Search

In May 1997, inclusions typical of a tospovirus were visualized by light microscopy in leaf tissue of lisianthus (Eustoma grandiflorum) exhibiting stunting, necrotic ringspots, leaf distortion, and systemic necrosis. Wilting and plant death were the final symptoms observed. Affected plants occurred at low incidence (-l · m-2. Transmission rates were 100 and 0% to lisianthus and tomato, respectively. Chlorotic local lesions followed by chlorotic ringspots were observed in inoculated lisianthus leaves 4 days after inoculation. Stunting, leaf distortion, and necrotic ringspots appeared in noninoculated leaves of lisianthus plants within 3 to 4 weeks after inoculation. Buffer-inoculated lisianthus and all tomato plants remained symptomless and tested negative for INSV by ELISA. All symptomatic lisianthus tested positive for INSV by ELISA. The symptoms we observed in lisianthus due to infection by INSV were more severe than those previously reported in this host (1,2). The occurrence of such strains of INSV at high incidences could pose a significant threat for commercial lisianthus production. References: (1) M. K. Hausbeck et al. Plant Dis. 76:795, 1992. (2) H. T. Hsu and R. H. Lawson. Plant Dis. 75:292,1991.

The location of tomato mottle virus (ToMoV) and cabbage leaf curl virus (CabLCV) (Geminiviridae, genus Begomovirus) in the whitefly vector Bemisia tabaci B-biotype (Homoptera: Aleyrodidae) was elucidated using a novel technique incorporating indirect immunofluorescent labeling in freshly dissected whiteflies. Begomoviruses were visualized in the whitefly by indirect-fluorescent-microscopy. Polyclonal and monoclonal primary antibodies were used to successfully detect both ToMoV and CabLCV. Both begomoviruses were located in the anterior region of the midgut and filter-chamber of adult whiteflies, with ToMoV detected in the salivary glands. CabLCV was detected at a greater frequency than ToMoV, with a positive detection of 16% (89 out of 560) for CabLCV and 3% (25 out of 840) for ToMoV. Possible sites involved in geminivirus transport from the gut lumen of whiteflies into the hemocoel were located in the filter-chamber and anterior portion of the midgut. The location of these begomoviruses suggests a possible scenario of virus movement through the whitefly, which is discussed.

In the summers of 2000 and 2001, tomato plants (Lycopersicon esculentum) with symptoms of stunting, curling, and marginal chlorosis of leaves, reduced leaf size, and marked reduction in fruit number, similar to those caused by Tomato yellow leaf curl virus (TYLCV), were seen in Henderson County, NC. In 2001, symptomatic plants appeared in a 40-A (18.2 ha) field in 12 foci of ≈12 plants each, at a total incidence of less than 1%. In August 2001, DNA was extracted from leaf samples from four symptomatic plants and tested by polymerase chain reaction (PCR) amplification for the presence of one or more geminiviruses. Two sets of primers were used to test for begomoviruses, AC1048 and PCRv181 (3,4), which amplify a 1,020-bp DNA product from a wide range of monopartite and bipartite (A component only) begomoviruses, and C473 and PTYC1v2406, which preferentially amplifies a 859-bp DNA product from the monopartite TYLCV (1,2). Fragments of the expected size were obtained from all four samples, and all PCR products were sequenced. The sequences of the 1,020-bp PCR product from each of the four samples were compared and found to be 100% identical. The same was found for the 859-bp products. These sequences were compared with equivalent regions of begomoviruses and were identical to sequences of TYLCV. Since the two primer sets amplify overlapping regions of the TYLCV genome, the 1,020 and 859-bp products generated by the two primer sets from one plant were combined to create a 1,464-bp sequence that represented approximately half of the TYLCV genome and encompasses the C4 ORF, the intergenic region, and most of the coat protein gene. This 1,464-bp sequence from North Carolina was 99.2 to 99.6% identical to TYLCV sequences reported from Cuba (GenBank Accession No. AJ223505), the Dominican Republic (GenBank Accession No. AF024715), and Florida, and 96.9 to 98.2% identical to TYLCV sequences reported from the Bahamas, Israel (GenBank Accession No. X15656), Jamaica (GenBank Accession No. U84146), Mexico (GenBank Accession No. AF168709), and Spain (GenBank Accession No. AF071228). Symptomatic plants appeared to be infected with an isolate of TYLCV that is most similar to TYLCV isolates reported from Florida and the northeastern Caribbean. To our knowledge, this is the first report of TYLCV in North Carolina. TYLCV may have been introduced on transplants since the infected plants showed symptoms at an early growth stage. The appearance of infected plants in clusters of limited size suggests no spread or very limited spread in the field. Reports of populations of the whitefly (Bemisia tabaci) vector in the field were not available since whiteflies are not normally a problem in this area due to the higher altitude and relatively cool temperatures characteristic of Henderson County. It is not clear at this time what threat TYLCV poses to tomato production in the county, though its appearance indicates that the geographic range of TYLCV is continuing to expand in the southeastern United States. References: (1) M. Ghanim et al. Virology 240:295, 1998. (2) M. K. Nakhla et al. Phytopathol. Mediterr. 32:163, 1993. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993. (4) S. D. Wyatt et al. Phytopathology 86:1288, 1996.

Polyclonal rabbit antisera were produced to the coat protein of Bean golden mosaic virus Brazil isolate (BGMV), Cabbage leaf curl virus (CabLCV), Tomato yellow leaf curl virus (TYLCV), and Tomato mottle virus (ToMoV), all expressed in Escherichia coli by the pETh expression vector. The expressed coat protein of each virus was purified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis for use as an immunogen. The antisera to BGMV, CabLCV, TYLCV, and ToMoV reacted in indirect (plate-trapping) enzyme-linked immunosorbent assay (ELISA) with extracts from begomovirus-infected tissue. The antisera to BGMV, CabLCV, TYLCV, and ToMoV also reacted specifically with the test begomovirus antigens in leaf imprint blots and Western blots. The CabLCV and TYLCV antisera were used to detect Bean golden yellow mosaic virus antigens by immunogold labeling of thin sections of infected bean tissues. In tissue blot immunoassays, the TYLCV antiserum reacted well with TYLCV antigens but not with ToMoV antigens, while CabLCV antiserum reacted well with ToMoV antigens and weakly with TYLCV antigens. The results indicate that polyclonal antisera prepared to expressed begomovirus coat proteins were useful for the detection of begomoviruses in an array of assays.

During December 2003, symptoms were observed in greenhouse tomato plants in Bet Dagan, Israel that resembled those of Tomato chlorosis virus (ToCV), a crinivirus common in the southeastern United States and southern Europe (2,3). Middle-aged leaves showed interveinal chlorosis, while more mature leaves showed more intense interveinal chlorosis with some interveinal bronzing. Symptoms were associated with the presence of Bemisia tabaci, an efficient vector of ToCV. Total nucleic acids were extracted (1) from middle-aged and mature leaves from two symptomatic plants, as well as from healthy tomato, Physalis wrightii infected with ToCV, and Nicotiana benthamiana infected with Tomato infectious chlorosis virus (TICV), another crinivirus that produces identical symptoms on tomato. Extracts were tested using hybridization with probes specific to the coat protein (CP) gene of ToCV and the HSP70h gene of TICV. Hybridization results identified the presence of ToCV in all samples from symptomatic tomato plants and ToCV-infected P. wrightii, but not in those from healthy tomato or TICV-infected N. benthamiana. TICV was only detected in TICV-infected N. benthamiana. Extracts were also subjected to reverse transcription-polymerase chain reaction using primers specific to the CP gene of ToCV (GenBank Accession No. AY444872; Forward primer: 5′ ATGGAGAACAGT GCCGTTGC 3′; Reverse Primer: 5′ TTAGCAACCAGTTATCGATGC 3′). All samples from symptomatic tomato and ToCV-infected P. wrightii produced amplicons of the expected size, but no amplicons were produced from extracts of healthy tomato. Laboratory results and observed symptoms confirm the presence of ToCV in symptomatic tomatoes. To our knowledge, this is the first report of ToCV in Israel. References: (1) S. Dellaporta et al. Plant Mol. Biol. Rep. 1:19, 1983. (2) J. Navas-Castillo et al. Plant Dis. 84:835, 2000. (3) G. C. Wisler et al. Phytopathology 88:402, 1998.

Tomato yellow leaf curl virus (TYLCV), a begomovirus in the family Geminiviridae, causes yield losses in tomato (Lycopersicon esculentum Mill.) around the world. During 2005, tomato plants exhibiting TYLCV symptoms were found in several locations in the Charleston, SC area. These locations included a whitefly research greenhouse at the United States Vegetable Laboratory, two commercial tomato fields, and various garden centers. Symptoms included stunting, mottling, and yellowing of leaves. Utilizing the polymerase chain reaction (PCR) and begomovirus degenerate primer set prV324 and prC889 (1), the expected 579-bp amplification product was generated from DNA isolated from symptomatic tomato leaves. Another primer set (KL04-06_TYLCV CP F: 5′GCCGCCG AATTCAAGCTTACTATGTCGAAG; KL04-07_TYLCV CP R: 5′GCCG CCCTTAAGTTCGAAACTCATGATATA), homologous to the Florida isolate of TYLCV (GenBank Accession No. AY530931) was designed to amplify a sequence that contains the entire coat protein gene. These primers amplified the expected 842-bp PCR product from DNA isolated from symptomatic tomato tissues as well as viruliferous whitefly (Bemisia tabaci) adults. Expected PCR products were obtained from eight different samples, including three tomato samples from the greenhouse, two tomato plants from commercial fields, two plants from retail stores, and a sample of 50 whiteflies fed on symptomatic plants. For each primer combination, three PCR products amplified from DNA from symptomatic tomato plants after insect transmission were sequenced and analyzed. All sequences were identical and generated 806 nucleotides after primer sequence trimming (GenBank Accession No. DQ139329). This sequence had 99% nucleotide identity with TYLCV isolates from Florida, the Dominican Republic, Cuba, Guadeloupe, and Puerto Rico. In greenhouse tests with a total of 129 plants in two separate experiments, 100% of the tomato plants became symptomatic as early as 10 days after exposure to whiteflies previously fed on symptomatic plants. A low incidence ( Reference: (1) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

Tomato yellow leaf curl disease caused by the whitefly-transmitted begomovirus (genus Begomovirus, family Geminiviridae) Tomato yellow leaf curl virus (TYLCV) is one of the most damaging diseases of tomato. TYLCV was introduced into the New World in the early 1990s and by the late 1990s, it was found in Florida (2). In 2005 and 2006, the virus was reported from northern Mexico (states of Sinaloa and Tamaulipas) (1) and subsequently from Texas and Arizona. In March 2007, tomato (Lycopersicon esculentum) plants growing in a greenhouse in Brawley, CA showed TYLCV-like symptoms including stunted upright growth, shortened internodes, and small upcurled leaves with crumpling and strong interveinal and marginal chlorosis. These plants also sustained high populations of whiteflies. Symptomatic tomato leaves and associated whiteflies were collected from inside the greenhouse. Leaf samples also were collected from symptomless weeds (cheeseweed [Malva parviflora] and dandelion [Taraxacum officinale]) outside of the greenhouse. Total nucleic acids were extracted from 41 symptomatic tomato leaf samples, seven samples of adult whiteflies (approximately 50 per sample), and six leaf samples each from cheeseweed and dandelion. PCR analyses were performed with the degenerate begomovirus primers PAL1v1978 and PAR1c496 (3) and a TYLCV capsid protein (CP) primer pair (4). The expected size of approximately 1.4-kbp and 300-bp DNA fragments, respectively, were amplified from extracts of all 41 symptomatic tomato leaves and adult whitefly samples; whereas the 300-bp DNA fragment was amplified from all six cheeseweed samples and four of the six dandelion samples. Sequence analysis of a portion of the AC1/C1 gene from the approximately 1.4-kbp fragment amplified from 12 tomato leaf samples and four whiteflies samples revealed 99 to 100% identity with the homologous sequence of TYLCV from Israel (GenBank Accession No. X15656). The putative genome of the California TYLCV isolate was amplified using PCR and an overlapping primer pair (TYBamHIv: 5′-GGATCCACTTCTAAATGAATTTCCTG-3′ and TYBamHI2c: 5′-GGATCCCACATAGTGCAAGACAAAC-3′), cloned and sequenced. The viral genome was 2,781 nt (GenBank Accession No. EF539831), and sequence analysis confirmed it was a bona fide isolate of TYLCV. The California TYLCV sequence is virtually identical (99.7% total nucleotide and 100% CP amino acid sequence identity) to a TYLCV isolate from Sinaloa, Mexico (GenBank Accession No. EF523478) and closely related to isolates from China (AM282874), Cuba (AJ223505), Dominican Republic (AF024715), Egypt (AY594174), Florida (AY530931), Japan (AB192966), and Mexico (DQ631892) (sequence identities of 98.2 to 99.7%). Together, these results establish that TYLCV was introduced to California, probably from Mexico. Because the tomatoes in this greenhouse were grown from seed, and symptoms did not appear until after initial fruit set, the virus was probably introduced via viruliferous whiteflies. To our knowledge, this is the first report of TYLCV infecting tomato plants in California. References: (1) J. K. Brown and A. M. Idris. Plant Dis. 90:1360, 2006. (2) J. E. Polston et al. Plant Dis. 83:984, 1999. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993. (4) R. Salati et al. Phytopathology 92:487, 2002.

Virus-like symptoms of leaf deformation and rugosity, especially of younger leaves, and a mild mosaic were observed on fresh market common (green) bean (Phaseolus vulgaris L.) plants in Hendry County in southwest Florida in December of 2007 and again in February of 2008. All bean fields were adjacent to watermelon fields in which Cucurbit leaf crumple virus (CuLCrV), Squash vein yellowing virus (SqVYV), and Papaya ringspot virus type W (PRSV-W) infections had previously been confirmed (fall of 2007) by PCR, reverse transcription (RT)-PCR, and/or ELISA. Whiteflies, Bemisia tabaci, were observed on both bean and watermelon plants in December and February. Fifteen samples (eleven with symptoms) were collected in December and two (both with symptoms) in February. Initial ELISA assays using commercially available antisera for potyviruses or Cucumber mosaic virus (Agdia, Elkhart, IN) were negative. Total nucleic acids were extracted and used for PCR testing. All samples tested negative by RT-PCR using specific primers for SqVYV, PRSV-W, and Cucurbit yellow stunting disorder virus, and degenerate primers for potyviruses. Ten of fifteen December samples (ten of eleven symptomatic samples) and both February samples yielded PCR products of the expected size with the degenerate begomovirus primers, PAR1c496/PAL1v1978, which amplify a portion of the begomovirus A component (3). PCR products from three December and both February samples were cloned and sequenced. The 1,159-nt PCR products shared 99% identity with each other and 96% identity with the corresponding region of A component sequences of Arizona and California CuLCrV isolates (GenBank Accession Nos. AF256200 and AF224760, respectively). Additional degenerate begomovirus primers PBL1v2040/PCRc154, which amplify a 381-nt portion of the hypervariable region of the begomovirus B component (3), and AC1048/AV494, which amplify a 533-nt portion of a conserved region of the coat protein gene (4), were used to confirm the identity of CuLCrV in the three December samples. The PBL1v2040/PCRc154 PCR products shared 98 to 99% identity with each other and 94 to 95% identity with the corresponding region of B component sequences of Arizona and California CuLCrV isolates (GenBank Accession Nos. AF327559 and AF224761, respectively), whereas the AC1048/AV494 PCR products shared 99% identity with each other and 97% identity with the corresponding region of A component sequences of Arizona and California CuLCrV isolates. Nucleic acid dot-blot hybridization assays of sap from homogenized leaves of the three December samples (from which the PCR product clones were obtained) with a digoxigenin-labeled CuLCrV cDNA probe also confirmed the presence of CuLCrV. Although CuLCrV has been reported to experimentally infect common bean and tobacco (2), to our knowledge, this is the first report of CuLCrV infecting any noncucurbit host in Florida. This finding suggests that CuLCrV may be more widely distributed than previously known in Florida (1) and that common bean (and potentially other legumes) are potential reservoirs for CuLCrV. References: (1) F. Akad et al. Plant Dis. 92:648, 2008. (2) J. K. Brown et al. Phytopathology 92:734, 2002. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993. (4) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

Bemisia tabaci has had a colorful nomenclatural past and is now recognized as a species complex. This new species framework has added many new areas of research including adding new insight into the virus transmission specificity of the species in the B. tabaci species complex. There is a wide disparity in what is known about the transmission of plant viruses by different members of the B. tabaci species complex. In this paper, we have synthesized the transmission specificities of the plant viruses transmitted by species belonging to the complex. There are five genera of plant viruses with members that are transmitted by species of the B. tabaci species complex. The transmission of viruses belonging to two of these, Begomovirus and Crinivirus, are well studied and much is known in regards to the relationship between species and transmission and etiology. This is in contrast to viruses of the genera, Torradovirus and Carlavirus, for which very little is known inregards to their transmission. This is the first attempt to integrate viral data within the new B. tabaci species complex framework. It is clear that matching historical transmission data with the current species framework is difficult due to the lack of awareness of the underlying genetic diversity within B. tabaci. We encourage all researchers to determine which species of B. tabaci they are using to facilitate association of phenotypic traits with particular members of the complex. © 2014 Society of Chemical Industry

A syndrome has been recognized on leatherleaf fern (Rumohra adiantiformis) in Costa Rica for many years that causes widespread damage but has not been described in the literature. A full description of the syndrome, termed fern distortion syndrome (FDS), is reported here, along with evidence that FDS is a new disease and that it is associated with endophytic fluorescent pseudomonads but not with any other major groups of pathogens or pests. The main aboveground symptoms of FDS are twisting and distortions of fronds, which make the fronds unmarketable. In advanced cases of FDS, fronds are often thickened, new frond growth ceases or slows dramatically, and uneven sporulation is apparent on the underside of fronds. Symptoms of FDS belowground are reduced diameter of rhizomes and reduced overall root mass. The incidence of FDS in Costa Rica was typically over 80%, and severity typically ranged from 1.26 to 2.48 using a 0 to 3 rating scale in fields propagated vegetatively with rhizomes from fields with FDS. In contrast, in three fields planted 1.5 to 4 years previously with rhizomes derived from tissue culture, incidence and severity were markedly lower: 23 to 34% and 0.24 to 0.36, respectively. Paired sampling of symptomatic and asymptomatic plants revealed significantly greater populations of fluorescent pseudomonads inside rhizomes of symptomatic plants.

The three Andean states of Mérida, Táchira, and Trujillo in Venezuela produce tomatoes (Lycopersicon esculentum) year-round with a high frequency of virus-like symptoms. Polymerase chain reaction amplification using degenerate primers detected begomoviruses in 18% of leaf samples collected from tomato plants showing virus-like symptoms in commercial fields in these states between 1993 and 1994. A comparison of the sequences of the amplified DNA products revealed a diversity of begomovirus sequences in tomato plants from this region. Partial A component sequences (approximately 1,100 bp) clustered in four groups based on BLAST, GAP, phylogenetic analyses of the nucleic acid sequences, and comparisons of iteron sequences with known begomoviruses. Two groups of sequences were closely related to Potato yellow mosaic virus—Venezuela strain tomato and Tomato Venezuela virus, respectively, begomoviruses previously reported from other Venezuelan states. The other two groups of sequences appear to belong to two new begomovirus species.

Yang, Y., Sherwood, T. A., Patte, C. P., Hiebert, E., and Polston, J. E. 2004. Use of Tomato yellow leaf curl virus (TYLCV) Rep gene sequences to engineer TYLCV resistance in tomato. Phytopathology 94:490-496. Tomato yellow leaf curl virus (TYLCV), a member of the genus Begomovirus (family Geminiviridae), causes severe losses in tomato production in the tropics and subtropics. In order to generate engineered resistance, eight different constructs of the TYLCV replication-associated protein (Rep) and C4 gene sequences were tested in transformed tomato inbred lines. Transgenic plants were screened for resistance to TYLCV using viruliferous whiteflies. No symptoms were observed and no TYLCV genomic DNA was detected by both hybridization and polymerase chain reaction in progenies of plants transformed with three constructs. This resistance was observed in plants that contained one of the following transgenes: 2/5Rep (81 nucleotides [nt] of the intergenic region [IR] plus 426 nt of the 5′ end of the TYLCV Rep gene), ∆2/5Rep (85 nt of the IR plus 595 nt of the 5′ end of the TYLCV Rep gene in the antisense orientation), and Rep∆2/5Rep (81 nt of the IR, the entire Rep gene, and 41 nt 3′ to the end of the Rep gene fused to ∆2/5Rep). Our study differs from other transgenic Geminivirus resistance reports involving the Rep gene in that viruliferous whiteflies were used for challenge inoculation instead of agroinoculation or biolistic inoculation, and TYLCV resistance was evaluated under field conditions.

El virus del mosaico dorado amarillo de la habichuela (BGYMV) es un geminivirus transmitido por moscas blancas (Género: Bemisia). Este virus causa pérdidas económicas considerables en la habichuela común (Phaseolus vulgaris L.). Las técnicas serológicas como ELISA, se han utilizado ampliamente en la detección de viruses. Se evaluaron tres anticuerpos monoclonales existentes (3F7, 2G5 y 5C5) en la detección del BGYMV en varias líneas de habichuela en Puerto Rico. El anticuerpo monoclonal 3F7 resultó el más efectivo en detectar el virus en tejidos de habichuela de la línea DOR 364 y los cultivares susceptibles Top Crop y Quest. Sin embargo, no fue efectivo en detectar el virus en la línea DOR 303 aún en presencia de síntomas típicos.También se evaluaron muestras de Macroptilium lathyroides, una maleza que puede ser reservorio del virus. Las pruebas de ELISA resultaron inconclusas en la detección de geminiviruses en M. lathyroides. Se utilizó la reacción en cadena de la poíimerasa (PCR) para complementar el diagnóstico de! BGYMV en M. lathyroides y líneas de habichuela con síntomas de virosis pero negativas a la prueba de ELISA. Se utilizaron tíos pares de iniciadores en las pruebas de PCR, específicos para Begomovirus como el BGYMV. Utilizando PCR fue posible detectar el virus en los tejidos de la línea DOR 303 y en M. lathyroides.

Tomato plants treated with plant growth-promoting rhizobacteria (PGPR), applied as an industrially formulated seed treatment, a spore preparation mixed with potting medium (referred to as powder), or a combined seed-powder treatment, were evaluated under field conditions for induced resistance to Tomato mottle virus (ToMoV). The PGPR strains used, based on their ability to induce resistance in previous experiments, included Bacillus amyloliquefaciens 937a, B. subtilis 937b, and B. pumilus SE34. Experiments were conducted in the fall of 1997 and the spring and fall of 1998 at the University of Florida's Gulf Coast Research & Education Center, Bradenton. All plants were rated for symptoms and analyzed for the presence of ToMoV DNA at 40 days after transplant (dat). Whitefly densities were determined on individual plants in each trial, and marketable fruit yields were determined at least two times during each trial. The highest level of protection occurred in the fall 1997 trial when, at 40 dat, ToMoV disease severity ratings were significantly less in all PGPR powder-based treatments than in either of the seed or control treatments. Detection of viral DNA using Southern dot blot analyses correlated with symptom severity ratings, as did fruit yields. A reduction in ToMoV symptom severity ratings and incidence of viral DNA were also observed for some PGPR treatments in the spring 1998 trial, although corresponding yield responses were not apparent. Little or no resistance was observed in the fall 1998 trial. No differences in disease severity, detection of ToMoV DNA, or yield occurred among treatments in any of the trials at 80 dat. These data show that up to 40 dat under natural conditions of high levels of vector-virus pressure, some PGPR treatments resulted in reduced ToMoV incidence and disease severity and, in some cases, a corresponding increase in fruit yield. The use of PGPR could become a component of an integrated program for management of this virus in tomato.

Polston, J. E., McGovern, R. J., and Brown, L. G. 1999. Introduction of tomato yellow leaf curl virus in Florida and implications for the spread of this and other geminiviruses of tomato. Plant Dis. 83:984-988. In July 1997, symptoms characteristic of tomato yellow leaf curl virus (TYLCV-Is) were observed on one tomato plant in a field in Collier C ounty, Florida, and on several tomato plants in a retail garden center in Sarasota, Florida. Amplification with three sets of primers, analysis of amplified fragments using restriction enzyme digestion, and hybridization with a clone of TYLCV-Is indicated that TYLCV-Is was present in symptomatic plants. The sequence of a 1,300-bp amplified fragment was 99% identical to TYLCV-Is from the Dominican Republic and 98% identical to an isolate from Israel. It appears that TYLCV-Is entered the United States in Dade County, Florida, in late 1996 or early 1997. Subsequently, infected tomato transplants produced for retail sale at two Dade County fac ilities were rapidly distributed via retail garden centers throughout the state. Infected plants purchased by homeowners and pl aced in and around homes appeared to be the source of TYLCV-Is for nearby commercial nurseries and production fields. It appears that transplants have played a role in the movement of this and probably other geminiviruses. A number of regulatory procedures, as well as field management practices, were implemented in the 1997-98 production season to minimize the movement of TYLCV-Is within and out of the state.

Tobacco plants (Nicotiana tabacum ‘Xanthi’) were transformed with a binary vector containing the coat protein gene of tomato mottle begomo-virus (ToMoV) modified by the deletion of 30 nucleotides in the 5′ end. The R1 generation was screened for resistance to ToMoV by inoculation with viruliferous whiteflies. Fifteen days after inoculation, symptom development was recorded weekly for up to 120 days using a visual scale, and ToMoV infection was confirmed by polymerase chain reaction and enzyme-linked immunosorbent assay. The response to high inoculation levels of ToMoV varied and ranged from susceptibility to immunity. The transgene transcript was detected by northern blot analysis; however, the transgene product could not be detected by protein blot analysis using antisera reactive with ToMoV coat protein. The lack of detection of the transgene product in resistant plants suggests that it is not involved in eliciting the resistance response and that resistance may be mediated by the transgene transcript.

Solanum viarum Dunal (tropical soda apple), an introduced and rapidly spreading weed, currently infests over 60 000 ha in Florida. Approximately 220 plants were sampled in seven stands of S. viarum in south‐west and west central Florida during 1992 and 1993 to determine the occurrence of nine viruses which can infect solanaceous crops. Virus detection utilized a double antibody sandwich‐enzyme linked immunosorbent assay, or a nucleic acid spot hybridization assay. The viruses detected included cucumber mosaic virus (CMV), potato leaf roll virus (PLRV), potato virus Y (PVY), tobacco etch virus (TEV), tomato mosaic virus (ToMV), and tomato mottle virus (TMoV). Transmission of PVY and ToMV from S. viarum produced a range of symptoms in pepper, tobacco, and tomato. Isolates of TEV from pepper, and PVY and TMoV from tomato were transmitted to S. viarum. Solanum viarum was also naturally infected in the field by Altemaria solani Sorauer and infested by Colorado potato beetles (Leptinotarsa decenlineata...

Polston, J. E., Cohen, L., Sherwood, T. A., Ben-Joseph, R., and Lapidot, M. 2006. Capsicum species: Symptomless hosts and reservoirs of Tomato yellow leaf curl virus. Phytopathology 96:447-452. Five Capsicum species were tested for susceptibility to Tomato yellow leaf curl virus (TYLCV) and the mild strain of TYLCV (TYLCV-Mld). TYLCV was able to infect 30 of 55 genotypes of C. annuum, one of six genotypes of C. chinense, one of two genotypes of C. baccatum, and the only genotype of C. frutescens tested but was unable to infect the one genotype of C. pubescens tested. This is the first evidence for the susceptibility of C. baccatum, C. chinense, and C. frutescens to TYLCV. Unlike TYLCV isolates, TYLCV-Mld was unable to infect C. chinense. No host differences were observed between the Israeli and Florida isolates of TYLCV. None of the Capsicum species showed symptoms after infection with TYLCV or TYLCV-Mld. TYLCV was detected in fruits of C. annuum, but whiteflies were unable to transmit virus from fruits to plants. Whiteflies were able to transmit both TYLCV and TYLCV-Mld from infected pepper plants to tomato plants. Pepper plants in research plots were found infected with TYLCV at rates as much as 100%. These data demonstrate the ability of some genotypes of pepper to serve as reservoirs for the acquisition and transmission of TYLCV and TYLCV-Mld.

Viruslike symptoms were observed in epidemic proportions in tomato, Lycopersicon esculentum Mill., in Guadeloupe and Martinique each year since 1992 and 1993, respectively, and in Puerto Rico since 1994 (1,3). Many tomato fields in Guadeloupe and Martinique had more than 70% of plants expressing symptoms of chlorotic mottling, leaf distortion, leaf rolling, and stunting in 1995 and 1996. The B biotype of Bemisia tabaci (aka B. argentifolii) was associated with all these epidemics. Ninety-three samples of tomato were collected from multiple locations from each island (65 samples from Guadeloupe, 11 from Martinique, and 17 from Puerto Rico) and assayed for the presence of geminivirus by polymerase chain reaction (PCR) with broad spectrum primers, PAL1v1978 and PAR1c496 for the A component, and PBL1v2040 and PCRc154 for the B component (4). Most samples tested positive for geminivirus (98% from Guadeloupe, 100% from Martinique, and 82% from Puerto Rico). Restriction analyses of amplified A component fragment with SacI, EcoRI, and AluI, and amplified B component fragment with EcoRI, AluI, VspI, PstI, and HaeIII were conducted on 34 samples (25 from Guadeloupe, six from Martinique, and three from Puerto Rico). All samples produced very similar restriction patterns, suggesting that they were infected by the same virus. One to three clones of amplified fragments of A and B components, obtained from one plant sample from each location, were at least 98.7% identical in sequence to each other and were 89.6% and 75.2 to 75.7% identical to equivalent regions in potato yellow mosaic virus (PYMV) A and B DNA, respectively (GenBank accession nos. D00940 and D00941). This isolate of PYMV was collected from potato in Venezuela in 1985 (2). Infectious full-length genomic clones of A and B component DNA from Guadeloupe were derived from the same tissue as the PCR-generated clones, and nucleotide sequences were found to be 99.1 and 99% identical to the PCR-generated fragments of A and B DNA, respectively. Nucleotide sequences of these full-length clones were 92.6 and 89.4% identical to full-length sequences of PYMV A and B DNA, respectively. The DNA sequence identity of the common regions of the A and B components between the Guadeloupe virus and PYMV was 95.1 and 91.6%, respectively. There was a nucleotide identity of 93% in the first 125 nucleotides of the coat protein gene. The virus found in Guadeloupe, Martinique, and Puerto Rico appears to be a strain of PYMV reported from Venezuela. This strain of PYMV is at least partially responsible for the epidemics in tomato in Guadeloupe, Martinique, and Puerto Rico. The similarity among geminivirus sequences at distant locations (Puerto Rico to Martinique is approximately 600 km) is unexpected and could be due to recent introductions. References: (1) J. K. Brown et al. Plant Dis. 79:1250, 1995. (2) R. H. A. Coutts et al. J. Gen. Virol. 72:1515, 1991. (3) B. Hostachy et al. Phytoma 456:24, 1993. (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.

Symptoms of interveinal chlorosis, necrotic flecking, thickening, and rolling of leaves were observed on leaves of field-grown tomato (Lycopersicon esculentum) plants in Jauna Diaz, Puerto Rico. These symptoms are indicative of those produced by the whitefly-transmitted criniviruses, Tomato infectious chlorosis virus (TICV) and Tomato chlorosis virus (ToCV) (1). Samples collected from two symptomatic plants were examined by leaf dip and were found to contain long flexuous rods approximately 800 nm in length, characteristic of criniviruses. Symptomatic leaves were used for extraction of total nucleic acid and for whitefly transmission studies. The greenhouse whitefly, Trialeurodes vaporariorum (Westwood), is a highly efficient vector of TICV, but an inefficient vector of ToCV, whereas the banded wing whitefly, T. abutilonea (Haldeman), is an efficient vector of ToCV but does not transmit TICV (2). Whiteflies of both species were allowed to feed separately on symptomatic tomato leaves for 24 h and then transferred to healthy Physalis wrightii and Nicotiana benthamiana indicator plants. Symptoms characteristic of ToCV infection developed on 3 of 3 P. wrightii plants and 2 of 3 N. benthamiana plants following transmission by T. abutilonea. Only 1 of 3 P. wrightii plants developed such symptoms following transmission by T. vaporariorum, while no N. benthamiana plants developed symptoms, suggesting that the virus responsible for the tomato disease was ToCV. Dot blot hybridizations were performed on total nucleic acids extracted from 0.1 g of symptomatic leaves of field samples using probes specific for TICV or ToCV (2), as well as probes specific for four additional criniviruses. Symptomatic and asymptomatic leaves of plants in transmission tests, as well as comparable leaves from control plants, were also tested by dot blot. Although no criniviruses could be detected by dot blot in the original tomato tissue, these hybridizations identified ToCV in all symptomatic plants from the transmission experiments, confirming the presence of ToCV in Puerto Rico. No additional criniviruses were detected in any samples, and negative controls were virus-free. This is the first time a tomato crinivirus has been detected in the Caribbean, outside of the continental United States. The ability of ToCV to be transmitted by four different whitefly species increases the potential for this virus to spread throughout the Caribbean Basin. References: (1) G. C. Wisler et al. Plant Dis. 82:270, 1998. (2) G. C. Wisler et al. Phytopathology 88:402, 1998.

In December 1996, symptoms of stunting, curling, and marginal chlorosis of leaves, reduced leaf size, and marked reduction in number of fruits were first seen in tomato (Lycopersicon esculentum) plants on the island of North Andros, The Bahamas. Similar symptoms were observed for the first time during fall 1997 in tomatoes on the island of Eleuthera. Incidences of symptomatic plants were as high as 100% in some fields. Leaves from one symptomatic plant from each island were collected during April 1998. DNA was extracted from the samples and tested by polymerase chain reaction (PCR) amplification for the presence of one or more geminiviruses (2). Three sets of primers were used to amplify the extracts: PAL1c496 and PAL1v1978, which amplify an ≈1,100- or ≈1,300-bp DNA product from the A component of a wide range of bipartite and monopartite begomoviruses, respectively; primers PCRc154 and PBL1v2042, which amplify an ≈600-bp DNA fragment from the B component of a wide range of bipartite geminiviruses; and primers PCRc154 and PTYC1v2180 (5′ACTACCATGGCCGC-GCAGCGGAATAC3′), which preferentially amplify Tomato yellow leaf curl virus (TYLCV-Is) (1,2). DNA products of ≈1,300 and ≈780 bp were amplified with PAR1c496 and PAL1v1978 and PCRc154 and PTYC1v2180, respectively, from one sample from each island. No product was obtained from primers PCRc154 and PBL1v2042. The symptoms and PCR results are consistent for the presence of TYLCV. PCR products generated by primers PAL1c496 and PAL1v1978 from each sample were cloned into a pGEM-T Easy Vector (Promega, Madison, WI), and one clone from each was sequenced with vector primers. The sequences of the two 1,300-nt Bahamian clones were identical. The Bahamian clones shared 98.9% sequence homology with equivalent sequences of a TYLCV-Is clone from Florida, 99.2 and 99.4% homology with two TYLCV-Is clones from the Dominican Republic (GenBank Accession no. AF024715, and a full-length infectious clone submitted to GenBank), 98.7% homology with a clone from Cuba (GenBank Accession no. AJ223505), and 98.0% homology with the type sequence from Israel (GenBank Accession no. X15656). A deletion (28 or 29 nt) in the intergenic region was shared by clones from The Bahamas and Florida but was not present in clones from Cuba (AJ223505), the Dominican Republic (AF024715), Egypt (GenBank Accession no. L12219), Israel (X15656), Jamaica (GenBank Accession no. U84146), Lebanon (GenBank Accession no. AF160875), Mexico (GenBank Accession no. AF168709), and Spain (GenBank Accession no. AJ223505). TYLCV-Is appeared in The Bahamas and Florida at almost the same time (1). Because clones from both locations share an unusual deletion, there may be a common source for both introductions. This is the first report of TYLCV-Is in The Bahamas. Reference: (1) J. E. Polston et al. Plant Dis. 83:984, 1999. (2) M. R. Rojas et al. Plant Dis. 77:340, 1993.

Progression of tomato mottle geminivirus (TMoV), and abundance and dispersion of adult whitefly, Bemisia tabaci (Gennadius) B biotype, were monitored in 1992 and 1993 in 91 experimental plots located on 10 commercial tomato farms. Prior to harvest (73 to 75 days post plant) within-row aggregation of tomato mottle-infected plants was detected by means of ordinary runs analysis in only two of 14 plots that exhibited a disease incidence greater than 5%. At harvest (95 to 107 days post plant), within-row aggregation was detected in 11 of 21 plots. Significant clustering of diseased plants occurred in only 7% of plots analyzed with Gray's two-dimensional distance class analysis. The observed pattern of disease in these plots was characterized as having numerous small clusters of symptomatic plants scattered throughout plots prior to harvest. No relationship was observed between disease incidence and the degree of aggregation. Dispersion patterns of adult B. tabaci fluctuated throughout the season with values of the Morisita's index ranging from less than 1 (indicating a uniform dispersion pattern) to greater than 2 (indicating an aggregated pattern). Abundant sources of immigrating viruliferous whitefly vectors, rather than secondary spread within fields, appeared to be the driving force behind epidemics of tomato mottle in this production system characterized by frequent applications of insecticides.

Two monoclonal antibodies prepared to purified virions of bean golden mosaic virus (BGMV) isolates from Guatemala (GA) and the Dominican Republic (DR) and one monoclonal antibody prepared to the coat protein of a BGMV isolate from Brazil (BZ) expressed in Escherichia coli were useful serological probes for detection of whiteflytransmitted geminiviruses. Abutilon mosaic, BGMV isolates from Puerto Rico (PR), and Homestead, Morida (H), BGMV-BZ, -DR, and -GA isolates, euphorbia mosaic, rhynchosia mosaic, squash leaf curl, soybean yellow mosaic, an isolate from Macroptilium lathyroides in Morida, and tomato mottle geminiviruses all reacted efficiently in Western blot and enzyme-linked immunosorbent assay with monoclonal antibody 3F7, indicating that this monoclonal antibody has a broad spectrum of reactivity. Another monoclonal antibody (2G5) reacted only with BGMV-DR, -GA, and -PR isolates. A third monoclonal antibody (5C5) reacted only with BGMV-BZ. A new geminivirus infecting cabbage (Bras-sicaceae) in Florida did not react with any of the three monoclonal antibodies

An epidemic of bean golden mosaic virus (BGMV-H) was observed in the winter of 1993 in South florida. The disease was found in common bean, Phaseolus vulgaris, and lima beans, P lunatus, in southwest Dade County and southeast Palm Beach County. In a survey of 125 fields in Dade County, there was an average disease incidence of 26%, with higher disease incidences in fields of cranberry beans and pole beans than in snap beans. Approximately 3O% of the estimated 11,000 ha planted to snap beans in South florida was affected. In snap bean fields where BGMV-H was most severe, growers reported yields of 26-87 hL/ha compared to expected yields of 115 hL/ha. In some cases, fields were completely abandoned or destroyed. The disease was not detected in the other winter bean production areas in South florida. An isolate of the virus from Homestead (BGMV-H) was mechanically transmissible to P vulgaris cv. Topcrop, and the whitefly Bemisia tabaci (also known as Bemisia argentifolii) was an efficient vector of the virus in transmission tests. Plants with bright golden mosaic symptoms tested positive for geminivirus infection when extracts were probed (dot blots) with A component DNA from a geminivirus infecting the weed Macroptilium lathyroides or from the recently identified tomato mottle geminivirus, both from florida. The bean samples did not react with probes prepared to the B components for either of these viruses. Hybridization probes prepared to A and B components of BGMV-H gave strong reactions with extracts from beans infected with BGMV isolates from Guatemala and from the Dominican Republic. This is the first report of an epidemic of BGMV occurring in the continental United States

Surveys were conducted in southwest and west central Florida to identify naturally occurring weed hosts of the whitefly-transmitted tomato mottle geminivirus (TMoV). More than 780 samples representing 42 species in 14 families were collected from 35 field sites over 3 yr. Detection procedures included nucleic acid spot hybridization assays with confirmation by polymerase chain reaction amplification, Southern blot analysis, and virus inclusion visualization. Experimental transmission of TMoV was also attempted to more than 340 plants representing 20 species in seven families by using whiteflies (Bemisia argentifolii [B. tabaci biotype B])

A geminivirus causing mottling, upward leaf curling, and stunting was observed infecting tomatoes (Lycopersicon esculentum Mill. var. esculentum) throughout production areas of Florida since 1989; and it has been named the tomato mottle virus (TMoV). The virus was inoculated by whiteflies (Bemisia tabaci (Gennadius)) to 41 plant species representing eight families. Species of four genera became infected, three in the Solanaceae (Lycopersicon, Nicotiana, and Physalis) and one in the Fabaceae (Phaseolus)

SUMMARY Samples of soybean plants with virus-like symptoms were collected from several locations in the People's Republic of China in 1981. These samples were used to prepare inocula for mechanical inoculation to soybean. Twenty-one virus cultures were obtained, the identities of which were determined by serology, symptomatology and host range. Sixteen cultures contained only soybean mosaic virus, four of which were more pathogenic than any previously studied; one culture contained only tobacco ringspot virus, another only southern bean mosaic virus, and three other cultures mixed infections of soybean mosaic and southern bean mosaic viruses. This is the first report of the occurrence of tobacco ringspot virus and southern bean mosaic virus in soybean in the People's Republic of China.

Even though much improvement has been made in plant transformation methods, the screening of transgenic plants is often a laborious work. Most approaches for detecting the transgene in transformed plants are still timeconsuming, and can be quite expensive. The objective of this study was to search for a simpler method to screen for transgenic plants. The infiltration of kanamycin (100 mg/mL) into tobacco leaves resulted in conspicuous chlorotic spots on the non-transgenic plant leaves, while no spots were seen on the leaves of transformed plants. This reaction occurred regardless of age of the tested plants, and the method has proven to be simple, fast, non-destructive, relatively cheap, and reliable. These results were comparable to those obtained by the polymerase chain reaction (PCR) amplification of the transgene using specific primers. Apesar do grande desenvolvimento observado na área de transformação de plantas, a avaliação de plantas transgênicas ainda é difícil de ser realizada. Os métodos mais comuns de detecção do transgene em plantas transformadas ainda são demorados e de alto custo. O objetivo deste estudo foi testar um método simples de avaliação de plantas de fumo transgênicas. Para isso, 100 mg/mL de canamicina foi infiltrada em folhas de fumo, resultando no aparecimento de manchas cloróticas nas folhas de plantas não-transgênicas e nenhuma mancha nas folhas de plantas transformadas. Essa reação ocorreu independentemente da idade das plantas testadas e evidenciou a simplicidade, rapidez, confiabilidade e baixo custo do método. Os resultados foram comparáveis aos obtidos por amplificações do transgene, utilizando-se primers específicos, por meio da reação da polimerase em cadeia (PCR).

With a probe composed of four unique full-length DNA geminiviral genome components cloned from squash infected with two variants of squash leaf curl virus (SLCV), viral nucleic acid could be detected in various infected hosts representing nine genera from four plant families. Two biologically different strains could be differentiated with these fragment probes and mixtures of these two strains could be detected in experimentally infected plants