN-γ levels. Results presented here suggest that protection against severe malaria in Thai adults is associated with genotypic variants that condition enhanced IL-12p40 and reduced IFN-γ levels. [ABSTRACT FROM AUTHOR]

The common marmoset ( Callithrix jacchus) is useful as a nonhuman primate model of human diseases. Although the marmoset model has great potential for studying autoimmune diseases and immune responses against pathogens, little information is available regarding the genes involved in adaptive immunity. Here, we identified one TCR α constant (TRAC), 46 TRAJ (joining), and 35 TRAV (variable) segments from marmoset cDNA. Marmoset TRAC, TRAJ, and TRAV shared 80%, 68–100%, and 79–98% identity with their human counterparts at the amino acid level, respectively. The amino acid sequences were less conserved in TRAC than in TCRβ chain constant (TRBC). Comparative analysis of TRAV between marmosets and humans showed that the rates of synonymous substitutions per site ( d S) were not significantly different between the framework regions (FRs) and complementarity determining regions (CDRs), whereas the rates of nonsynonymous substitutions per site ( d N) were significantly lower in the FRs than in CDRs. Interestingly, the d N values of the CDRs were greater for TRBV than TRAV. These results suggested that after the divergence of Catarrhini from Platyrrhini, amino acid substitutions were decreased in the FRs by purifying selection and occurred more frequently in CDRβ than in CDRα by positive selection, probably depending on structural and functional constraints. This study provides not only useful information facilitating the investigation of adaptive immunity using the marmoset model but also new insight into the molecular evolution of the TCR heterodimer in primate species. [ABSTRACT FROM AUTHOR]

Killer cell immunoglobulin-like receptors ( KIR) gene frequencies vary between populations and contribute to functional variation in immune responses to viruses, autoimmunity and reproductive success. This study describes the frequency distribution of 12 variable KIR genes and their HLA-C ligands in two Iranian populations who have lived for many generations in different environments: the Azerbaijanis at high altitude and the Jonobi people at sea level. The results are compared with those published for other human populations and a large group of English Caucasians. Differences were seen in KIR and HLA-C group frequencies, in linkage disequilibrium and inhibitory/activating KIR ratios between the groups. Similarities with geographically close populations in the frequencies of the KIR A and B haplotypes and KIR AA genotype reflected their common ancestry. The extreme variability of the KIR gene family and their HLA-C ligands is highlighted and their importance in defining differences between geographically and culturally isolated communities subject to different environmental pressures who come from the same ethnic grouping. [ABSTRACT FROM AUTHOR]

Mannose receptor is a member of the C-type lectin receptor family involved in pathogen molecular pattern recognition and thought to be critical in shaping host immune responses and maintaining homeostasis. The aim of this study was to investigate potential associations of genetic variants in the MRC1 gene with asthma in two independent populations. Seven single-nucleotide polymorphisms (SNPs; rs2477637, rs2253120, rs2477631, rs2477664, rs692527, rs1926736, and rs691005) in the MRC1 gene locus were genotyped and evaluated regarding association with asthma in 870 unrelated Japanese subjects (446 asthmatics, 424 controls). The same markers were validated in 176 unrelated African–American subjects (86 asthmatics, 90 controls). Suggestive evidence of association between five SNPs (rs2477637, rs2253120, rs2477664, rs692527, and rs1926736) and asthma was observed in the analysis of the Japanese population independent of sex, age, smoking status, and atopic status. SNPs rs692527 and rs691005 showed significant association with asthma in the African–American population. Haplotypes containing two linked SNPs (rs692527 and rs1926736) were significantly associated with asthma in both Japanese and African–American populations. Our results suggest that sequence variations in the MRC1 gene are associated with the development of asthma in two independent and ethnically diverse populations. [ABSTRACT FROM AUTHOR]

The restricted diversity of the major histocompatibility complex (MHC) of Mauritian cynomolgus macaques provides powerful opportunities for insight into host-viral interactions and cellular immune responses that restrict lentiviral infections. However, little is known about the effects of Mhc haplotypes on control of SIV in this species. Using microsatellite-based genotyping and allele-specific PCR, Mhc haplotypes were deduced for 35 macaques infected with the same stock of SIVmac251. Class I haplotype H6 was associated with a reduction in chronic phase viraemia ( p = 0.0145) while a similar association was observed for H6 class II ( p = 0.0063). An increase in chronic phase viraemia, albeit an insignificant trend, was observed in haplotype H5-positive animals. These results further emphasise the value of genetically defined populations of non-human primates in AIDS research and provide a foundation for detailed characterisation of MHC restricted cellular immune responses and the effects of host genetics on SIV replication in cynomolgus macaques. [ABSTRACT FROM AUTHOR]

Murine models of allergic lung disease have many similar traits to asthma in humans and can be used to investigate mechanisms of allergic sensitization and susceptibility factors associated with disease severity. The purpose of this study was to determine strain differences in allergic airway inflammation, immunoglobulin production, and changes in respiratory responses between systemic and mucosal sensitization routes in BALB/cJ, FVB/NJ, and C57BL/6J, and to provide correlations between immune and pathophysiological endpoints. After a single intranasal ovalbumin (OVA) challenge, all three strains of mice systemically sensitized with OVA and adjuvant exhibited higher airflow limitation than non-sensitized mice. No changes were seen in mice that were pre-sensitized via the nose with OVA. Systemic sensitization resulted in an elevated response to methacholine (MCH) in BALB/cJ and FVB/NJ mice and elevated total and OVA-specific IgE levels and pulmonary eosinophils in all three strains. The mucosal sensitization and challenge produced weaker responses in the same general pattern with the C57BL/6J strain producing less serum IgE, IL5, IL13, and eosinophils in lung fluid than the other two strains. The converse was found for IL6 where the C57BL/6J mice had more than twice the amount of this cytokine. The results show that the FVB/NJ and BALB/cJ mice are higher Th2-responders than the C57BL/6J mice and that the levels of pulmonary eosinophilia and cytokines did not fully track with MCH responsiveness. These differences illustrate the need to assess multiple endpoints to provide clearer associations between immune responses and type and severity of allergic lung disease. [ABSTRACT FROM AUTHOR]

Salmonella typhimurium and Campylobacter jejuni pose significant risks to human health and poultry are a major vector for infection. Comparative in vivo infection models were performed to compare the avian host immune response to both bacterial species. Forty-five commercial broiler chickens were orally challenged with either C. jejuni or S. typhimurium whilst 60 similar control birds were mock challenged in parallel. Birds were sacrificed at 0, 6, 20 and 48 h post-infection and cloacal swabs, blood and tissue samples taken. Peripheral blood leukocytes were isolated for flow cytometric analyses and RNA was extracted for gene expression profiling. Colonisation patterns were markedly different between the two bacterial species, with systemic colonisation of Campylobacter outside the gastrointestinal tract. Salmonella infection induced significant changes in circulating heterophil and monocyte/macrophage populations, whilst Campylobacter infection had no effect on the heterophil numbers but caused a significant early increase in circulating monocytes/macrophages. Toll-like receptor 1 ( TLR1) gene expression was decreased, and avian β-defensin (AvBD) gene expression ( AvBD3, AvBD10 and AvBD12) was significantly increased in response to Salmonella infection ( P < 0.05). In contrast, Campylobacter infection induced increased TLR21 gene expression but significantly reduced expression of seven antimicrobial peptide (AMP) genes ( AvBD3, AvBD4, AvBD8, AvBD13, AvBD14, CTHL2 and CTHL3; P < 0.05). Considered together, microbiological, cellular and gene expression profiles indicate that the innate immune system responds differently to Salmonella and to Campylobacter infection. Furthermore, reduction in the expression of AMPs may play a role in the persistence of high level colonisation of the host by Campylobacter. [ABSTRACT FROM AUTHOR]

Recent large-scale cDNA cloning studies have shown that a significant proportion of the transcripts expressed from vertebrate genomes do not appear to encode protein. Moreover, it was reported in mammals (human and mice) that these non-coding transcripts are expressed and regulated by mechanisms similar to those involved in the control of protein-coding genes. We have produced a collection of cDNA sequences from immunologically active tissues with the aim of discovering chicken genes involved in immune mechanisms, and we decided to explore the non-coding component of these immune-related libraries. After finding known non-coding RNAs (miRNA, snRNA, snoRNA), we identified new putative mRNA-like non-coding RNAs. We characterised their expression profiles in immune-related samples. Some of them showed changes in expression following viral infections. As they exhibit patterns of expression that parallel the behaviour of protein-coding RNAs in immune tissues, our study suggests that they could play an active role in the immune response. [ABSTRACT FROM AUTHOR]

Killer cell immunoglobulin-like receptors ( KIR) gene frequencies have been shown to be distinctly different between populations and contribute to functional variation in the immune response. We have investigated KIR gene frequencies in 370 individuals representing three Asian populations in Singapore and report here the distribution of 14 KIR genes ( 2DL1, 2DL2, 2DL3, 2DL4, 2DL5, 2DS1, 2DS2, 2DS3, 2DS4, 2DS5, 3DL1, 3DL2, 3DL3, 3DS1) with two pseudogenes ( 2DP1, 3DP1) among Singapore Chinese ( n = 210); Singapore Malay ( n = 80), and Singapore Indian ( n = 80). Four framework genes ( KIR3DL3, 3DP1, 2DL4, 3DL2) and a nonframework pseudogene 2DP1 were detected in all samples while KIR2DS2, 2DL2, 2DL5, and 2DS5 had the greatest significant variation across the three populations. Fifteen significant linkage patterns, consistent with associations between genes of A and B haplotypes, were observed. Eighty-four distinct KIR profiles were determined in our populations, 38 of which had not been described in other populations. KIR haplotype studies were performed using nine Singapore Chinese families comprising 34 individuals. All genotypes could be resolved into corresponding pairs of existing haplotypes with eight distinct KIR genotypes and eight different haplotypes. The haplotype A2 with frequency of 63.9% was dominant in Singapore Chinese, comparable to that reported in Korean and Chinese Han. The A haplotypes predominate in Singapore Chinese, with ratio of A to B haplotypes of approximately 3:1. Comparison with KIR frequencies in other populations showed that Singapore Chinese shared similar distributions with Chinese Han, Japanese, and Korean; Singapore Indian was found to be comparable with North Indian Hindus while Singapore Malay resembled the Thai. [ABSTRACT FROM AUTHOR]

Interleukins 4 and 13 (IL-4 and IL-13) are related cytokines important for Th2 immune responses and encoded by adjacent genes on human chromosome 5. Efforts were made previously to detect these genes in fish, but research was hampered by a lack of sequence conservation. A Tetraodon nigrovirides (green spotted pufferfish) gene was annotated as IL-4 by Li et al. ( Mol Immunol, 44:2078–2086, ), but this annotation was not well substantiated. However, the present study concludes that the reported pufferfish gene belongs to the IL-4/13 lineage indeed, while also describing an additional IL-4/13 copy in a paralogous genomic region. Our analyses of IL-4/13 loci in fish describe (1) genomic region history, (2) characteristic intron–exon organization, (3) deduced IL-4/13 molecules for several teleost fish species, (4) IL-4/13 lineage-specific protein motifs including a cysteine pair (pair 1), and (5) computer software predictions of a type I cytokine fold. Teleost IL-4/13 molecules have an additional cysteine pair (pair 2) or remnants thereof, which is absent in mammalian IL-4 and IL-13. We were unable to determine if the teleost IL-4/13 genes are orthologous to either IL-4 or IL-13, or if these mammalian genes separated later in evolution. [ABSTRACT FROM AUTHOR]