Search

Most hops are produced in Europe; therefore, it is alarming that the citrus bark cracking viroid (CBCVd), the causal agent of the severe hop stunt disease, was detected in different nonadjacent hop growing countries. It is still unclear how the initial infection occurred since CBCVd is typically found in citrus and not in hops. To extent data for a viroid risk assessment, potential hosts were tested for the presence of viroids in grocery stores in the hop producing areas of Slovenia and Germany. Samples positive for hop-pathogenic viroids were further used for infection studies. The surveys covered CBCVd, hop stunt viroid (HSVd), citrus exocortis viroid (CEVd), citrus dwarfing viroid (CDVd), citrus viroid V (CVdV), and citrus bent leaf viroid (CBLVd). The results show that all tested viroids can be found in fruits sold in grocery stores, thus there is a risk of introducing CBCVd, HSVd, and other viroids into the hop growing regions via imported fruits and their remains. Furthermore, the transmission study reveals that CBCVd and HSVd infected citrus fruits can lead to infected plants, irrespective of the type of inoculum whether in the form of RNA extract, injected sap, or fruit peel in the soil. Finally, the phylogenetic analysis showed that the sequence diversity within viroid samples is high and that CBCVd and HSVd sequence variants can be found, which are almost identical to variants confirmed in hop. We assumed that fruit imports contribute to international viroid spreading and inappropriate handling like fruit waste deposition to agricultural lands is a serious risk factor. [ABSTRACT FROM AUTHOR]

This article reports the first record of coleus blumei viroid 1 (CBVd-1) in Australia. The viroid was detected in an asymptomatic coleus plant sample obtained from New South Wales. Further analysis confirmed the presence of CBVd-1 in multiple samples, and the viroid was identified through high throughput sequencing. CBVd-1 is a predominant species in the genus Coleviroid and has been reported worldwide. More surveys are needed to determine if CBVd-1 is the only coleus-infecting viroid in Australia. The research was funded by CAUL and its Member Institutions, and the data is publicly available. [Extracted from the article]

A multiplex RT-PCR reaction was developed and validated for the simultaneous detection of two viruses and two viroids: grapevine fleck virus, grapevine Pinot gris virus, grapevine yellow speckle viroid 1, and hop stunt viroid. The multiplex reaction specificity was verified on a set of 210 grapevines from the Czech Republic. The results showed the occurrence of hop stunt viroid in 94.3% of the examined plants, while incidence of the other pathogens was lower: grapevine Pinot gris virus (64.8%), grapevine yellow speckle viroid 1 (52.4%), and grapevine fleck virus (15.2%). [ABSTRACT FROM AUTHOR]

Next-generation sequencing (NGS)-based studies have reported a large amount of transcriptome data. In fact, plant transcriptome data sometimes contain sequence reads associated with viruses and viroids. Recently, we screened several grapevine transcriptomes to identify viruses and viroids that infect grapevine and we selected a transcriptome of the grapevine cultivar Cabernet Sauvignon for an in silico data analysis. After de novo assembly of raw data, the obtained contigs were blasted against a virus reference database. We identified five viruses and two viroids that infected the grapevine. We discovered that 2.16% of the transcriptome was comprised of viral RNAs, with more than half of the viral reads deriving from grapevine rupestris stem pitting-associated virus. However, the RNA populations of the two viroids were more than half of the total viral population based on the viral RNA copy number. Moreover, we identified single nucleotide polymorphisms for each virus and viroid and performed phylogenetic analyses. Taken together, we report the successful application of plant transcriptome data using bioinformatics analyses in the identification of five viruses and two viroids in the grapevine cultivar Cabernet Sauvignon, which is one of the most important grapevine cultivars in the world. [ABSTRACT FROM AUTHOR]

A field survey was conducted in commercial orchards of Cap Bon region and at the INRAT citrus collection to identify the prevalence of citrus viroids in Tunisia. Samples were collected from 202 trees grafted on sour orange (Citrus aurantium L.) including 35 common mandarin and 40 Cassar clementine trees showing cachexia symptoms. Sequential PAGE (sPAGE) analysis and molecular hybridization using viroid-specific probes revealed that all plants were infected with at least two viroids. Citrus exocortis viroid (CEVd), hop stunt viroid (HSVd) and citrus dwarfing viroid (CDVd) were found to be widespread and accounted for 70.3%, 72.3% and 78.2% of the tested trees, respectively. Citrus bent leaf viroid (CBLVd) and citrus bark cracking viroid (CBCVd) were found in 28.2% and 3.0% of trees, respectively. The most frequent viroid combinations found were CEVd+HSVd+CDVd (34.7%) and HSVd+CDVd (22.3%). Other combinations such as CBLVd+HSVd+CDVd (12.9%), CEVd+CBLVd+HSVd (11.9%) and CEVd+CDVd (10.8%) were less frequent. CEVd and CDVd isolates were RT-PCR amplified, cloned and sequenced, then compared with sequences from other parts of the world deposited in GenBank. The three CEVd clones sequenced had 99% similarity with each other and shared ca. 99% similarity with those from Iran, Greece, and Syria. CDVd isolates were 100% similar and shared >96% similarity with other isolates from Brazil, Cyprus, Greece, Uruguay, Israel and Spain. [ABSTRACT FROM AUTHOR]

Six viroids have been reported to infect grapevine and among which only Grapevine yellow speckle viroid-1 (GYSVd-1) and Grapevine yellow speckle viroid-2 (GYSVd-2) are able to induce yellow speckle (YS) disease, characterized by yellowish flecks scattered on the leaf blade or massed along the veins. The mixed infection of GYSVd-1 or GYSVd-2 with Grapevine fanleaf virus (GFLV) may elicit vein banding (VB), a syndrome characterized by chrome-yellow flecks along the main veins of mature leaves and expanding through the interveinal tissues of infected leaves. In the present study, we have developed a multiplex RT-PCR (mRT-PCR) for simultaneous detection of GYSVd-1, GYSVd-2 and GFLV. Hop stunt viroid (HSVd), another viroid that infects most grapevines worldwide is used as a positive control instead of a host-derived internal control. The test developed in this study proved to be reliable for simultaneous detection of three pathogens, i.e. GYSVd-1, GYSVd-2 and GFLV in grapevine; hence it is useful for detection of YS and VB in large-scale surveys and certification programs. [ABSTRACT FROM AUTHOR]

Stone fruits orchards from three Chilean regions were visited to collect leaf samples which were tested for the presence of the most important viruses and viroids. Molecular nonradioactive hybridization (MH) testing of 2,456 samples and confirmatory RT-PCR of some MH-negative samples gave the following infection rates: 31.5% for Prunus necrotic ringspot virus (PNRSV); 31.3% for Prune dwarf virus (PDV); 25.7% for Peach latent mosaic viroid (PLMVd); 3.1% for Tomato ringspot virus (ToRSV) only in rootstocks; 1.8% for Plum pox virus (PPV); 1.2% for Hop stunt viroid (HSVd); 1.1% for Apple mosaic virus (ApMV); and 0.9% for Apple chlorotic leaf spot virus (ACLSV). American plum line pattern virus (APLPV) was not detected. The overall infection rate in the surveyed orchards was 29.6%, specifically 28.2% (Región Metropolitana), 23.4% (Valparaiso) and 33% (Bernardo O'Higgins) in the three regions surveyed. ApMV and HSVd, detected only in peach and nectarine, are new records in stone fruits in Chile. [ABSTRACT FROM AUTHOR]

The article offers information on grapevine yellow speckle viroids (GYSVds), the non coding genomes which are subviral pathogerns of the plant. Information regarding the common symptoms, detection, and disease transmission, are discussed. The article also mentioned the varietal susceptibility, geographical distribution, and preventive method such as the use of viroid-free propagative material through meristem tip culture and somatic embryogenesis.

Potato spindle tuber viroid (PSTVd) was the first species of the genus Pospiviroid detected in naturally infected symptomless ornamental plants (Solanum jasminoides) in 2006. Since then, other pospiviroid species were found in several naturally infected solanaceous ornamentals. The combination of latent infection, the widespread occurrence and the possibility of transmission to edible solanaceous crops (tomato and potato) has made the development of accurate and reliable molecular diagnostic detection methods a high priority. The aim of this study was the development of a genus-specific RT-PCR protocol, using universal pospiviroid primers, which would allow also a species-specific identification through restriction fragment length polymorphism (RFLP) analysis. The primers were designed to amplify the majority of the pospiviroid genome (ca. 80%) and the identification of each species using appropriate restriction endonuclease enzymes (AluI and Sau96I). The method was evaluated for specificity using healthy and/or non-target viroid-infected plants and for sensitivity using serial dilutions of total RNA extracted from plants infected by different pospiviroid species. The reliability of the method was successfully ascertained during a survey when numerous plants of the families Solanaceae and Asteraceae were assayed for single and mixed infection of pospiviroid species. [ABSTRACT FROM AUTHOR]

In Brazil, the ornamental flowers and plants market moves in the wholesale and retail more than two billion US dollars annually, and chrysanthemum stands out as one of the most valuable commercial species. The stunting disease induced by Chrysanthemum stunt viroid (CSVd) has become a serious problem in chrysanthemum production systems worldwide. CSVd incites also colour breaking and retards flowering, but in many situations it does not induce visible symptoms, facilitating its spread in the field and passing international borders unnoticed. In Brazil there are few studies on this pathogen, with a single report of its possible occurrence in chrysanthemum in the State of São Paulo. In this work we aimed at surveying, identifying and characterizyng viroids in chrysanthemum crops in the State of São Paulo; challenging chrysanthemum varieties with a Brazilian CSVd isolate; and establishing diagnostic strategies to strengthen quarantine and indexing programs. Our survey showed that CSVd is widely disseminated in chrysanthemum crops in the State of São Paulo. All evaluated chrysanthemum varieties were susceptible of infection, although infection was sometimes symptomless. The complete genome sequencing of seven CSVd isolates showed high nucleotide identity when compared with other isolates from databases. Specific oligonucleotides were designed for conventional RT-PCR and RT-qPCR CSVd analysis. Results show that CSVd can be identified with a sensitivity about 100,000 times higher than PAGE. Dotblot proved also to be highly sensitive and, consequently, most useful for large scale diagnosis. This is the first biological and molecular identification and characterization of CSVd isolates in Brazil. [ABSTRACT FROM AUTHOR]

Out of 16 plants positive for WSMV with DAS-ELISA (Agdia, Inc.), one was found to be co-infected with TriMV using RT-PCR with the primers TriMV-F and TriMV-R (Rupp et al. [2]). Keywords: Viruses and viroids; Pathogen detection EN Viruses and viroids Pathogen detection 695 696 2 05/06/21 20210501 NES 210501 Triticum mosaic virus (TriMV; genus I Poacevirus, i family I Potyviridae i ) occurs widely in the Great Plains region of the United States (Byamukama et al. [1]). [Extracted from the article]

The citrus industry in Iran is based on graft propagation of local and imported cultivars on a limited number of rootstocks such as sour orange, Mexican lime and Bakraee, a local natural hybrid. Infection of the available cultivars with graft-transmissible agents, viroids in particular, may have deleterious effects on the productivity of citrus and, more importantly, limits the choice of rootstocks. Rootstocks other than sour orange and Mexican lime will be needed as a consequence of the introduction and spread of Citrus tristeza virus (CTV) in the country. In the present study, two cv. Sanguinello sweet orange and two cv. Duncan grapefruit trees were selected on the basis of the bark scaling symptoms observed on the trifoliate orange and Troyer citrange rootstocks. Analysis by sPAGE and Northern blot hybridization of nucleic acid preparations of Etrog citrons graft-inoculated with these sources revealed the presence of several viroids: Citrus exocortis viroid (CEVd) and Hop stunt viroid (HSVd), the causal agents of exocortis and cachexia, respectively, as well as Citrus bent leaf viroid (CBLVd), Citrus dwarfing viroid (CDVd) and Citrus bark cracking viroid (CBCVd). These viroids were sequenced and compared with the corresponding reference sequences. To extend these results, samples from different citrus cultivars were collected in the two main citrus growing regions and analyzed for viroids. Of the 49 samples tested, 22 were viroid-positive, witnessing the occurrence of cultivars infected with CEVd, HSVd, CBLVd, CDVd, or CBCVd as mixed infections in the surveyed regions. One sample was also co-infected with the newly described Citrus viroid V (CVd-V). [ABSTRACT FROM AUTHOR]

The occurrence of Citrus exocortis viroid (CEVd), Citrus bent leaf viroid (CBLVd), Hop stunt viroid (HSVd), Citrus dwarfing viroid (CDVd), Citrus bark cracking viroid (CB-CVd) and Citrus viroid VI (CVd-VI) in Citrus spp. cultivated in six provinces of Uruguay was surveyed in 2008-2009 and 2009-2010 growing seasons using Northern blot hybridization. Sixty two per cent of surveyed trees were infected with either single or mixed viroid inocula, the latter being more abundant. CBCVd and CVd-VI were not detected in the samples analyzed. HSVd showed the highest prevalence (92%) among infected plants followed by CDVd (50%), CEVd (23%) and CBLVd (19%). The most frequently observed viroid combination was HSVd+CDVd. Our results showed that CEVd, CBLVd, HSVd, CDVd are widespread throughout citrus orchards in Uruguay and highlight the presence of mixed viroid infections. [ABSTRACT FROM AUTHOR]

In a survey of apple virus diseases in China, typical symptoms of Apple dimple fruit viroid (ADFVd) infections were observed. The presence of ADFVd in samples of symptomatic fruits and symptomless leaves from different apple trees was confirmed by RT-PCR, sequencing and dot blot hybridization. Sequence alignment and RNA structure analysis showed that, compared with isolates and variants reported in Italy, there were two nucleotide variations and an alteration of the secondary structure in the AD-FVd variants we isolated. Phylogenetic analysis revealed the four variants from China clustered in a group separate from previously reported isolates and variants from Italy and Japan. This is the first report of the identification and molecular characterization of ADFVd in China. [ABSTRACT FROM AUTHOR]

Field surveys were carried out in the main peach-growing areas of China to assess the virus or viroid disease status of peach trees. A total of 505 leaf samples were tested by ELISA or RT-PCR for the presence of nine major peach viruses. The viruses most frequently detected were Apple chlorotic leaf spot virus (ACLSV) (71.8%), followed by Prunus necrotic ringspot virus (PNRSV) (20.2%), Cherry green ring mottle virus (CGRMV) (8.1%), and Apricot pseudo-chlorotic leaf spot virus (APCLSV) (1.6%). The overall average of virus infection level in peach trees was 24.6%. Apple mosaic virus (ApMV), Plum pox virus (PPV), Prune dwarf virus (PDV), Cherry virus A (CVA) and Cherry leaf roll virus (CLRV) were not detected. Of another 583 leaf samples tested for the presence of the known major peach viroids, by dot-blot hybridization, 444 (76.2%) were infected. Peach latent mosaic viroid (PLMVd) and Hop stunt viroid (HSVd) were detected in 443 and 18 samples, respectively. This is the first large-scale study on major viruses and viroids that infect peach trees in China. [ABSTRACT FROM AUTHOR]

Chrysanthemum stunt viroid (CSVd) has been detected or isolated from chrysanthemums or other host species in 26 countries. While strains (biological variants) have been described for many viroids, strains have not been described as such specifically for CSVd, despite the determination of 117 sequence variants of CSVd in 16 countries. Tomato has been described as an experimental host, either symptomless, or showing mild, or even severe symptoms, depending on the report; however, most of these studies were done with single isolates of CSVd and one cultivar of tomato plants. Thus, here we re-examined these issues by directly comparing the biological activity of three isolates of CSVd, one each from the USA, China and Australia, varying in their nucleotide sequence. We found that these isolates showed no differences in symptoms induced on either chrysanthemum or tomato plants, suggesting that much of the biological variation reported previously may have been due to cultivar differences and/or environmental effects. [ABSTRACT FROM AUTHOR]

Chrysanthemum stunt viroid (CSVd) is a quarantine pathogen for chrysanthemum (Dendranthema spp.) in the European countries (Plant Health Directive 2000/29/EC), because this host is severely affected, thus comes down with a disease characterized by stunting, leaf chlorosis and floral disorders. CSVd spread in Europe has efficiently been restrained so far, although several outbreaks were recorded in the past. Here we report the first occurrence of CSVd in Italy, as detected in several symptomless cultivars of Argyranthemum frutescens (marguerite daisy) by RT-PCR with specific primers and by Northern blot hybridization with a specific digoxigenin-labeled riboprobe. Viroid identity was ultimately ascertained by cloning and sequencing cDNA amplicons. Molecular characterization of CSVd isolates from six different A. frutescens cultivars disclosed viroid RNA populations with a prevalent size of 354 nt and sequences 98-100% identical to those of CSVd variants reported previously from D. grandiflora and A. frutescens. These results call for a prompt extension of surveys for assessing the presence of CSVd in symptomless A. frutescens and other ornamentals, which could constitute hidden reservoirs of this pathogen. In view of this, a tissue-printing hybridization method for detecting CSVd in A. frutescens was tested and validated. [ABSTRACT FROM AUTHOR]

The USDA National Clonal Germplasm Repository (NGCR) at the University of California, Davis is recognized as one of the richest sources of Prunus species material in the US. The repository maintains more than 2450 trees representing 96 taxa collected from around the world. However, the phytosanitary status of the NCGR Prunus collection has not been thoroughly evaluated. In this study, a comprehensive screening of a selected subset of the collection for virus and virus-like diseases affecting Prunus trees has been completed. Two factors were considered for selecting the trees: the country of origin and the observation of suspicious disease symptoms. A total of 221 trees representing 185 different cultivars of cherry, almond, peach, apricot and plum were sampled. Conventional RT-PCR detection was used to test for 13 different viruses and two viroids. The pathogens included in the survey were Prunus necrotic ringspot virus (PNRSV), Prune dwarf virus (PDV), Plum bark necrosis stem pitting-associated virus (PBNSPaV), American plum line pattern virus (APLPV), Cherry virus A (CVA), Cherry leafroll virus (CLRV), Cherry rasp leaf virus (CRLV), Cherry green ring mottle virus (CGRMV), Cherry necrotic rusty mottle virus (CNRMV), Apple chlorotic leafspot virus (ACLSV) Tomato ringspot virus (ToRSV), Little cherry virus 1 (LChV-1), Little cherry virus 2 (LChV-2), Peach latent mosaic viroid (PLMVd) and Hop stunt viroid (HSVd). Though the majority of these trees were asymptomatic, all tested pathogens were detected except for ToRSV and CRLV. Two of the viruses detected (ACLSV and LChV-2) had never been reported from California. Incidence of PNRSV in tested trees was the highest (55 trees) followed by the two viroids (PLMVd and HSVd), with 33 and 32 infected trees, respectively. The incidence for the rest of the pathogens ranged between 0 to 19 trees. The infection rate of all tested samples ranged from 0.5% to 24.9%. [ABSTRACT FROM AUTHOR]

In 2014, some registered native grapevine cultivars from Apulia were analyzed to determine their "absolute" sanitary status (virome) i.e. the totality of virus, viroids and phytoplasmas, present in any single accession, using a high throughput sequencing (HTS) approach (Giampetruzzi et al., 2015). Small RNA libraries synthesized from a symptomless red-berried wine grapevine of cv. Bombino nero (accession D205), growing in a foundation block, showed the presence of 21 contigs (ranging from 329 to 56 nucleotides in length) which, upon BLASTX analysis (Altschul et al., 1997), were identified as badnavirus-like sequences. To confirm deep-sequencing findings, a set of PCR specific primers (11for-G: 5'CAAAGTAAGAGCAATCCTTGATACCGG3'; 13rev-G: 5' CCCAATGTTACAGATCACCATCTCCTG3') were designed, using the closest reference sequence, i.e. Fig badnavirus 1 (FBV-1, GenBank NC017830). A product of the expected size (410 bp) was amplified and custom-sequenced, showing ca. 91% identity at the nucleotide level with the sequence of a badnavirus recently discovered in Greece (Maliogka et al., 2015) and denoted Grapevine Roditis leaf discoloration-associated virus (GRLDaV, NC027131). For a preliminary assessment of the incidence of this virus in the field, a preliminary survey in the same foundation block was conducted. A total of 11 samples from different autochthonous cultivars were checked by PCR, but none of them tested positive. It is worth nothing that accession D205 is a registered clone, which has been inspected for years by laboratory testing and field indexing without revealing the presence of regulated viruses, nor showing symptoms. To our knowledge, this is the first report of GRLDaV in Italy. [ABSTRACT FROM AUTHOR]

An abstract on the study relating to the dissection of viroid-host interplay by deep sequencing of small RNA libraries and degradome is presented.

An abstract on the study relating to the rapid differentiation of citrus hop stunt viroid variants by various real-time and high resolution melting analysis is presented.

In October 2011, during a survey for pospiviroids in ornamental plants, leaf samples were collected from two symptomless Portulaca sp. plants of two different varieties grown in a flower bed. Total RNA of each sample was extracted twice from 15 mg of leaf tissue using the MagMax™-96 total RNA isolation kit (Ambion, USA). The samples were tested by RT-PCR using semi-universal pospiviroid primers [Pospi1-RE/FW and Vid-RE/FW (Verhoeven et al., 2004)]. A product was amplified with primer pair Pospi1-RE/FW but not with primer pair Vid-RE/FW. The amplicon from each total RNA extract was custom sequenced (Macrogen, The Netherlands). Blast sequence analysis showed high identity with Iresine viroid 1 (IrVd-1). Primer pair IrVd-FW1/IrVd-RE1 (Verhoeven et al., 2010) was used to amplify the full-length viroidal genomes. Amplicons were successfully cloned into pGEM- T easy vector (Promega, USA) and transformed into E. coli JM109 competent cells (Promega, USA). At least eight clones per sample were sequenced. Master sequences of each sample were deposited in GenBank under accession Nos. JQ889689 and JQ889690. They showed 99.7% identity between each other and 96.7-98.6% identity with other IrVd-1 sequences (GU911350, DQ094294, NC_003613 and DQ94293). This is the first report of IrVd-1 in Slovenia and the second report of IrVd-1 in Portulaca sp. worldwide. Portulaca sp. was first reported as a host of IrVd-1 in 2010 (Verhoeven, 2010). Unlike other pospiviroids IrVd-1 does not seem to present a threat to potato and tomato (Verhoeven et al., 2010). [ABSTRACT FROM AUTHOR]

The recently described Citrus viroid V (CVd-V) (Serra et al., 2008) has the typical features of members of the genus Apscaviroid. Our viroid-infected citrus collection which had been analyzed by sPAGE and found to be infected with different viroid species was checked again to determine whether CVd-V was present in Turkey. Viroidal RNAs extracted from 20 sweet orange plants were used as templates for RT-PCR with primer pairs P3/P4 [CVV-P3(h) CTGTGGGTCACCCCGCCC and CVV-P4(c) GAACCACAAGGTTGTTCACC] according to Ito and Ohta (2010). After electrophoresis of RT-PCR products in 1% agarose gel followed by ethidium bromide staining, bands of ca. 300 bp in size were detected in amplifications from five sweet orange samples. Amplified PCR products were purified using a Qiagen gel extraction kit and custom sequenced by Iontec Sequencing Service (Turkey). Nucleotide sequence analysis showed that CVd-V was 294 bp in length. Positive detection of CVd-V was confirmed by sPAGE and SSCP analysis. Analysis of the sequence of the 294 bp amplicon revealed 96% and 98% identity with CVd-V GenBank reference sequences EU433392.1 and AB560862, respectively. Members of the genus Apscaviroid infecting citrus are not associated with diseases but they cause mild stunting and synergistic effects in Etrog citron co-infected with CVd-V (Serra et al., 2008). Since all CVd-V-infected sweet orange trees analyzed contained also more than three viroid species, the effect of CVd-V was not clear. To the best of our knowledge this is the first report of CVd-V in citrus trees in Turkey. [ABSTRACT FROM AUTHOR]

Control measures based on the use of viroid-free propagation material and, when possible, on the interception of infected plants, are needed to constrain the spread of viroids. Effectiveness of these defense strategies requires fast, reliable, sensitive and economically sustainable detection methods. A single molecular probe (polyprobe), composed of assembled sequence fragments derived from several viroid species has the advantage of re- ducing the costs of simultaneous detection of most viroid species by molecular hybridization. In fact, just one single transcription reaction is needed for synthesizing a polyprobe useful to detect different viroid species. Based on bioinformatics analyses of pospiviroid genomic RNAs, we have developed a polyprobe that can detect at least eight different viroid species belonging to Pospiviroid genus (family Pospiviroidae) (POSPIprobe), including Potato spindle tuber viroid and Chrysanthemum stunt viroid, which are quarantine pests recently intercepted in Italy. The digoxigenin-labelled polyprobe was synthesized by in vitro-transcription using as template a single vector constructed by cloning directionally partial sequences from four different pospiviroids. POSPIprobe sensitivity in dot-blot assays was similar to that obtained using single probes, and its specificity for the eight pospiviroids was further corroborated by Northern blot and tissue printing hybridization. Dot blot assays with the POSPIprobe were validated by simultaneously testing 68 samples from tomato, chrysanthemum, Argyranthemum frutescens and pepper infected by different pospiviroids, which confirmed the high potential of this probe in quarantine, certification and survey programs. Emerging phytosanitary risks due to pospiviroid spread in Europe and effectiveness of control measures will be also discussed. [ABSTRACT FROM AUTHOR]