Search

Pawpaw (Asimina triloba) trees exhibiting stunting and foliar mosaic, chlorosis, or distortions were observed in New York. In 2021, leaf samples from two symptomatic trees and a sapling, as well as two asymptomatic trees, were tested for the presence of viruses and viroids by high-throughput sequencing (HTS) using total RNA after ribosomal RNA depletion. HTS sequence information revealed tobacco ringspot virus (TRSV) and tomato ringspot virus (ToRSV) in symptomatic but not in asymptomatic leaves. HTS reads and de novo-assembled contigs covering the genomes of both viruses were obtained, with a higher average read depth for RNA2 than RNA1. The occurrence of TRSV and ToRSV was confirmed in the original leaf samples used for HTS and 12 additional trees and saplings from New York and Maryland in 2022 by RT-PCR combined with Sanger sequencing, and DAS-ELISA. Single infections by TRSV in 11 of 14 trees and dual infections by TRSV and ToRSV in 3 of 14 trees were identified. The nucleotide sequence identity of partial gene fragments of TRSV and ToRSV was high among pawpaw isolates (94.9–100% and 91.8–100%, respectively) and between pawpaw isolates and isolates from other horticultural crops (93.6–100% and 71.3–99.3%, respectively). This study is the first to determine the virome of pawpaw.

Goal. Analyze the data of foreign and domestic literature on viruses that infect gladioli, risks for domestic agriculture, present the results of the study of viral diseases on gladioli in Ukraine. Methods. Review of information in foreign and domestic literature on viruses that infect gladioli. Visual diagnostics, transmission electron microscopy, double sandwich enzyme immunoassay (DAS-ELISA). Results. Gladioli infect viruses: cucumber mosaic virus, bean yellow mosaic virus, tobacco rattle virus, tobacco ringspot virus, which belongs to regulated pests in Ukraine. These pathogens are common on all continents where plants are grown, have a wide range of host plants and pose a potential threat to crops. In the case of a systemic reaction of a plant to a viral infection, the symptoms lead to a loss of aesthetic value by the plant, economic losses in the floriculture industry, degeneration of varieties in the collections of botanical gardens and private farms, problems in further selective selection for creating new varieties. Possible means of protection and prevention of the spread of viruses to other types of cultivated plants are considered. Conclusions. Gladiolus plants can infect 9 types of viruses, among which the most common and harmful are cucumber mosaic, yellow bean mosaic and tobacco pogrimovka viruses. A yellow bean mosaic virus and a cucumber mosaic virus have been identified in Ukraine. It is especially dangerous that these viral infections can be asymptomatic and gladioli become reservoirs for the preservation and transmission of viruses to other plant crops sensitive to pathogens.

Tobacco ringspot virus (TRSV) is an important plant pathogen that causes severe diseases in tobacco plants. In recent years, this virus has been reported in a number of ornamental plants. However, it has never been reported from Japanese iris, a famous traditional ornamental plant distributed in Asian countries. In this study, the near-complete bipartite genome of a nepovirus (TRSV-Iris) infecting Japanese iris from Taiwan of China was determined. The RNA1 and RNA2 are 7512 and 3899 nucleotides in length, and encodes a polyprotein of 2303 and 1078 amino acids, respectively. Sequence analysis indicates that TRSV-Iris shares more than 80% amino acid sequence identity, the threshold values of the species demarcation for the genus Nepovirus, with known TRSV isolates either in the conserved Pro-Pol or CP regions, respectively. Phylogenetic analysis indicates that TRSV-Iris is a TRSV isolate.

Gladioli can be affected with 15 species of viruses, which cause significant economic losses to both floriculture and agriculture. The most prevalent and harmful for gladioli are Bean yellow mosaic virus (BYMV) and Cucumber mosaic virus (CMV), circulating on the territory of Ukraine on vegetable, legume and other crops, and also Tobacco ringspot virus (TRSV), which is included into the List of regulated pests of Ukraine and is the subject to strict control. The aim of the work was to conduct testing of gladiolus plants for the presence of viral infection symptoms and to test them for the affection with the most widespread and dangerous viruses, namely: BYMV, CMV, TRSV. Visual diagnostics, enzyme-linked immunosorbent assay in DAS-ELISA modification, transmission electron microscopy method and statistical data analysis were used in this research. The results of the studies showed absence of TRSV in all tested samples. For the first time in Ukraine, it has been established that gladioli are infected by Bean yellow mosaic virus. Its circulation on gladioli has been registered in Poltava, Kyiv and Sumy regions. Gladioli were also found to be affected by CMV or mixed infection of these pathogens. Gladioli infection by BYMV and CMV in Kyiv region is 88.2% and 93.8%, in Poltava – 69.2% and 55.5%, in Sumy – 66.6% and 0%, respectively. Typical symptoms on gladiolus plants caused by CMV and BYMV isolates are leaf chlorotic stripes and flower color break, less often – spotting on the leaves and plant stunting. It has been revealed that affection of gladioli by CMV and BYMV can be asymptomatic. The diversity, nature and course of viral infections in gladioli demonstrate the relevance of further research and their monitoring in Ukraine.

The first search for viruses in berries (blackberry, raspberry and blueberry) was conducted in Mexico. In September 2017, 24 berry plants displaying virus-like symptoms were sampled in the main berry-producing areas of Mexico and later analyzed for the presence of 29 different viruses via enzyme linked immunosorbent assay (ELISA) and reverse transcription PCR (RT-PCR). Additionally, virus screening was verified using high throughput sequencing (HTS). As a result of this study, two blackberry plants collected in Los Reyes de Salgado, Michoacan were determined positive for tobacco ringspot virus (TRSV; genus Nepovirus), such plants exhibited yellowing and ringspot on leaves. In contrast, the rest of berry samples tested negative for any other virus. This is the first detection of TRSV or any other virus infecting blackberries in Mexico. Lastly, the sequence diversity of characterized TRSV isolates was investigated using an identity matrix and phylogenetics.

Tobacco ringspot virus (TRSV) is a pathogen with a wide host range that can cause disease in many perennial species. Yet detection of this virus can be insistent and unreliable, complicating disease management. In this study we asked whether seasonal effects changed the titer and distribution of the virus in Vitis vinifera, Malus domestica, and Prunus armeniaca. We developed an RT-qPCR assay and used it to monitor TRSV accumulation in leaves, stems, and roots over the course of a year. TRSV titer, and the tissues in which it accumulated, changed throughout the year in a host-specific manner which may be due to host plant growth patterns and temperature. These data will aid in determining optimal sampling time, and which tissues to collect to have confidence in diagnostic results.

Melon is one of the most popular fruits worldwide and has been bred into various cultivars. RNA-sequencing using healthy melon fruit was performed to determine differences in gene expression among cultivars. Unexpected RNA-seq results revealed that viruses asymptomatically infected fruits at a high frequency (16 of 21 fruits examined were infected) and that viral transcripts highly accumulated in comparison with host transcripts (15 %–75 % of total reads). Their nucleotide sequences and phylogenetic analyses indicated that more than 10 novel isolates of tobacco ringspot virus (TRSV) were found in melon fruits. Asymptomatic infection with TRSV on melon fruits was confirmed by both immunoblot and RT-PCR analyses. Numerous isolates of TRSV generated and maintained in melon fields, and this is likely due to their asymptomatic infections. This TRSV melon isolate infected Nicotiana benthamiana plants with stunting and yellowing symptoms. This is the first report of frequent and asymptomatic infection of TRSV in consumable melon fruits.

Grapevines from 13 vineyards in Pakistan were surveyed for the prevalence of several pathogens. Using RT-qPCR, 257 samples were tested for 19 viruses, phytoplasmas and Xylella fastidiosa. Prevalent viruses were: grapevine virus A (GVA, 47.8%), grapevine leafroll-associated virus 2 (GLRaV-2, 37.3%), grapevine rupestris stem pitting-associated virus (GRSPaV, 36.1%), and grapevine fleck virus (GFkV, 35%). Other viruses detected were: grapevine leafroll-associated virus 1 (GLRaV-1, 2.3%), grapevine leafroll-associated virus 2RG (GLRaV-2RG, 5%), grapevine leafroll-associated virus 3 (GLRaV-3, 7%), grapevine leafroll-associated virus 4 (GLRaV-4) and its strains (5, 6, and Pr, 16.6%), grapevine leafroll-associated virus 7 (GLRaV-7, 4.2%), grapevine fanleaf virus (GFLV, 11.6%), grapevine virus B (GVB, 4.2%), grapevine virus D (GVD, 0.7%), grapevine virus E (GVE, 1.1%), and grapevine Pinot gris virus (GPGV, 1.9%). Mixed infections were detected in 75.9% of samples. Pathogens tested for, but not detected include GLRaV-4 strains 9 and Car, grapevine red blotch virus (GRBV), tomato ringspot virus (ToRSV), tobacco ringspot virus (TRSV), Arabis mosaic virus (ArMV), grapevine virus F (GVF), phytoplasmas and X. fastidiosa. Additionally, 16 samples were analyzed by high-throughput sequencing (HTS) to confirm RT-qPCR results. In this paper we present an extensive survey for grapevine pathogens and thus the first report of GVA, GVB, GVD, GVE, GRSPaV, GFkV, GLRaV-1, GLRaV-2, GLRaV-2RG, GLRaV-3, GLRaV-4, GLRaV-4 strains 5, 6, and Pr, and GLRaV-7 in Pakistan.

The Panel on Plant Health of EFSA conducted a pest categorisation of 17 viruses of Rubus L. that were previously classified as either non-EU or of undetermined standing in a previous opinion. These infectious agents belong to different genera and are heterogeneous in their biology. Blackberry virus X, blackberry virus Z and wineberry latent virus were not categorised because of lack of information while grapevine red blotch virus was excluded because it does not infect Rubus. All 17 viruses are efficiently transmitted by vegetative propagation, with plants for planting representing the major pathway for entry and spread. For some viruses, additional pathway(s) are Rubus seeds, pollen and/or vector(s). Most of the viruses categorised here infect only one or few plant genera, but some of them have a wide host range, thus extending the possible entry pathways. Cherry rasp leaf virus, raspberry latent virus, raspberry leaf curl virus, strawberry necrotic shock virus, tobacco ringspot virus and tomato ringspot virus meet all the criteria to qualify as potential Union quarantine pests (QPs). With the exception of impact in the EU territory, on which the Panel was unable to conclude, blackberry chlorotic ringspot virus, blackberry leaf mottle-associated virus, blackberry vein banding-associated virus, blackberry virus E, blackberry virus F, blackberry virus S, blackberry virus Y and blackberry yellow vein-associated virus satisfy all the other criteria to be considered as potential QPs. Black raspberry cryptic virus, blackberry calico virus and Rubus canadensis virus 1 do not meet the criterion of having a potential negative impact in the EU. For several viruses, the categorisation is associated with high uncertainties, mainly because of the absence of data on biology, distribution and impact. Since the opinion addresses non-EU viruses, they do not meet the criteria to qualify as potential Union regulated non-quarantine pests. (C) 2020 European Food Safety Authority. EFSA Journal published by John Wiley and Sons Ltd on behalf of European Food Safety Authority.

Since 2015, several blueberry plants (Vaccinium corymbosum) of cvs. Draper and Top Shelf in an organic farm in eastern Washington State showed reduced growth with deformed leaves displaying chlorotic spots, rings, and red blotches and producing small and poorly ripened berries. The symptomatic plants showed gradual decline within 2 to 3 years post-planting. In ELISA using antibodies (Agdia, Inc., USA) to Blueberry leaf mottle virus, Cherry leaf roll virus, Peach rosette mosaic virus, Strawberry latent ringspot virus, Tomato black ring virus, Tomato ringspot virus, and Tobacco ringspot virus [TRSV]), leaf samples from six symptomatic plants tested positive only to TRSV (Secoviridae: Nepovirus). Subsequently, total RNA was isolated from leaves of a symptomatic plant using the Spectrum™ Plant Total RNA Kit (Sigma-Aldrich, USA). High quality RNA was subjected to high-throughput sequencing (HTS) on the Illumina© NovaSeq™ platform (Huntsman Cancer Institute, UT, USA). An average of ~28 million 150-base pair (bp) paired-end reads obtained were subjected to quality filtering followed by de novo assembly using CLC Genomics Workbench (v12.0) and BLASTn analysis (http://www.ncbi.nlm.nih.gov/blast). Two contigs of 2,778 bp (average coverage: 11,031.7) and 3,589 bp (average coverage: 11,882) showed, respectively, a maximum of 97.3 and 97.6% nucleotide (nt) identity with TRSV RNA1 of a South Korean isolate (KJ556849). Another contig of 3,615 bp (average coverage: 7072.1) showed a maximum of 92.8% nt identity with TRSV RNA2 of an isolate from Iowa (MT563079). The HTS data revealed no other viral sequences reported from blueberry plants (Martin and Tzanetakis 2018). To further confirm the presence of TRSV, extracts of leaf samples from seven symptomatic and ten asymptomatic plants collected randomly from cvs. Draper and Top Shelf were tested by RT-PCR using primers specific to a region of the helicase gene of TRSV RNA1 (Forward: GACTACTGAGCAACATTGCAACTTCC, Reverse: GTCCCCTAACAGCATTGACTACC) and the coat protein gene of TRSV RNA2 (Forward: GCTGATTGGCAGTGTATTGTTAC, Reverse: GTGTTCGCATCTGGTTTCAAATTGG). An approximately 360 bp fragment specific to RNA1 and ~640 bp fragment specific to RNA2 were amplified only from symptomatic samples. Sanger sequence analysis of amplicons specific to RNA1 and RNA2 showed 98.1% and 96.8% nt identity with corresponding sequences of TRSV isolates from South Korea (KJ556849) and Iowa (MT563079), respectively. These results confirmed the presence of TRSV in symptomatic blueberry plants. The complete sequence of RNA1 (7,512 nt, MW495243) and RNA2 (3,925 nt, MW495244) genome segments of the blueberry isolate determined in this study showed 95.9 and 93.2% nt sequence identity, respectively, with corresponding TRSV sequences from South Korea (KJ556849) and Iowa (MT563079). Based on previous reports (Converse and Ramsdell 1982, Martin et al. 2012, Martin and Tzanetakis, 2018), this study represents the first report of TRSV infecting highbush blueberry in Washington State. Since the State has emerged as the national leader in blueberry production, the results will strengthen plant health certification standards to provide virus-tested propagative materials for domestic growers and export to the European Union.

High-throughput sequencing (HTS) is becoming the new norm of diagnostics in plant quarantine settings. HTS can be used to detect, in theory, all pathogens present in any given sample. The technique’s success depends on various factors, including methods for sample management/preparation and suitable bioinformatic analysis. The Limit of Detection (LoD) of HTS for plant diagnostic tests can be higher than that of PCR, increasing the risk of false negatives in the case of low titer of the target pathogen. Several solutions have been suggested, particularly for RNA viruses, including rRNA depletion of the host, dsRNA, and siRNA extractions, which increase the relative pathogen titer in a metagenomic sample. However, these solutions are costly and time-consuming. Here we present a faster and cost-effective alternative method with lower HTS-LoD similar to or lower than PCR. The technique is called TArget-SPecific Reverse Transcript (TASPERT) pool. It relies on pathogen-specific reverse primers, targeting all RNA viruses of interest, pooled and used in double-stranded cDNA synthesis. These reverse primers enrich the sample for only pathogens of interest. Evidence on how TASPERT is significantly superior to oligodT, random 6-mer, and 20-mer in generating metagenomic libraries containing the pathogen of interest is presented in this proof of concept.

The dagger nematode, Xiphinema rivesi Dalmasso, is a virus-transmitting plant-parasitic nematode described from France (2) and also reported from Germany, Portugal, and Spain. While this species is only known from a few local sites within Europe, it is widespread in North America and also present in Peru and Pakistan (3). X. rivesi is able to transmit at least four North American nepoviruses, including Cherry rasp leaf virus, Tobacco ringspot virus, Tomato ringspot virus, and Peach rosette mosaic virus (1,4). In early spring 2002, nematodes of the X. americanum group were detected in soil samples taken near the roots of peach plants from an orchard in Bilje near Nova Gorica, Slovenia. Resampling in June and September at the same site and at an adjacent, approximately 30-year-old peach orchard confirmed the presence of the nematode in relatively high numbers (5 per 100 ml of soil). Adult females were isolated and sent for further identification to the Plant Protection Service in Wageningen, the Netherlands. The nematode was morphologically identified as X. rivesi and confirmed at the rDNA-level with internal transcribed spacer restriction fragment length polymorphism analysis. Because both sampling sites where the nematode was found are close to the Vipava River in an area of extensive stone and pome fruit production, it is likely that the nematode is also present in other orchards in this region. The origin of this quarantine nematode is unknown as there is no direct link with Slovenian orchards and import of plant material from abroad in the last decades. To our knowledge, this is the first report of X. rivesi in Slovenia and the fourth report of this species in Europe. References: (1) D. J. F. Brown et al. Phytopathology 84:646, 1994. (2) A. Dalmasso. Mem. Mus. Hist. Nat. Nouv. Série A., Zool. 61:33, 1969. (3) Data Sheets on Quarantine Pests: Xiphinema americanum sensu lato. Page 629 in: Quarantine Pest for Europe, CABI, Wallingford, UK, 1997. (4) L. W. Stobbs et al. Plant Dis. 80:105, 1996.

Vineyards in the New England region of the USA were surveyed for the occurrence of grapevine viruses. A total of ten vineyards were visited and 62 composite samples of leaves with the petioles were collected from symptomatic grapevines (Vitis spp.). All of the samples were assayed by double-antibody sandwich enzyme-linked immunosorbent assays (DAS-ELISA) using antibodies specific for four major grapevine leafroll-associated viruses (GLRaV-1, GLRaV-2, GLRaV-3, and GLRaV-4), grapevine fanleaf virus (GFLV), tobacco ringspot virus (TRSV), and tomato ringspot virus (ToRSV). Positive ELISA samples were further tested by reverse transcription polymerase chain reaction (RT-PCR) with primers specific for each of the viruses to confirm the ELISA results. Twenty-two samples were infected with at least one of the viruses tested. GLRaV-3 (24.19%) was the most prevalent virus detected followed by GLRaV-1 (12.90%), ToRSV (3.23%), and GLRaV-2 and TRSV (1.61%). This is the first study reporting on the presence of grapevine viruses in New England. Extensive surveys need to be conducted to evaluate the prevalence and economic impact of these viruses on New England vineyards.

Jatropha curcas L. is a major commercial biodiesel fuel crop grown on 98 million acres (39.66 million ha) in India. Severe mosaic disease accompanied by yellow spots was noticed on 15% of J. curcas growing in the experimental plots of NBRI, Lucknow, India, during October of 2006. Inoculations with sap from symptomatic plants resulted in systemic mosaic on three of seven J. curcas seedlings. Gel diffusion tests were performed with antiserum to Cucumber mosaic virus (CMV), Tobacco ringspot virus, and Chrysanthemum virus B (PVAS-242a, PVAS-157, and PVAS-349, respectively; ATCC, Manassas, VA). Leaf sap of infected plants reacted only with PVAS-242a, indicating the presence of CMV. Reverse transcription (RT)-PCR assays with CMV coat protein gene specific primers (Genbank Accession Nos. AM180922 and AM180923) and total nucleic acid extracted from symptomatic J. curcas leaf tissue yielded the expected ~650-bp amplicon, which was cloned and sequenced (GenBank Accession No. EF153739). BLAST analysis indicated 98 to 99% nucleotide identity with CMV isolates (GenBank Accession Nos. DQ914877, DQ640743, AF350450, AF281864, X89652, AF198622, DQ152254, DQ141675, and DQ028777). Phylogenetic analysis showed that the J. curcas isolate was more closely related to Indian isolates of CMV belonging to subgroup Ib. Literature surveys revealed records of Jatropha mosaic virus on J. gossypiifolia in Puerto Rico (1) and on J. curcas in India (2). To our knowledge, this is the first report of CMV on J. curcas. References: (1) J. K. Brown et al. Arch. Virol. 146:1581, 2001. (2) D. S. A. Narayana et al. Curr. Sci. 91:584, 2006.

Zamia furfuracea (Zamiaceae) is native of coastal Mexico. It is a popular houseplant and easy to grow outdoors in warm climates. In November 2005, a plant of Z. furfuracea, originally from Texas, was received at the Division of Plant Industry in Gainesville, FL. The plant had numerous chlorotic spots on the leaves that eventually became necrotic. Leaves were ground in phosphate buffer (pH 7.2) with Carborundum and used to inoculate a host range that included Chenopodium amaranticolor, C. quinoa, Gomphrena globosa, Datura stramonium, and Nicotiana benthamiana. Systemic symptoms were seen in C. quinoa (necrotic lesions), G. globosa (stunting), D. stramonium (chlorotic ringspots), and N. benthamiana (wavy line patterns) 1 to 2 weeks after inoculation. C. amaranticolor showed only small necrotic local lesions. In further host range studies, systemic infections of Beta vulgaris, D. metaloides, Lactuca sativa, N. clevelandii, Pisum sativus, Petunia hybrida, Zinnia elegans (symptomless), and Cucumis sativa were observed. However, no infection of Zea mays, Verbena hybrida, Glycine max, Phaseolus vulgaris, Catharanthus roseus, Arachis hypogaea, Trifolium spp., Vigna unguiculata, Vicia faba or Digitalis spp. was detected. Inclusions observed in leaf strips of N. benthamiana and D. stramonium indicated a possible infection of this plant with a nepovirus (1). A 337-bp fragment was amplified from total RNA isolated from an inoculated D. stramonium using reverse transcription-PCR with nepovirus group primers provided by Agdia Inc. (Elkhart, IN). Sequence analysis indicated that the nucleotide (nt) and deduced amino acid (aa) sequences of the fragment were 89 to 91% and 91 to 95% identical, respectively, to sequences of the RNA-dependent RNA polymerase gene for Tobacco ringspot virus (TRSV) contained in GenBank (Accession Nos. U50869 and AJ698718). This region was only 50% (nt) and 38% (aa) identical to Cycas necrotic stunt virus (GenBank Accession No. NC_003791), a nepovirus previously reported to infect cycads (2). The original plant, symptomatic inoculated hosts, and the symptomless zinnia tested positive by double-antibody sandwich-ELISA using commercially available antiserum for TRSV (Agdia, Inc.), further confirming the presence of TRSV. Although the virus infecting Z. furfuracea has a more restricted host range than that reported for TRSV, the serology and gene sequence indicates that this virus is a unique isolate of TRSV. References: (1) J. R. Edwardson and R. G. Christie. University of Florida, Institute of Food and Agricultural Sciences, Bull. 894. 1996. (2) S. S. Han et al. Arch. Virol. 147:2207, 2002.

In 2006, primocane stunted growth and crumbly berry development were observed on 4-year-old Kiowa and Apache blackberry cultivars grown at the Chilton Research and Extension Center, Clanton, AL. Samples from affected plants were tested for virus infection by ELISA kits (Agdia, Inc., Elkhart, IN) specific to each of 14 different viruses. Most samples tested positive for Tobacco ringspot virus (TRSV). TRSV was detected in blackberry samples from North Carolina and South Carolina (2). Bray et al. (1) studied the incidence of viruses in blackberry nursery stock in the United States and reported that 9% of the tested samples contained TRSV. Thus, a survey was conducted for TRSV incidence among commercial blackberry stands in eight counties in Alabama during July 2007. Blackberry plants were observed to express virus-like symptoms including chlorotic spots on leaves, leaf veinal chlorosis, stunting, and combinations thereof. Fruit-bearing plants sometimes had crumbly fruit symptoms characteristic of virus infection. Leaf samples that were collected from symptomatic and nonsymptomatic plants representing 14 cultivars were tested by TRSV ELISA (Agdia, Inc.). Of 180 blackberry samples, 68 tested positive for TRSV. Positive ELISA reactions for TRSV were on average 28 times greater than the reactions of known negative control samples considered negative for TRSV. Blackberry plants shown to be infected with TRSV during the 2007 survey were tested in July 2008 in an effort to confirm the presence of TRSV. Fifty-four percent of the samples tested positive by ELISA with the average positive ELISA value being 21 times higher than the average negative ELISA value for known negative control samples. To further confirm the occurrence of TRSV in Alabama-grown blackberry plants, leaf samples were tested by reverse transcription (RT)-PCR to amplify a 329-bp fragment of the viral coat protein gene (TRSV RNA 2 sequence accession no. NC_005096; primers TRSCP-F (5′-TCTGGCACTATAAGCGGAAG-3′) and TRSCP-R (5′-GAAAACATGGGAGGATGCAC-3′). A single band of the anticipated size was amplified (analyzed by agarose gel electorphoresis and visualized by ethidium bromide staining) from RNA samples extracted with a RNeasy Mini kit (Qiagen, Valencia, CA) from blackberry samples that tested positive for TRSV by ELISA and a known positive control. No amplified product resulted from a blackberry sample that tested negative for TRSV by ELISA. These results illustrate and confirm the presence of TRSV in blackberry leaf tissues grown in Alabama. To our knowledge, this is the first report of TRSV infection of blackberry plants in Alabama. References: (1) M. M. Bray et al. HortScience 40:874, 2005. (2) T. L. Guzmán-Baeny. Incidence, distribution, and symptom description of viruses in cultivated blackberry (Rubus subgenus Eubatus) in the southeastern United States. M.S. thesis, North Carolina State University, Raleigh, 2003.

Eupatorium purpureum L. (joe-pye weed, sweet joe-pye weed, and sweetscented joe-pye weed) is a wildflower perennial plant native to the eastern United States. In May 2006, virus-like symptoms including systemic chlorosis, mottling, and downward rolling of leaf blades were observed in a joe-pye weed plant located on the Mississippi State University campus. Young symptomatic leaves were ground in 0.1 M phosphate buffer, pH 7.2, and the slurry was inoculated on leaves of several herbaceous hosts grown in a greenhouse. Systemic symptoms were observed 1 to 2 weeks postinoculation in Cucumis sativus (chlorotic spots followed by systemic ringspot and leaf deformation), Chenopodium quinoa (necrotic lesions/leaf deformation), Nicotiana benthamiana (mosaic/line patterns), and N. rustica (necrotic ring spots). Electron microscopy of partially purified preparations from infected joe-pye weed and cucumber plants revealed the presence of intact and empty isometric viral particles of approximately 30 nm in diameter resembling nepoviruses or comoviruses. The original joe-pye weed plant and artificially infected herbaceous plants were tested by ELISA (Agdia Inc., Elkhart, IN) for several nepoviruses/comoviruses and found to be positive for Tobacco ringspot virus (TRSV; genus Nepovirus, family Comoviridae). Total RNA extracted from the original virus source plant was reverse transcribed using oligodT primer and submitted to PCR with the primer set TRS-F (5′TATCCCTATGTGCTTGAGAG3′) and TRS-R (5′CATAGACCACCAGAGTCACA3′) designed from the published sequences in GenBank of the RNA 1 of Tobacco ringspot virus. A specific 766-bp PCR product was cloned and sequenced. Sequence analysis showed that the virus from the joe-pye weed shared 94% nucleotide identity (98% at amino acid level) with a “bud blight” isolate of TRSV (Accession No U50869) (2) in the sequenced genome portion and slightly lower (90 to 92%) with other sequenced isolates of the same virus, thus further confirming the identity of the virus. In 2008 and 2009, TRSV was detected in an additional 16 symptomatic specimens of the same host collected from six distinct locations in Mississippi. Our results show that E. purpureum is a new host for TRSV. Considering that the related plant species E. capillifolium (small dogfennel) was already reported as a host of TRSV in North Carolina (1), this suggests that these two common plants may represent additional reservoirs of this virus in the region. References: (1) M. C. Rush and G. V. Gooding. Phytopathology 60:1756, 1970, (2) P. A. Zalloua et al. Virology 219:1, 1996.

Cucurbits are major cash crops of vegetable growers in Oklahoma, particularly watermelon, which is the official state vegetable. In 2010, during a survey for cucurbit viruses (1), symptomatic leaf samples of cucumber (Cucumis sativus), cantaloupe (Cucumis melo), pumpkin, (Cucurbita pepo), squash (Cucumis maxima), and watermelon (Citrullus lanatus) showing mild to severe mosaic, mottling, and chlorotic spots were collected in Atoka, Blaine, Jefferson, and Tulsa counties. A total of 161 samples were tested by dot-immunobinding assay (DIBA) (2) using Tobacco ringspot virus (TRSV; genus Nepovirus, family Comoviridae) specific antiserum. Fourteen samples of cantaloupe, pumpkin, and watermelon from Blaine, Jefferson, and Tulsa counties were positive serologically to TRSV. At least one to two samples from each representative cucurbit collected in the field above were used as a source for mechanical inoculation. Sap was extracted from symptomatic leaves using 0.1 M K2HPO4 buffer (pH 7.2) and rub-inoculated to two squash (cv Elite) seedlings at cotyledonary stage pre-dusted with Carborundum. Seven to 10 days post-inoculation, all inoculated plants produced typical TRSV symptoms including chlorotic spots, systemic ringspot, severe leaf deformation, mottling, and stunting. Sap and total RNA was extracted from 10 mechanically inoculated squash seedlings and tested by DIBA and reverse transcription (RT)-PCR using specific TRSV primers (F: 5′-TACAGTGAGGATGCATG-3′ and R: 5′-AGTAGCTGCGACAAGCCA-3′). All of the tested samples were positive by DIBA except the negative control. Similarly, all samples from mechanically inoculated plants were also positive by PCR showing the expected 1,039-bp PCR product when analyzed by agarose gel electrophoresis. Total RNA obtained from mock-inoculated squash seedlings used as a control was negative by PCR. Amplified PCR product (1,039 bp) was directly sequenced from three infected squash seedlings. Sequence analysis confirmed that the virus shared 90 to 92% nucleotide and 94% amino acid identities with RNA2 of TRSV isolate from the U.S. (Accession No AY363727) available in the GenBank database. Total RNA extracted from original tissues of 14 DIBA positive samples collected from field were also positive by RT-PCR. The presence of TRSV could pose a serious threat to many vegetable crops, particularly cucurbits and other agricultural crops, due to its wide host range (3). This report confirms the suspected occurrence of TRSV in 1956 from watermelon in Oklahoma (4). References: (1) Ali et al. Plant Dis. 96:243, 2012 (2) A. Ali and J. W. Randles. Plant Dis. 81:343, 1997 (3) M. J. Adams and J. F. Antoniw. Outlooks Pest Manage. 16:268, 2005 (4) R. J. Shephered and F. B. Struble. Phytopathology 46:358, 1956.

Chili pepper (Capsicum frutescens) represents an important crop in Iran and is under cultivation in different regions in Northern Iran. In spring 2012, commercially grown tabasco (Capsicum frutescens) peppers in Varamin, Shahriar, and Karaj districts of Tehran province developed an undescribed disease. Symptoms observed were mosaic, leaf malformations, and stunting. Fruit symptoms included chlorosis and distortion. To verify the identity of the disease, six fields were surveyed and 72 symptomatic leaves were collected and screened by double antibody sandwich (DAS)-ELISA using specific antibodies to Tobacco ringspot virus (TRSV), Tomato ringspot virus (ToRSV), Pepper mild mottle virus (PMMV), Tomato mosaic virus (ToMV), Tobacco mosaic virus (TMV), and Arabis mosaic virus (ArMV). ToRSV was found in 23% of the samples collected. None of the samples had a positive reaction to other tested viruses. The ToRSV-positive peppers were used for mechanical transmission to Chenopodium quinoa, local lesion host, and after two cycles of single local lesion isolation, they were transferred to Cucumis sativus, Solanum esculentum, and Capsicum fructescens. Inoculations resulted in systemic mosaic and chlorotic local lesion on C. sativus; leaf distortion and mosaic on S. esculentum; and mosaic, mottle, and stunting on C. fructescens. All inoculated plants were positive for ToRSV with DAS-ELISA. To further verify ToRSV infection, reverse transcription (RT)-PCR was conducted. Two primers were designed on the basis of the highly conserved sequences of the putative viral polymerase gene available in the GenBank. RT-PCR of total RNA extract from infected peppers and inoculated plants with the designed primers RdR-R (5′-CGCCTGGTAATTGAGTAGCCC-3′) and RdR-F (5′-GAAGAGCTAGAGCCTCAACCAGG-3′), consistently amplified the 411-bp product, while no amplification products were obtained from noninfected control (healthy plants). The fragment from tabasco pepper was cloned into pTZ57R/T (Ins T/A clone PCR Cloning kit, Fermentas, St. Leon-Rot, Germany) and sequenced in both directions of three clones. The resulting nucleotide sequence (GenBank Accession No. JQ972695) had the highest identity (94%) with the polymerase gene of a ToRSV isolate from blueberry cv. Patriot (Accession No. GQ141528) and had lower identity (91%) with that of a ToRSV isolate from blueberry cv. Bluecrop (Accession No. GQ141525). Tomato ringspot virus (ToRSV) is reported to infect Capsicum spp. in the United States (1,2). Our results confirm the natural infection of pepper plants in Tehran by ToRSV. To our knowledge, this is the first report of ToRSV infection of pepper in Iran. The finding of this disease in Tehran confirms further spread of the virus within northern regions of Iran and prompts the need for research to develop more effective management options to reduce the impact of ToRSV on pepper crops. Beside, primers designed on the basis of putative viral polymerase gene sequences may improve the detection of ToRSV isolates by RT-PCR in Iran. References: (1) S. K. Green and J. S. Kim. Technical Bulletin. No.18, 1991. (2) G. P. Martelli and A. Quacquarelli. Acta Hortic. 127:39, 1983.

Kundu J.K., Gadiou S., Schlesingerova G., Dziakova M., Cermak V. (2015): Emergence of quarantine Tobacco ringspot virus in Impatiens walleriana in the Czech Republic. Plant Protect. Sci., 51: 115–122. Tobacco ringspot virus (TRSV) is a quarantine pathogen in Europe. During an official inspection in November 2011, Impatiens walleriana plants showing symptoms were found in a nursery in the Czech Republic. The causal agent of the disease was detected as Nepovirus group A by RT-PCR using specific primers of the Nepovirus group. Sequence analysis of PCR fragments confirms that the detected virus is TRSV. TRSV detection in these plants was further con firmed by ELISA and one-step RT-PCR using specific primers. The coat protein (CP) gene of the Czech TRSV isolate was sequenced, and the sequence analysis showed high identity of both nucleotide (99.28%) and amino acid (99.96%) levels compared with other known TRSV isolates from GenBank. Two amino acid motifs characteristic of nepoviruses, FDDY (FDAY) and FWGR (FYGR), were found equally at positions 80 and 497 of the TRSV CP genes, respectively, including the sequences described in this study.

A producing strain of an anti-tumor and antiviral enzyme L-lysine-α-oxidase from Trichoderma was cultured using a technological device of G. K. Skryabin Institute of Biochemistry and Physiology of Microorganisms, Russian Academy of Sciences (Pushchino). L-lysine-α-oxidase activity in the obtained metabolite concentrate was 5.4 U/ml. We studied the effects of the concentrate of active L-lysine-α-oxidase producer on the highly infectious Tobacco ringspot virus and revealed anti-viral activity of it when enzyme concentration was at least 1.0 U/ml.

Herbaceous indicator bioassays are used to screen for unwanted plant viruses on imported plant material To optimise virus detection the effect of plant nutrition was investigated to determine whether this plays a role in virus symptom expression and severity Apple stem grooving virus and Tobacco ringspot virus were inoculated onto a range of herbaceous indicator species grown in potting mix supplemented with differing rates of slowrelease fertiliser Higher rates of fertiliser resulted in better plant nutrition and a greater incidence of virus expression and more severe expression of disease in the seven indicator plant species Overall disease assessments indicated that plant nutrition affects plant growth virus infection rate and virus symptom expression As virus infection affects plant growth and leaf colour good plant nutrition is important to avoid masking virus symptoms and to optimise the detection of viruses in postentry quarantine facilities

During 2006 and 2007, a survey on the incidence and distribution of fourteen grapevine viruses was carried out in the Skadar Lake basin, one of the two main grapevine-growing areas of Montenegro. In total 165 samples were collected from four red (‘Vranac’, ‘Kratosija’, ‘Merlot’ and ‘Cardinal’), two white (‘Chardonnay’ and ‘Rkaciteli’) and a few unknown grapevine varieties in the vicinity of Podgorica and Bar. The phytosanitary status of the collected samples was analysed by DAS-ELISA and the presence of Grapevine fanleaf virus (GFLV), Grapevine leafroll-associated virus 1 (GLRaV-1), Grapevine leafroll-associated virus 2 (GLRaV-2) and Grapevine leafroll-associated virus 3 (GLRaV-3) was confirmed in some of them. The most frequently found virus in assayed samples was GLRaV-3 (54.5%), followed by GFLV (23%), GLRaV-1 (20%) and GLRaV-2 (0.6%). These serological analyses showed the absence of Grapevine leafroll-associated virus 6 (GLRaV-6), Grapevine leafroll-associated virus 7 (GLRaV-7), Raspberry bushy dwarf virus (RBDV), Strawberry latent ringspot virus (SLRSV), Tomato ringspot virus (ToRSV), Raspberry ringspot virus (RpRSV), Arabis mosaic virus (ArMV), Tobacco ringspot virus (TRSV), Tomato black ring virus (TBRV) and Cherry leaf roll virus (CLRV) from all tested samples.

A virus was isolated from potted plants of an unidentified species of Aeonium, a succulent ornamental very common in Southern Italy, showing chlorotic spots and rings on both leaf surfaces. It was successfully transmitted by sap inoculation to a limited range of hosts, including Nicotiana benthamiana which was used for ultrastructural observations and virus purification. Virus particles are isometric, ca. 30nm in diameter, have a single type of coat protein (CP) subunits 54kDa in size, that encapsidate single-stranded positive-sense RNA species of 7,549 (RNA1) and 4,010 (RNA2) nucleotides. A third RNA molecule 3,472 nts in size entirely derived from RNA2 was also found. The structural organization of both genomic RNAs and the cytopathological features were comparable to those of nepoviruses. In addition, amino acid sequence comparisons of CP and the Pro-Pol region (a sequence containing parts of the proteinase and polymerase) with those of other nepoviruses showed that the Aeonium virus belongs to the subgroup A of the genus Nepovirus and is phylogenetically close to, but serologically distinct from tobacco ringspot virus (TRSV). Based on the species demarcation criteria for the family Secoviridae, the virus under study appears to be a novel member of the genus Nepovirus for which the name of Aeonium ringspot virus (AeRSV) is proposed.

Presented review of rose diseases, associated with the mosaic symptoms, includes common and yellow rose mosaic, rose ring pattern, rose X disease, rose line pattern, yellow vein mosaic and rose mottle mosaic disease. Based on symptomatology and graft transmissibility of causing agent many of those rose disorders are called "virus-like diseases" since the pathogen has never been identified. However, several viruses were detected and identified in roses expressing mosaic symptoms. Currently the most prevalent rose viruses are Prunus necrotic ringspot virus - PNRSV, Apple mosaic virus - ApMV (syn. Rose mosaic virus) and Arabis mosaic virus - ArMV Symptoms and damages caused by these viruses are described. Tomato ringspot virus, Tobacco ringspot virus and Rose mottle mosaic virus are also mentioned as rose pa thogcns. Methods of control of rose mosaic diseases are discussed.

Department of Horticulture and Landscape, Seoul Women’s University, Seoul 139-774, Korea(Received on April 9, 2012; Revised on May 16, 2012; Accepted on May 16, 2012)Petunia hybrida is commonly used in landscapes andinteriors for its attractive flower. Virus-like foliar symp-toms, including a mosaic with dark green islands sur-rounding the veins and chlorosis on the leaf margins,were observed on a petunia plant from Icheon, Gyeonggi-do, Korea. Cucumber mosaic virus (CMV) was identifiedin the symptomatic petunia by serological testing for thepresence of CMV coat protein (CP) with a direct anti-body-sandwich-enzyme-linked immunosorbent assay.An agent was mechanically transmitted to indicatorplant species including Chenopodium quinoa. Exami-nation of the inoculated plant leaves by RT-PCR analy-sis and electron microscopy revealed the presence ofspecifically amplified CP products and spherical virionsof approximately 28 nm in diameter, respectively, pro-viding confirmation of a CMV infection. Analysis of CPsequences showed that CMV petunia isolate (CMV-YJC) shared 82.5−100% amino acid sequence identitywith CPs of representative CMV strains. Phylogeneticanalysis of CPs supports that CMV-YJC is a member ofCMV subgroup IA (CMV-IA) and has biological pro-perties of CMV-IA on host species. To our knowledge,this is the first report of CMV from P. hybrida in Korea.Keywords : coat protein, Cucumber mosaic virus, petunia,RT-PCR, sequence analysis, symptomPetunia hybrida is a perennial plant, known as the “king ofparterre flowers”. Petunia hybrida is one of six members ofthe Solanaceae grown primarily as an ornamental plant,and the most economically important due to its horticulturalvalue (Sink, 1984). Petunia is a popular bedding plant, thethird most valuable after geranium and impatiens (Hamrick,1997) and it is also grown in pots, hanging baskets, andbalcony/window boxes (Lesemann, 1996). Petunia plantsare propagated by seeds in nature, but new species ofvegetatively propagated petunia have been recently culti-vated as garden ornamentals in the world (Dai and Bao,2004). Plant viruses are responsible for severe diseases inmany crops, ornamental plants, and various plants, result-ing in major economic losses (Hull, 2002). Virus symptomsusually vary from local discoloration to severe perturbationof growth and development, or even death of the plant. Inmost relationships between virus and susceptible host, theinduction of disease symptoms results from colonization ofplant virus in which the agent modifies the metabolism ofits host at many different levels. In turn, host plant showsvarious responses to virus, depending upon genetic back-grounds, development stage and surrounding environment(Hull, 2002). Several viruses have been reported as naturallyinfecting petunia plants (Bellardi et al., 1996; Mavric et al.,1996; Pirone, 1978), and many viruses capable of infectingpetunia plants have been identified using artificial inocu-lation methods since petunia plants are frequently used asindicator hosts for virus diagnostic assays (Brunt et al.,1996; Lane, 1992). The virus most often detected in petuniaplants is Tobacco mosaic virus (TMV) and other commonlydetected viruses are and Chrysanthemum virus B (CVB),Cucumber mosaic virus (CMV), Tobacco ringspot virus(TRSV), Tobacco streak virus (TSV), Tomato ringspotvirus (ToRSV), and Tomato spotted wilt virus (TSWV)(Brunt et al., 1996; Lawson and Hus, 1994; Sanchez-Cuevas and Nameth, 2002). Among viruses infectingPetunia hybrida, CMV is a prevalent plant pathogen allover the world and has one of the widest host ranges of anyplant virus, infecting over 885 plant species in 65 families(Palukaitis et al., 1992). CMV is multi-component singlestranded virus, with three positive-sense RNA's (RNA1,RNA2 and RNA3) and an additional subgenomic RNA(RNA4) derived from RNA3 (Habili and Francki, 1974;Peden and Symons, 1973). RNA2 codes for the 2a protein

Bean pod mottle virus (BPMV) and Tobacco ringspot virus (TRSV) are two important viral pathogens causing reduction of seed yield and quality in soybean (Glycine max (L.) Merr.). Various BPMV and TRSV isolates have been observed, but no host resistance has been reported. The objective of this study was to screen a set of modern soybean cultivars for resistance or tolerance to BPMV and TRSV. A total of 303 cultivars currently grown in the mid- southern United States were screened in the greenhouse for their reactions to BPMV and TRSV. Each cultivar was inoculated with a mild and a virulent isolate of each virus. None of the cultivars tested was resistant to BPMV, but a range of tolerance to this virus was observed among the cultivars. An enzyme-linked immunosorbent assay (ELISA) confi rmed the presence of BPMV in the high and low tolerance cultivars. Tolerance to BPMV is associated with less of a reduction in plant height and biomass on infected plants. Cultivars were classifi ed into four groups, high, moderate, low, and very low tolerance, on the basis of their having exhibited ≤20, 21 to 40, 41 to 60, or >60% of a reduction in plant height and ≤25, 26 to 50, 51 to 75, and >75% plant biomass reduction, respectively. None of the cultivars was resistant to TRSV, and all showed bud blight symptoms by 10 d after inoculation. However, 55 cultivars recovered 5 wk after inoculation, with more than 80% of the plants growing out of the bud blight symptoms and forming new leaves. The recovered plants, although systemically infected, clearly showed tolerance to TRSV at a later stage. These results may be helpful to soybean producers for selecting tolerant cultivars to grow in areas where BPMV and/or TRSV may cause problems in production.

Most Arabidopsis ecotypes display tolerance to the Tobacco ringspot virus (TRSV), but a subset of Arabidopsis ecotypes, including Estland (Est), develop lethal systemic necrosis (LSN), which differs from the localized hypersensitive responses (HRs) or systemic acquired resistance (SAR) characteristic of incompatible reactions. Neither viral replication nor the systemic movement of TRSV was restricted in tolerant or sensitive Arabidopsis ecotypes; therefore, the LSN phenotype shown in the sensitive ecotypes might not be due to viral accumulation. In the present study, we identified the Est TTR1 gene (tolerance to Tobacco ringspot virus 1) encoding a TIR-NBS-LRR protein that controls the ecotype-dependent tolerant/sensitive phenotypes by a map-based cloning method. The tolerant Col-0 ecotype Arabidopsis transformed with the sensitive Est TTR1 allele developed an LSN phenotype upon TRSV infection, suggesting that the Est TTR1 allele is dominant over the tolerant ttr1 allele of Col-0. Multiple sequence alignments of 10 tolerant ecotypes from those of eight sensitive ecotypes showed that 10 LRR amino acid polymorphisms were consistently distributed across the TTR1/ttr1 alleles. Site-directed mutagenesis of these amino acids in the LRR region revealed that two sites, L956S and K1124Q, completely abolished the LSN phenotype. VIGS study revealed that TTR1 is dependent on SGT1, rather than EDS1. The LSN phenotype by TTR1 was shown to be transferred to Nicotiana benthamiana, demonstrating functional conservation of TTR1 across plant families, which are involved in SGT-dependent defense responses, rather than EDS1-dependent signaling pathways.

Tomato ringspot virus (ToRSV, a Nepovirus sp.) systemically infects many herbaceous plants. Viral RNA accumulates in symptomatic leaves and in young, asymptomatic leaves that emerge late in infection. Here, we show that systemic infection by ToRSV is restricted in tobacco. After an initial hypersensitive response in inoculated leaves, only a few plants showed limited systemic symptoms. Viral RNA did not usually accumulate to detectable levels in asymptomatic leaves. ToRSV-derived small-interfering RNAs and PR1a transcripts were only detected in tissues that contained viral RNA, indicating local induction of RNA silencing and salicylic acid (SA)-dependent defense responses. Lesion size and viral systemic spread were reduced with SA pretreatment but enhanced in NahG transgenic lines deficient in SA accumulation, suggesting that SA-dependent mechanisms play a key role in limiting ToRSV spread in tobacco. Restriction of virus infection was enhanced in transgenic lines expressing the P1-HC-Pro suppressor of silencing. Knocking down the SA-inducible RNA-dependent RNA polymerase 1 exacerbated the necrotic reaction but did not affect viral systemic spread. ToRSV-infected tobacco plants were susceptible to reinoculation by ToRSV or Tobacco mosaic virus, although a small reduction in lesion size was observed. This moderate systemic resistance suggests inefficient induction or spread of RNA silencing and systemic acquired resistance signal molecules.

Soybean vein necrosis virus (SVNV) is a virus originally discovered in Arkansas and Tennessee and is currently present in all major soybean-producing states in the United States and Canada (Zhou and Tzanetakis 2013). Studies were carried out to investigate the role of kudzu (Pueraria montana) in SVNV epidemiology. Kudzu is present in millions of acres in the southeastern United States and is known to host at least another soybean-infecting virus, tobacco ringspot virus (TRSV) (Aboughanem-Sabanadzovic et al. 2014; Khankum et al. 2013). Eighty-five samples collected from 15 Mississippi counties during September 2015 were tested for SVNV infections using DAS-ELISA (Agdia Inc, U.S.A.) and three were infected by the virus. Two of the samples displayed mild deformation of young leaves, whereas the third was symptomless. In order to verify the results, virus-specific RT-PCR tests were performed on nucleic acid extracts from all ELISA-positive samples along with three SVNV-free kudzu plants and controls, represented by SVNV-infected and healthy soybeans. A DNA band of 236 bp corresponding to the NSs gene (Zhou and Tzanetakis 2013) was amplified only from the three ELISA-positive kudzu samples and positive controls. The products were directly sequenced in both directions and confirmed to be SVNV-specific as they shared 96 to 99% nt identity with corresponding region of the SVNV reference isolate (GenBank accession no. GU722319). In a greenhouse-based study, first instar larvae of soybean thrips (Neohydatothrips variabilis Beach) were fed on symptomatic soybean for virus acquisition and transferred to eight SVNV-free kudzu seedlings as described (Zhou and Tzanetakis 2013). Leaf and root tissues were randomly collected from virus-inoculated and mock-inoculated kudzu, respectively, at 6 weeks post inoculation. Total nucleic acids were isolated and RT-PCR was performed using primer set SdetF/SdetR (Zhou et al. 2011). Amplification products corresponding to the complete NP gene (834 bp) were obtained in both leaf and root tissues from five inoculated plants and shared 97 to 99% identity with the reference isolate (GenBank accession no. GU722319), whereas there was no amplification from mock-inoculated controls. Those results were further confirmed by dot blot immunoassay with infected plants remaining asymptomatic for at least a month post inoculation. Our findings represent the first report of SVNV infections of kudzu in the U.S.A. and the world. Kudzu is likely to play a role in the epidemiology of virus and disease. Furthermore, our results expand the range of pathogens (Asian soybean rust, TRSV) and insects (kudzu bug) that kudzu can sustain, indicating its ecological impact as an invasive species.

There is limited information on the distribution of blueberry viruses in the U.S. or around the world other than where the viruses were first discovered and characterized. A survey for blueberry viruses was carried out in the U.S. in 2015–2017. Most blueberry viruses have been characterized to the point that sensitive diagnostic assays have been developed. These assays are based on ELISA or variations of PCR, which were employed here to determine the presence of blueberry viruses in major blueberry production and nursery areas of the U.S. The viruses included in this study were: blueberry fruit drop (BFDaV), blueberry latent (BlLV), blueberry leaf mottle (BLMoV), blueberry mosaic (BlMaV), blueberry red ringspot (BRRV), blueberry scorch (BlScV), blueberry shock (BlShV), blueberry shoestring (BlSSV), blueberry virus A (BVA), peach rosette mosaic (PRMV), tobacco ringspot (TRSV), and tomato ringspot (ToRSV). In the Pacific Northwest BlShV was the most widespread virus, with BlScV and ToRSV detected in a limited number of fields in Oregon and Washington, but BlScV was widespread in British Columbia. In the upper midwest, the nematode-borne (ToRSV, TRSV), aphid-transmitted (BlSSV and BVA) and pollen-borne (BLMoV) viruses were most widespread. In the northeast, TRSV, ToRSV, and BlScV, were detected most frequently. In the southeast, BRRV and BNRBV were the most widespread viruses. BlLV, a cryptic virus with no known symptoms or effect on plant growth or yield was present in all regions. There are other viruses present at low levels in each of the areas, but with the lower incidence they pose minimal threat to nursery systems or fruit production. These results indicate that there are hotspots for individual virus groups that normally coincide with the presence of the vectors. The information presented highlights the high risk viruses for nursery and fruit production each pose a different challenge for control.

Pollen is traded internationally as a source of germplasm and for pollination. Thirty-nine viruses and five viroids are known to be pollen transmitted. We investigated whether reverse transcription-polymerase chain reaction (RT-PCR) could be used to detect viruses reliably in pollen. Four extraction methods yielded nucleic acid in appropriate quantity and quality from Tobacco ringspot virus (TRSV)-infected pollen for RT-PCR

A survey was conducted in 2007 to determine the incidence and distribution of viruses in commercial blackberry crops in Alabama. Symptomatic and asymptomatic plants in eight major blackberry producing counties were tested for Impatiens necrotic spot virus, Raspberry bushy dwarf virus, Tobacco ringspot virus, and Tomato ringspot virus using enzyme-linked immunosorbent assay. Seventy-nine percent of the blackberry samples were infected. Tomato ringspot virus was detected in 45% of the samples, followed by Impatiens necrotic spot virus (35%), Tobacco ringspot virus (31%), and Raspberry bushy dwarf virus (26%). Each virus was detected in each of the eight counties surveyed and in each of the 14 blackberry cultivars evaluated in this study. Seventy-eight percent of the asymptomatic blackberry samples tested positive for virus infection, an indication that symptom expression is not necessarily a reliable diagnostic method for virus infection of blackberries.

We analysed the kinetics of virus distribution in Tobacco ringspot virus (TRSV)-infected tobacco. Infected plants developed asymptomatic leaves above the symptomatic leaves that exhibited ringspots. We detected virus in the shoot apical meristem (SAM). Time-course immunohistochemical microscopy showed that TRSV continuously distributed in the centres of the SAM and in leaf primordia. In contrast, TRSV infection was transient in the root meristem. In western blot and RT-PCR analyses, TRSV infection occurred only within and around the ringspot tissues of the symptomatic leaf; however, TRSV was not or hardly detected in the asymptomatic leaves of inoculated tobacco plants. These results indicate that TRSV persists in the SAM, but that TRSV infection is transient in the root meristem and asymptomatic leaves.

International audience; The order Picornavirales includes several plant viruses that are currently classified into the families Comoviridae (genera Comovirus, Fabavirus and Nepovirus) and Sequiviridae (genera Sequivirus and Waikavirus) and into the unassigned genera Cheravirus and Sadwavirus. These viruses share properties in common with other picornavirales (particle structure, positive-strand RNA genome with a polyprotein expression strategy, a common replication block including type III helicase, a 3C-like cysteine proteinase and type I RNA-dependent RNA polymerase). However, they also share unique properties that distinguish them from other picornavirales. They infect plants and use specialized proteins or protein domains to move through their host. In phylogenetic analysis based on their replication proteins, these viruses form a separate distinct lineage within the picornavirales branch. To recognize these common properties at the taxonomic level, we propose to create a new family termed “Secoviridae” to include the genera Comovirus, Fabavirus, Nepovirus, Cheravirus, Sadwavirus, Sequivirus and Waikavirus. Two newly discovered plant viruses share common properties with members of the proposed family Secoviridae but have distinct specific genomic organizations. In phylogenetic reconstructions, they form a separate sub-branch within the Secoviridae lineage. We propose to create a new genus termed Torradovirus (type species, Tomato torrado virus) and to assign this genus to the proposed family Secoviridae.

Over the past decade, intensive spread of virus infections of oilseed pumpkin has resulted in significant economic losses in pumpkin crop production, which is currently expanding in our country. In 2007 and 2008, a survey for the presence and distribution of oilseed pumpkin viruses was carried out in order to identify viruses responsible for epidemics and incidences of very destructive symptoms on cucurbit leaves and fruits. Monitoring and collecting samples of oil pumpkin, as well as other species such as winter and butternut squash and buffalo and bottle gourd with viral infection symptoms, was conducted in several localities of Vojvodina Province. The collected plant samples were tested by DAS-ELISA using polyclonal antisera specific for the detection of six most economically harmful pumpkin viruses: Cucumber mosaic virus (CMV), Zucchini yellow mosaic virus (ZYMV), Watermelon mosaic virus (WMW), Squash mosaic virus (SqMV), Papaya ringspot virus (PRSV) and Tobacco ringspot virus (TRSV) that are included in A1 quarantine list of harmful organisms in Serbia. Identification of viruses in the collected samples indicated the presence of three viruses, ZYMV, WMV and CMV, in individual and mixed infections. Frequency of the identified viruses varied depending on locality and year of investigations. In 2007, WMV was the most frequent virus (94.2%), while ZYMV was prevalent (98.04%) in 2008. High frequency of ZYMV determined in both years of investigation indicated the need for its rapid and reliable molecular detection. During this investigation, a protocol for ZYMV detection was developed and optimized using specific primers CPfwd/Cprev and commercial kits for total RNA extraction, as well as for RT-PCR. In RT-PCR reaction using these primers, a DNA fragment of approximately 1100 bp, which included coat protein gene, was amplified in the samples of infected pumkin leaves. Although serological methods are still useful for large-scale testing of a great number of samples, this protocol, due to its high sensitivity and specificity, is an important improvement in rapid diagnosis of diseases caused by this virus. In addition, the protocol provides a basis for further characterization of ZYMV isolates originating from Serbia. Intenzivno širenje virusa infektivnih za uljanu tikvu (Cucurbita pepo), poslednjih deset godina imalo je za posledicu značajne ekonomske gubitke u proizvodnji ove kulture koja se gaji na sve većim površinama u našoj zemlji. Kako bi se identifikovali virusi, odgovorni za epidemijsku pojavu i ispoljavanje veoma destruktivnih simptoma na lišću i plodovima uljane tikve, tokom 2007. i 2008. sprovedeno je ispitivanje njihove pojave i rasprostranjenosti. Pregled i sakupljanje uzoraka uljane tikve, kao i nekih drugih vrsta tikava, kao što su bundeva, muskatna i bizonska tikva i vrg sa simptomima virusnih zaraza, obavljeno je na više različitih lokaliteta gajenja uljane tikve u Vojvodini. Sakupljeni uzorci testirani su DAS-ELISA metodom primenom poliklonalnih antiseruma specifičnih za detekciju u svetu šest ekonomski najznačajnijih virusa tikava: virusa mozaika krastavca (Cucumber mosaic virus, CMV), virusa žutog mozaika cukinija (Zucchini yellow mosaic virus, ZYMV), virusa mozaika lubenice (Watermelon mosaic virus, WMW), virusa mozaika bundeve (Squash mosaic virus, SqMV), virusa prstenaste pegavosti papaje (Papaya ringspot virus, PRSV) i virusa prstenaste pegavosti duvana (Tobacco ringspot virus, TRSV), koji se nalazi na A1 karantinskoj listi štetnih organizama u Srbiji. Identifikacija virusa u sakupljenim uzorcima ukazala je na prisustvo tri virusa, ZYMV, WMV i CMV, koji su se javili u pojedinačnim ili mešanim infekcijama. Njihova učestalost je po pojedinim godinama i lokalitetima bila različita. Tokom 2007. najčešće je dokazan WMV (94,2%), dok je 2008. godine prevalentan virus bio ZYMV (98,04%). Velika učestalost ZYMV u obe godine ispitivanja ukazala je na potrebu za brzom i pouzdanom molekularnom detekcijom ovog virusa. U toku ovih istraživanja razvijen je i optimizovan protokol za detekciju ZYMV primenom specifičnih prajmera CPfwd/CPrev i komercijalnih kitova za ekstrakciju ukupne RNA i RT-PCR. Korišćenjem ovih prajmera, kojim se amplifikuje deo genoma ZYMV kojim je obuhvaćen i gen za proteinski omotač, umnožen je DNK fragment dužine oko 1100 bp iz lišća zaraženih biljaka. Mada serološke metode i dalje imaju veliku prednost u primeni za masovna testiranja velikog broja uzoraka, razvijeni protokol molekularne detekcije, zbog visoke osetljivosti i specifičnosti predstavlja značajno poboljšanje brze dijagnoze oboljenja koja ovaj virus izaziva. Osim toga, ovaj protokol pruža osnovu za dalju karakterizaciju ZYMV izolata poreklom iz Srbije.

The aim of this study was to investigate the dependence of the observed cleavage rates (kobs) of a tertiary stabilized hammerhead ribozyme (tsHHRz) and of a minimal hammerhead ribozyme (mHHRz), both derived from tobacco ringspot virus, on the type and concentration of divalent metal ions in order to interpret the functional role of high-affinity ions detected by electron paramagnetic resonance (EPR). To measure the fast cleavage of the cis tsHHRz, a new method using chemically synthesized fluorescent-labeled RNAs has been developed. The tsHHRz cleavage rate is up to 20-fold faster than that of the mHHRz under similar conditions. The presence of Mn2+ ions leads to a 60-fold faster cleavage than in the presence of Mg2+ ions. The functional role of the high-affinity ion was evaluated using neomycin B inhibition studies. Neomycin B reduces the cleavage activity of both ribozymes but the inhibitory effect on tsHHRz is much weaker than that on the mHHRz. EPR data had shown that neomycin B displaces both low-aff...

Background Genome-wide association study (GWAS) is a useful tool for detecting and characterizing traits of interest including those associated with disease resistance in soybean. The availability of 50,000 single nucleotide polymorphism (SNP) markers (SoySNP50K iSelect BeadChip; www.soybase.org) on 19,652 soybean and wild soybean plant introductions (PIs) in the USDA Soybean Germplasm Collection allows for fast and robust identification of loci associated with a desired phenotype. By using a genome-wide marker set to predict phenotypic values, genomic prediction for phenotype-unknown but genotype-determined PIs has become possible. The goal of this study was to describe the genetic architecture associated with sensitivity to Tobacco ringspot virus (TRSV) infection in the USDA Soybean Germplasm Collection. Results TRSV-induced disease sensitivities of the 697 soybean PIs were rated on a one to five scale with plants rated as one exhibiting mild symptoms and plants rated as five displaying terminal bud necrosis (i.e., bud blight). The GWAS identified a single locus on soybean chromosome 2 strongly associated with TRSV sensitivity. Cross-validation showed a correlation of 0.55 (P

We report here the development of tobacco ringspot virus (TRSV)-based vectors for the transient expression of foreign genes and for the analysis of endogenous gene function in plants using virus-induced gene silencing. The jellyfish green fluorescent protein (GFP) gene was inserted between the TRSV movement protein (MP) and coat protein (CP) regions, resulting in high in-frame expression of the RNA2-encoded viral polyprotein. GFP was released from the polyprotein via an N-terminal homologous MP-CP cleavage site and a C-terminal foot-and-mouth disease virus (FMDV) 2 A catalytic peptide in Nicotiana benthamiana. The VIGS target gene was introduced in the sense and antisense orientations into a SnaBI site, which was created by mutating the sequence following the CP stop codon. VIGS of phytoene desaturase (PDS) in N. benthamiana, Arabidopsis ecotype Col-0, cucurbits and legumes led to obvious photo-bleaching phenotypes. A significant reduction in PDS mRNA levels in silenced plants was confirmed by semi-quantitative RT-PCR.

Based on the nucleotide sequence homology of RNA-1 and RNA-2 of nepoviruses isolated from grapevines, three sets of degenerate primers, one for each of the three subgroups of the genus (A, B and C), were designed and proved effective for RT-PCR detection of subgroups in infected grapevines and herbaceous hosts. Primers designed specifically for detecting subgroup A species amplified a fragment of 255 bp from samples infected by Grapevine fanleaf virus (GFLV), Arabis mosaic virus (ArMV), Tobacco ringspot virus (TRSV) and Grapevine deformation virus (GDefV), but not from samples infected by other nepovirus species. Similarly, primers for detection of subgroup B nepoviruses amplified a 390 bp product from samples infected by Grapevine chrome mosaic virus (GCMV), Tomato black ring virus (TBRV), Grapevine Anatolian ringspot virus (GARSV) and Artichoke Italian latent virus (AILV). The third set of primers amplified a 640 bp fragment, only from samples infected by subgroup C nepoviruses, i.e Tomato ringspot virus (ToRSV) Grapevine Bulgarian latent virus (GBLV), and Grapevine Tunisian ringspot virus (GTRSV). These primers were able to detect simultaneously all viral species belonging to the same subgroup and to discriminate species of different subgroups. Multiplex-PCR detection of subgroup A and B nepoviruses was obtained using a specific primer (sense for subgroup A and antisense for subgroup B) for each of the species of the same subgroup in combination with the degenerate subgroup-specific primers. In this way it was possible to detect four different viral species in single samples containing mixtures of viruses of the same subgroup. In particular, for viruses of subgroup A (TRSV, GFLV, ArMV and GDefV) amplicons of 190, 259, 301 and 371 bp were obtained, whereas amplicons of 190, 278, 425 and 485 bp, respectively, were obtained from samples infected with viruses of subgroup B (GCMV, AILV, GARSV and TBRV).

Tobacco ringspot virus (TRSV, genus Nepovirus), causes severe diseases in soybean and tobacco plants. TRSV-induced bud blight disease significantly reduced both the yield and quality of soybeans. The function of the encoded viral gene product involved in TRSV infection was unclear due to the limitation of reverse genetics studies on the viral genome. Here, we represent the successful construction of infectious full-length cDNA clones of TRSV genome (RNA1 and RNA2). The cDNAs of TRSV RNA1 and RNA2 were cloned into the binary vector pPZP211 immediately downstream of a double cauliflower mosaic virus 35S promoter and upstream of the nopaline synthase terminator. Seven days after agrobacterium-mediated co-inoculation of these two constructs, Nicotiana benthamiana plants developed a systemic infection with necrotic ringspot symptoms and weak stunting of the leaves, similar to that induced by natural TRSV. The systemic infection was confirmed by transmission electron microscopy and Western blot analysis. Simultaneously, soybean, tomato, and Arabidopsis ecotype Estland were mechanically inoculated with sap prepared from TRSV-agroinfiltrated N. benthamiana leaves, showing typical symptoms of bud blight, necrotic spots, and lethal systemic necrosis, respectively. The system developed herein will be an appealing way to determine TRSV viral gene functions and study host-TRSV interactions.

The recently introduced soybean aphid (Aphis glycines), which is widespread in the soybean-growing regions in the United States, is the only aphid able to develop large colonies on soybean. Although its potential as a vector of plant viruses is recognized, reports on virus transmission efficiency by this aphid species are limited. In the present study, we examined the ability of A. glycines to transmit several economically important viruses. The results showed that A. glycines transmitted the potyviruses Bean yellow mosaic virus (BYMV) and Soybean mosaic virus from soybean to soybean more efficiently than Myzus persicae. However, M. persicae transmitted the alfamovirus Alfalfa mosaic virus and the potyviruses Tobacco etch virus (TEV) and Tobacco vein mottling virus (TVMV) from tobacco to tobacco more efficiently than A. glycines. This is the first report to demonstrate that the soybean aphid can vector TEV and TVMV, two economically important tobacco viruses. This also is the first report to document successful transmission of BYMV by A. glycines. All attempts to transmit the nepovirus Tobacco ringspot virus by A. glycines were unsuccessful, regardless of the length of the acquisition and inoculation feeding periods. Although the luteovirus Soybean dwarf virus (SbDV) was widely distributed in red and white clover in Kentucky, it was not detected in soybean. All transmission experiments of SbDV by A. glycines were unsuccessful. A reverse-transcription polymerase chain reaction (RT-PCR) assay was developed to detect SbDV in single aphids using a pair of primers designed to amplify a 372-bp PCR fragment in the coding region of SbDV coat protein. Although A. glycines was not a vector of SbDV, the virus was detected in 100% of tested aphids by RT-PCR after a 24- to 48-h virus acquisition access feeding. The practical applications of RT-PCR in detecting persistently transmitted viruses are discussed.

Symptoms of viral infection have been observed during the last decade in berry crops; however, only few viral diseases have been reported on raspberry ( Rubus idaeus ), red currant ( Ribes sanguineum ) and blueberry ( Vaccinium corymbosum ) crops in Chile. A serological survey based on ELISA test was performed in2000 to determine the six most important virus affecting raspberries and red currants and the four most important viruses in blueberries. This survey comprised a total of 82 ha representative of the main cultivated area distributed in about 940 km from north to south. The results obtained demonstrated an extremely high incidence of the following viruses in raspberry: Apple mosaic virus (87-98%), Arabis mosaic virus (29-86%), Raspberry bushy dwarf virus (35-68%) and Tomato ringspot virus (63-85%). Low incidence levels of Tomato ringspot virus (0-14%) and Tobacco ringspot virus (6-19%) were found in blueberries. Red currants had a low incidence of either Arabis mosaic virus or Tomato ringspot virus, in just one location each. Therefore, the results obtained in this survey will be useful for the establishment of a virus-free certification program, based on ELISA test in Chile. To our knowledge, with the exception of T omato ringspot virus and Raspberry bushy dwarf virus in raspberry, these virus were reported for the first time, in the above mentioned host plants, in Chile. En Chile, el cultivo de berries : arandano ( Vaccinium corymbosum ), frambueso ( Rubus idaeus ) y zarzaparrilla ( Ribes sanguineum ), se distribuye en las regiones central y sur del pais, constituyendo una fuente importante de trabajo. Durante los ultimos diez anos, han sido reportados una serie de sintomas virales en estos cultivos. Con el proposito de determinar el estado actual de infecciones virales en estas especies, se condujo una prospeccion en el 2000 de estos cultivos basados en analisis serologico utilizando la tecnica de ELISA, para la deteccion de seis virus en frambueso y zarzaparrilla, y cuatro virus en arandano. Un total de 82 ha de plantaciones comerciales de estas especies, representativas del area total de cultivo, fueron muestreadas y examinadas. Los resultados demostraron diferencias importantes entre localidades. Una muy alta incidencia de los siguientes virus se encontro en frambueso: Apple mosaic virus (87-98%), Arabis mosaic virus (29-86%), Raspberry bushy dwarf virus (35-68%) y Tomato ringspot virus (63-85%), mientras que en arandano hubo una baja incidencia de Tomato ringspot virus (0-14%) y Tobacco ringspot virus (6-19%). Zarzaparrillas arrojaron una muy baja incidencia tanto de ArMV como ToRSV en tan solo una localidad cada uno. Estos resultados son importantes al momento de establecer un programa de certificacion de plantas libres de virus, lo que permitiria mejorar la calidad y rendimientos es estas especies frutales en Chile. De acuerdo a nuestro conocimiento, con la excepcion de Tomato ringspot virus y Raspberry bushy dwarf virus , esta constituye la primera mencion de estos virus en Chile, en las plantas hospederas antes indicadas.

During February and September 2003, the incidence and distribution of viruses infecting grapevine (Vitis vinifera) in Iran was determined. A total of 238 symp- tomatic and 1314 asymptomatic leaf samples were col- lected from 56 different vineyards from 10 Iranian provinces and tested by enzyme-linked immunosorbent assay (ELISA) for the presence of Grapevine fanleaf virus (GFLV), Grapevine fleck virus (GFkV), Grapevine virus A (GVA), Arabis mosaic virus (ArMV), Grapevine leafroll associated virus-3(GLRaV-3), Raspberry ring- spot virus (RpRSV) and Tobacco ringspot virus (TRSV). Viruses were found in almost all Iranian vine- yards examined. The incidence of viruses in a decreas- ing order was: GFLV (11.1%), GFkV (8.6%), GVA (8.4%), ArMV (6.6%), GLRaV-3 (6.4%), RpRSV (2.8%) and TRSV (0.35%). GFLV, either alone or in mixed infection in 11.1% of the samples collected nationwide, was the most prevalent virus. In addition, 25 (20%) of 125 symptomatic leaf samples from the Orumeyeh district were shown to contain Tomato ring- spot virus. Viruses other than GFLV and GVA are reported from grapevine for the first time in Iran.

Merr.] lines were screened for resistance to Bean pod mottle virus (BPMV), Soybean mosaic virus (SMV) strains G1 and G5, Tobacco that occurs in all soybean production areas of the world ringspot virus (TRSV), and Tobacco streak virus (TSV). Seven an- (Hill, 1999). Leaves of SMV-infected plants often apcestors, ‘CNS’, ‘Haberlandt’, ‘Ogden’, ‘Peking’, PI 71506, PI 88788, pear mottled and distorted, and yield losses of 8 to 35% and ‘Tokyo’, were resistant to SMV-G1. Sixteen entries, ‘A.K. (Har- have been reported (Hill, 1999; Quinones et al., 1971; row)’, ‘Capital’, CNS, FC 33243, Haberlandt, ‘Illini’, ‘Improved Peli- Ross, 1968). Cho and Goodman (1979) defined SMV can’, ‘Laredo’, ‘Lincoln’, ‘Mandarin’, ‘Mandarin (Ottawa)’, Ogden, strains G1 through G7 using reactions on a set of soy‘Palmetto’, Peking, PI 88788, and Tokyo were resistant to SMV-G5. bean differentials. Soybean mosaic virus strain G1 was All ancestral lines tested were susceptible to BPMV and TRSV. Only the most common strain identified when 98 SMV isoone ancestor, ‘Tanner’, was resistant to TSV. On the basis of cultivar lates were tested from a worldwide seed collection (Cho registration articles through 2002, there were 15 public soybean cultiand Goodman 1979), and it has been shown to have a vars with reported resistance to SMV. The possible donors of resistance for each were identified. Two soybean ancestors, CNS and high rate of seed transmission (Bowers and Goodman, Ogden, were the most important possible sources of SMV resistance 1991).SoybeanmosaicvirusG5hasbeenshowntocause genes in U.S. commercial soybean cultivars, as the pedigree of 75 and severe reduction in weight of infected plants and seed 56% of the reported resistant cultivars contained CNS and Ogden, yields(Tu,1989).Allstrains,includingG1andG5,cause respectively. In most of the cultivar registration articles, reactions to seed mottling (Bowers and Goodman, 1991). SMV were not reported. With the relatively high frequency of SMV Tobacco ringspot virus was first described in the USA resistance in major ancestral lines, SMV resistance in U.S. cultivars in 1941 (Samson, 1942). Bud blight is the most severe may be more common than expected. symptom of TRSV infection in soybean, but vein necrosis, flower and pod abortion, and stunting also can be

A survey was conducted to determine the incidence of Alfalfa mosaic virus (AlMV), Bean common mosaic virus (BCMV), Bean yellow mosaic virus (BYMV), Blackeye cowpea mosaic virus (BlCMV), Cucumber mosaic virus (CMV), Pea enation mosaic virus (PEMV), Peanut mottle virus (PeMoV), Soybean mosaic virus (SMV), Tobacco mosaic virus (TMV), Tobacco ringspot virus (TRSV), Tobacco streak virus (TSV), Tomato ringspot virus (ToRSV), and Tomato spotted wilt virus (TSWV) on soybean (Glycine max) in Iran. Totals of 3,110 random and 1,225 symptomatic leaf samples were collected during the summers of 1999 and 2000 in five provinces of Iran, where commercial soybean is grown, and tested by enzyme-linked immunosorbent assay (ELISA) using specific polyclonal antibodies. Serological diagnoses were confirmed by electron microscopy and host range studies. The highest virus incidence among the surveyed provinces was recorded in Mazandaran (18.6%), followed by Golestan (15.7%), Khuzestan (14.2%), Ardabil (13.9%), and Lorestan (13.5%). Incidence of viruses in decreasing order was SMV (13.3%), TSWV (5.4%), TRSV (4.2%), TSV (4.1%), PEMV (2.9%), BYMV (2.2%), ToRSV (2.1%), AlMV (1.3%), BCMV (0.8%), and CMV (0.6%). Additionally, 1.5% of collected leaf samples had positive reactions in ELISA with antiserum to TMV, indicating the possible infection of soybeans in Iran with a Tobamovirus that is related serologically to TMV. Of 195 leaves from plants showing soybean pod set failure syndrome (PSF) in Mazandaran and Lorestan, only 14 (7.2%) samples had viral infection. No correlation was observed between PSF and presence of the 13 viruses tested, suggesting the involvement of other viruses or factors in this syndrome. To investigate the presence of seed-borne viruses, including SMV, TRSV, ToRSV, and TSV, 7,830 soybean seeds were collected randomly at harvesting time from the major sites of soybean seed production located in Mazandaran and Golestan provinces. According to ELISA analyses of germinated seedlings, 7.1 and 8.9% of the seed samples from Golestan and Mazandaran provinces, respectively, transmitted either SMV, TRSV, ToRSV, or TSV through seed. We also showed that SMV and other seed transmissible viruses, as well as TSWV, usually are the most prevalent viruses in soybean fields in Iran. In this survey, natural occurrence of AlMV, BCMV, BlCMV, BYMV, CMV, PEMV, PeMoV, and TSWV was reported for the first time on soybeans in Iran.

During the last three years blackberries in southern and southeastern U.S. have shown symptoms of vein clearing, yellow mottling and plant decline with considerable variation in symptoms with cultivars. We isolated dsRNA from symptomatic plants and identified high molecular weight bands similar to those isolated from plants infected with criniviruses. Paired extractions from virus-tested blackberries did not yield any dsRNA bands with molecular weight greater than 500 bp. Using degenerate primers developed against the crinivirus 1b protein in RTPCR resulted in an amplicon that when sequenced showed the virus was a member of the Crinivirus genus. We have also cloned the virus and sequenced clones containing regions of the minor coat protein of the virus. Phylogenetic analysis revealed that the new virus, designated as Blackberry yellow vein associated virus (BYVaV), is related most closely to Beet pseudo-yellows virus and Strawberry pallidosis associated virus, two criniviruses recently identified in strawberry. INTRODUCTION Symptoms of vein clearing, yellow mottling, ringspots and plant decline have been observed in blackberry in South Carolina, North Carolina and Arkansas over the past few years (Fig. 1). Initially the symptoms were thought to be caused by Tobacco ringspot virus (TRSV) as this virus is known to infect blackberry and similar symptoms attributed to TRSV infection have been reported (1). Symptomatic plants were tested for 14 viruses by ELISA including: Alfalfa mosaic, Arabis mosaic, Cucumber mosaic, Impatiens necrotic spot, Prunus necrotic ringspot, Raspberry bushy dwarf, Raspberry ringspot, Strawberry latent ringspot, Strawberry mild yellow edge, Tobacco ringspot, Tobacco streak, Tomato ringspot, and Tomato spotted wilt viruses as well as for Potyviruses using group specific antibodies. However, in ELISA tests very few plants that exhibited these symptoms tested positive for TRSV or any other virus. In this report we describe a crinivirus associated with the symptoms observed in blackberry and a reverse-transcritase polymerase chain reaction (RT-PCR) method for detecting this new virus. MATERIALS AND METHODS In an attempt to determine if there may be a new virus associated with these symptoms dsRNA was extracted from symptomatic and asymptomatic plants using a shortened version of the standard extraction method (2). After the dsRNA was bound to the cellulose powder in the presence of 16% ethanol in STE buffer, the samples were centrifuged for three minutes at 5,000 X g, the pellet was washed once with 50 ml of STE-EtOH and the cellulose repelleted by centrifugation. Two ml of STE was added to the final pellet and incubated at room temp for 5 min. The sample was then transferred to a microfuge tube and pellet at max rpm for 3 min. The supernatant was collected and nucleic acid precipitated by the addition of 2 ml of 95% EtOH with 5% 3 M sodium acetate. Samples were mixed then stored at -80C for 20 minutes before centrifugation in a microfuge at max speed for 30 minutes. Pellets were resuspend in 10 mM Tris-HCl containing 1 mM EDTA and analyzed by gel electrophoresis. Proc. X IS on Small Fruit Virus Diseases