Search

Objective: Tumor hypoxia is associated with a poorer prognosis in cancer patients and can diminish the efficacy of radiation therapy (RT). This study investigates the potential of metformin to enhance radiosensitivity in hypoxic cancer cells., Methods: Preliminary experiments were conducted to validate the impact of hypoxia on radiation response. Reactive oxygen species (ROS) levels, cell migration, and cell death were assessed in hypoxic, radiated cells treated with metformin. Proteomic and ontological analyses were employed to identify molecular targets associated with the radiosensitizing effect of metformin. Proteomic and ontological findings were validated through patient samples and in vitro studies., Results: Metformin amplified cell death, induced DNA fragmentation, decreased cell migration, and elevated ROS levels in hypoxic, radiated cells. Proteomic analyses revealed that GAPDH and TAGLN2 were identified as pivotal targets linked to the radiosensitizing effect of metformin. Oral cancer patients exhibited elevated levels of TAGLN2 and reduced levels of GAPDH. Metformin downregulated TAGLN2 and upregulated GAPDH in hypoxic, radiated cells. Additionally, metformin reduced levels of mutated p53., Conclusions: This study suggests that metformin can enhance radiosensitivity in hypoxic cells, operating through modulation of GAPDH and TAGLN2. Furthermore, metformin effectively reduces mutated p53 levels in radiated cells under hypoxic conditions., (© 2024 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.)

Objective: Oral squamous cell carcinoma (OSCC) is one of the most common neoplasms worldwide. The current study aimed to identify potential biomarkers associated with OSCC survival., Materials and Methods: Differentially expressed genes (DEGs) in atypical OSCC cases were identified using two public datasets: The Cancer Genome Atlas and the Gene Expression Omnibus database. Receiver operating characteristic (ROC) analysis was performed to identify the cutoff, and the candidate DEGs related to survival. Kaplan-Meier and Cox regression analysis using the categorized genes were employed to identify genes that impact the overall survival in OSCC., Results: A total of 263 OSCC samples and 105 healthy tissues were used to identify 295 upregulated and 131 downregulated genes expressed only in non-smokers. ROC analyses identified 25 candidate genes associated with death. Survival analyses demonstrated that the following DEGs, namely CSTA, FGFR2, MMP19, OLR1, PCSK1, RAMP2, and CGB5, are potential OSCC prognostic factors., Conclusion: We found that CSTA, FGFR2, MMP19, OLR1, PCSK1, RAMP2, and CGB5 are associated with a low survival rate in OSCC. However, further studies are needed to validate our findings and facilitate the development of these factors as potential biomarkers for OSCC survival., (© 2022 Wiley Periodicals LLC.)

Purpose: To identify the best internal structure of the Tampa Scale for Kinesiophobia in chronic low back pain patients., Design: Questionnaire validation study was designed for this study., Setting: This study was conducted in physical therapy facility., Subjects: Respondents reporting chronic low back pain (≥3 points on the 11-point Numerical Pain Rating Scale)., Main Measures: We included participants of both sexes, with a self-report of low back pain ≥3 months and with pain intensity ≥3 on the 11-point Numerical Pain Rating Scale; participants also answered the Roland-Morris Disability Questionnaire and the Pain-Related Catastrophizing Thoughts Scale for low back pain disability and catastrophizing, respectively. The dimensionality and number of items of the Tampa Scale for Kinesiophobia were evaluated using the confirmatory factor analysis. Criterion validity was assessed using Spearman's correlation coefficient using the original version of the 17-item Tampa Scale for Kinesiophobia as the gold standard., Results: A total of 122 participants were included, with mean values of low back pain duration ≥48 months, pain intensity >5 and disability >8. Tampa Scale for Kinesiophobia structure with two domains and nine items was the most suitable, with adequate values in all fit indices (Chi-square/degree of freedom <3, Comparative Fit Index and Tucker-Lewis Index >0.90, and root mean square error of approximation <0.08) and lower Akaike information criterion and Bayesian information criterion values. We observed a high correlation between the 17-item Tampa Scale for Kinesiophobia and the activity avoidance domain (rho = 0.850, P  < 0.001) and somatic focus domain (rho = 0.792, P  < 0.001) of the nine-item Tampa Scale for Kinesiophobia., Conclusion: Tampa Scale for Kinesiophobia structure with two domains (activity avoidance and somatic focus) and nine items is the most suitable for patients with chronic low back pain.

Differences in the features of aggressiveness of non-melanoma skin cancer (NMSC) subtypes, between basal cell carcinoma (BCC) and squamous cell carcinoma (SCC) are relevant characteristics. Comparing the characteristics between NMSC subtypes might help identify molecules associated with cancer metastasis and invasion. Considering these facts, the current study aimed to identify a molecular target for inhibiting skin cancer metastasis and invasion. Proteomic analysis suggested that heat shock protein 90 kDa, alpha, class B member 1 (HSP90AB1), pentaxin (PTX3), caspase-14 (CASP14), S100, actin-1, and profilin were the primary targets related to metastasis and invasion. However, after a differential expression comparison between BCC and SCC, HSP90AB1 was identified as the best target to repress metastasis and invasion. Based on molecular docking results, gallic acid (GA) was selected to inhibit HSP90AB1. A specific Hsp90ab1 siRNA targeting was designed and compared to GA. Interestingly, GA was more efficient in silencing HSP90AB1 than siRNAhsp90ab1. Hence, our data suggest that HSP90AB1 is a crucial biomarker for identifying invasion and metastasis and that its inhibition may be a viable strategy for treating skin cancer., Competing Interests: Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2022 Elsevier B.V. All rights reserved.)

Radiation therapy for head and neck squamous cell carcinoma (HNSCC) is associated with several complications. Although photobiomodulation (PBM) has radioprotective effects in normal tissue, it could also enhance the growth of neoplastic cells. Thus, the present study aimed to investigate the cellular response of oral squamous cell carcinoma with pre-exposure to low-level phototherapy before radiotherapy. SCC9, Cal-27, A431, and HaCaT cell lines were subjected to low-level light therapy and radiotherapy. The cells were treated with a single energy density (300 J/cm 2 ) of a light-emitting diode (660 nm) prior to ionizing radiation at different doses (0, 2, 4, and 6 Gy). After 24 h, wound scratch, proliferation, clonogenic cell survival, cell death, and reactive oxygen species (ROS) analyses were performed to evaluate cell response. The cell lines pre-exposed to PBM at the analyzed dosage were radiosensitive. The treatment significantly reduced cell proliferation and clonogenic cell survival. Migration and cell death assays also revealed positive results, with the treatment group showing lower rate of migration and higher cell death than did the control group. Moreover, PBM effectively increased the intracellular levels of ROS. PBM at 300 J/cm 2 is a promising radiosensitizing modality to reduce the radiation dose and avoid the intolerable side effects of radiotherapy for HNSCC, thus increasing the probability of successful treatment. However, further studies are needed to support and confirm the results., (© 2022. The Author(s), under exclusive licence to Springer-Verlag London Ltd., part of Springer Nature.)

COVID-19 was first reported in Wuhan, China, in December 2019. It is widely accepted that the world will not return to its prepandemic normality until safe and effective vaccines are available and a global vaccination program has been successfully implemented. Antisense RNAs are single-stranded RNAs that occur naturally or are synthetic and enable hybridizing and protein-blocking translation. Therefore, the main objective of this study was to identify target markers in the RNA of the severe acute respiratory syndrome coronavirus, or SARS-CoV-2, with a length between 21 and 28 bases that could enable the development of vaccines and therapies based on antisense RNA. We used a search algorithm in C language to compare 3159 complete nucleotide sequences from SARS-CoV-2 downloaded from the repository of the National Center for Biotechnology Information. The objective was to verify whether any common sequences were present in all 3159 strains of SARS-CoV-2. In the first of three datasets (SARS-CoV-2), the algorithm found two sequences each of 21 nucleotides (Sequence 1: CTACTGAAGCCTTTGAAAAAA; Sequence 2: TGTGGTTATACCTACTAAAAA). In the second dataset (SARS-CoV) and third dataset (MERS-CoV), no sequences of size N between 21 and 28 were found. Sequence 1 and Sequence 2 were input into BLAST® ≫ blastn and recognized by the platform. The gene identified by the sequences found by the algorithm was the ORF1ab region of SARS-CoV-2. Considerable progress in antisense RNA research has been made in recent years, and great achievements in the application of antisense RNA have been observed. However, many mechanisms of antisense RNA are not yet understood. Thus, more time and money must be invested into the development of therapies for gene regulation mediated by antisense RNA to treat COVID-19 as no effective therapy for this disease has yet been found., (Copyright © 2021 Elsevier B.V. All rights reserved.)

Cancer patients present a higher risk of experiencing anxiety disorders (AD). However, it is not clear if AD might be associated with cancer development. Thus, our study aimed to evaluate if AD might be related to head and neck squamous cell carcinoma (HNSCC) development. The combination of an applied animal basic study and a retrospective diagnostic case and control study in patients was performed. As a result, we obtained that stress reduced the locomotor activity of the animals in the group stress and stress + 4NqO (p < 0.0001). The stress showed no influence on the progression of neoplasia in mice. In the same way, the case group did not present differences in anxiety scores in comparison to control. Moreover, no association between HNSCC staging and anxiety scores was observed. In conclusion, our in vivo findings in humans and animals have shown that there is no relationship between AD and oral squamous cell carcinoma., Competing Interests: The authors have no conflicts of interest to declare., (© 2020 The Authors.)

Radiation Therapy (RT) is a treatment option for a large number of neoplasias. However, the effect of RT on the level of hypoxia markers is poorly understood. The present study aimed to investigate the effect of RT on the levels of hypoxic markers in Oral squamous cell carcinoma (OSCC). Evaluation of HIF-1α and miR-210 levels in OSCC was performed. Then a proteomic analysis was performed to identify candidate hypoxic targets of RT. To validate proteomic studies, the effect of RT on HIF-1α, miR-210, PDH-A and LDH-A levels under hypoxia was assessed by qRT-PCR. The impact of RT in hypoxia markers was evaluated in patients to confirm in vitro results. An increase in the HIF-1α levels was observed in OSCC. RT reduced OSCC cell proliferation and migration. Interestingly, hypoxia could revert the effect of radiation on OSCC phenotype. However, proteomics analyses suggested that LDH is one of the critical targets of RT even in hypoxia. Moreover, RT decreased HIF-1α, miR-210, and LDH even in hypoxia. The current study demonstrated that hypoxia could revert the effects of RT in the OSCC context. However, RT reduces the levels HIF-1α, miR-210 and LDH in vivo and in vitro. The consequences of RT in blood should be carefully investigated.

Objective: Malignant salivary gland tumors (MSGTs) present different phenotypic characteristics and various clinical outcomes, which proved to be a diagnostic challenge. Considering the heterogeneity of MSGT, this study aims to identify molecule related to the nature of MSGT., Methods: For screening, proteomic analysis comparing MSGT with pleomorphic adenoma (PA) and salivary gland was performed. The MSGT-associated protein which presented in the higher number in the Gene Expression Omnibus (GEO) database was selected. To validate the data, immunohistochemistry (IHC) was performed in 14 patients with PA, 22 patients with MSGT, and 14 controls., Results: 16 proteins were associated with MSGT. ANXA2 was the primary protein, according to GEO database analyses. ANXA2 was most expressed in the cell membrane. However, some ANXA2 staining was also observed in the cytoplasm and nucleus. ANXA2 was highly expressed in MSGT in comparison with control. Also, ANXA2 has a higher expression in adenocarcinoma not otherwise specified (ANOS) and myoepithelial carcinoma (MC) in comparison with PA., Conclusion: In conclusion, this study demonstrated that MSGT presented higher levels of ANXA2 in comparison with normal salivary glands. Also, ANXA2 might be interesting as a molecular marker of ANOS and MS., (© 2019 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.)

Background: There is significant controversy in the literature regarding the relationship between hypoxia and salivary gland neoplasms (SGNs)., Objective: The current study aims to investigate levels of hypoxia markers in both benign and malignant salivary neoplasms., Patients and Methods: The current study sample is comprised of a total of 62 samples. HIF-1α expression was evaluated by immunohistochemistry. Additionally, HIF-1α mRNA and miR-210 levels were assessed using qRT-PCR., Results: No differences in HIF-1α expression were observed among the control group, benign and malignant SGNs. Similarly, HIF-1α mRNA levels were similar between benign and malignant SGNs. Also, there was no difference in miR-210 expression between case and control groups., Conclusion: The angiogenic markers, miR-210 and HIF-1α, do not appear to distinguish malignancy in salivary glands., (Copyright © 2019 Elsevier B.V. All rights reserved.)

Leptin, one of the main hormones controlling energy homeostasis, has been associated with different cancer types. In oral cancer, its effect is not well understood. We investigated, through in vitro and in vivo assays, whether leptin can affect the neoplastic behavior of oral squamous cell carcinoma. Expression of genes possibly linked to the leptin pathway was assessed in leptin-treated oral squamous cell carcinoma cells and also in tissue samples of oral squamous cell carcinoma and oral mucosa, including leptin, leptin receptor, hypoxia-inducible factor 1-alpha, E-cadherin, matrix metalloproteinase-2, matrix metalloproteinase-9, Col1A1, Ki67, and mir-210. Leptin treatment favored higher rates of cell proliferation and migration, and reduced apoptosis. Accordingly, leptin-treated oral squamous cell carcinoma cells show decreased messenger RNA caspase-3 expression, and increased levels of E-cadherin, Col1A1, matrix metalloproteinase-2, matrix metalloproteinase-9, and mir-210. In tissue samples, hypoxia-inducible factor 1-alpha messenger RNA and protein expression of leptin and leptin receptor were high in oral squamous cell carcinoma cases. Serum leptin levels were increased in first clinical stages of the disease. In animal model, oral squamous cell carcinoma-induced mice show higher leptin receptor expression, and serum leptin level was increased in dysplasia group. Our findings suggest that leptin seems to exert an effect on oral squamous cell carcinoma cells behavior and also on molecular markers related to cell proliferation, migration, and tumor angiogenesis.

Background: Metformin is a biguanide, belonging to the oral hypoglycemic agents and is a widely used in the treatment of type 2 diabetes. Evidence indicate that Metformin inhibits cell proliferation in several human cancers and inhibits the Warburg phenomenon in tumor cells., Results: Low PDH levels were observed in OSCC, and Metformin promotes an increase in PDH levels in hypoxic conditions. Metformin also reduced HIF-1α mRNA and protein levels. Metformin demonstrated antiproliferative effects, inhibited migration, increased the number of apoptotic cells and increased the transcription of caspase 3., Objective: The present study aims to explore the effects of Metformin in hypoxic conditions. Specifically, we focused on pyruvate dehydrogenase (PDH), (hypoxia-inducible factor 1α) HIF-1α levels and the oral squamous cell carcinoma (OSCC) cell phenotype. Additionally, we also investigated a theoretical consequence of Metformin treatment., Methods: PDH levels in patients with OSCC and oral dysplasia were evaluated. Metformin was administered in vitro to test the effect of Metformin under hypoxic conditions. The results were complemented by Bioinformatics analyses., Conclusions: In conclusion, our current findings show that Metformin reduces HIF-1α gene expression and increases PDH expression. Metformin inhibits cell proliferation and migration in the OSCC cell line model. Additionally, Metformin enhances the number of apoptotic cells and caspase 3 levels. Interestingly enough, Metformin did not increase the mutant p53 levels under hypoxic conditions.

Background: Skin cancer represents the most common worldwide malignancy. Angiogenesis is an important factor in tumor growth and metastasis. Given these facts, the purpose of the current study was to compare the levels of angiogenic proteins in the context of the most common malignant and premalignant skin lesions., Methods: Immunohistochemistry of CD31, HIF1A, VEGFR1 and VEGFR2 was performed in basal cell carcinoma (BCC), actinic keratosis (AK) and squamous cell carcinoma of the skin (SCCS)., Results: SCCS presented with increased levels of HIF1A, VEGFR1 and VEGFR2 in comparison to AK. In addition, SCCS also demonstrated increased levels of HIF1A to BCCLR or BCCHR. BCC presented with more vessels than AK. However, no correlation was observed among CD31, HIF1A, VEGFR1 and VEGFR2., Conclusions: SCCS presented with higher levels of HIF1A, VEGFR1 and VEGFR2, while BCC demonstrated an increased number of vessels in relation to AK. These data suggest that antiangiogenic therapy might be useful for skin cancer treatment., (Copyright © 2015 Elsevier GmbH. All rights reserved.)