Search

A sudden, unprecedented failure of USP rabbit pyrogen tests for multiple 10% IGIV-C lots prompted a thorough investigation of the root cause for this phenomenon. All microbe-related testing, including Limulus amebocyte lysate test for endotoxin, proved negative, and no deficiencies were discovered in manufacturing. Plasma pool composition analysis revealed that a single plasma donor ("Donor X″) was common to all pyrogenic IGIV-C lots and that as little as one unit of "Donor X″ plasma (in a pool of ∼4500 units) was sufficient to cause IGIV-C lot failure in the USP rabbit pyrogen test. Whole plasma and Protein A-purified IgG from "Donor X″ caused a temperature increase in rabbits; however, all IgG samples tested pyrogen-negative in two in vitro cell-based pyrogen tests. Flow cytometry showed that "Donor X″ IgG bound strongly to rabbit white blood cells (WBC) but minimally to human WBC. Exclusion of "Donor X″ plasma from manufacturing marked the end of IGIV-C lots registering positive in the USP rabbit pyrogen test. This failure of multiple 10% IGIV-C lots to pass the USP rabbit pyrogen test was demonstrated to be due to the highly unusual anti-rabbit-leukocyte specificity of IgG from a single donor.

Hepatocellular carcinoma (HCC) is a fatal cancer with no effective therapy. Astrocyte elevated gene-1 (AEG-1) plays a pivotal role in hepatocarcinogenesis and inhibits retinoic acid-induced gene expression and cell death. The combination of a lentivirus expressing AEG-1 shRNA and all-trans retinoic acid (ATRA) profoundly and synergistically inhibited subcutaneous human HCC xenografts in nude mice. We have now developed liver-targeted nanoplexes by conjugating poly(amidoamine) (PAMAM) dendrimers with polyethylene glycol (PEG) and lactobionic acid (Gal) (PAMAM-PEG-Gal) which were complexed with AEG-1 siRNA (PAMAM-AEG-1si). The polymer conjugate was characterized by (1)H-NMR, MALDI, and mass spectrometry; and optimal nanoplex formulations were characterized for surface charge, size, and morphology. Orthotopic xenografts of human HCC cell QGY-7703 expressing luciferase (QGY-luc) were established in the livers of athymic nude mice and tumor development was monitored by bioluminescence imaging (BLI). Tumor-bearing mice were treated with PAMAM-siCon, PAMAM-siCon+ATRA, PAMAM-AEG-1si, and PAMAM-AEG-1si+ATRA. In the control group the tumor developed aggressively. ATRA showed little effect due to high AEG-1 levels in QGY-luc cells. PAMAM-AEG-1si showed significant reduction in tumor growth, and the combination of PAMAM-AEG-1si+ATRA showed profound and synergistic inhibition so that the tumors were almost undetectable by BLI. A marked decrease in AEG-1 level was observed in tumor samples treated with PAMAM-AEG-1si. The group treated with PAMAM-AEG-1si+ATRA nanoplexes showed increased necrosis, inhibition of proliferation, and increased apoptosis when compared to other groups. Liver is an ideal organ for RNAi therapy and ATRA is an approved anticancer agent. Our exciting observations suggest that the combinatorial approach might be an effective way to combat HCC.

Astrocyte elevated gene-1 (AEG-1) and c-Myc are overexpressed in human hepatocellular carcinoma (HCC) functioning as oncogenes. AEG-1 is transcriptionally regulated by c-Myc, and AEG-1 itself induces c-Myc by activating the Wnt/β-catenin-signaling pathway. We now document the cooperation of AEG-1 and c-Myc in promoting hepatocarcinogenesis by analyzing hepatocyte-specific transgenic mice expressing either AEG-1 (albumin [Alb]/AEG-1), c-Myc (Alb/c-Myc), or both (Alb/AEG-1/c-Myc). Wild-type and Alb/AEG-1 mice did not develop spontaneous HCC. Alb/c-Myc mice developed spontaneous HCC without distant metastasis, whereas Alb/AEG-1/c-Myc mice developed highly aggressive HCC with frank metastasis to the lungs. Induction of carcinogenesis by N-nitrosodiethylamine significantly accelerated the kinetics of tumor formation in all groups. However, in Alb/AEG-1/c-Myc, the effect was markedly pronounced with lung metastasis. In vitro analysis showed that Alb/AEG-1/c-Myc hepatocytes acquired increased proliferation and transformative potential with sustained activation of prosurvival and epithelial-mesenchymal transition-signaling pathways. RNA-sequencing analysis identified a unique gene signature in livers of Alb/AEG-1/c-Myc mice that was not observed when either AEG-1 or c-Myc was overexpressed. Specifically, Alb/AEG-1/c-Myc mice overexpressed maternally imprinted noncoding RNAs (ncRNAs), such as Rian, Meg-3, and Mirg, which are implicated in hepatocarcinogenesis. Knocking down these ncRNAs significantly inhibited proliferation and invasion by Alb/AEG-1/c-Myc hepatocytes.Our studies reveal a novel cooperative oncogenic effect of AEG-1 and c-Myc that might explain the mechanism of aggressive HCC. Alb/AEG-1/c-Myc mice provide a useful model to understand the molecular mechanism of cooperation between these two oncogenes and other molecules involved in hepatocarcinogenesis. This model might also be of use for evaluating novel therapeutic strategies targeting HCC.

Activation of the oncogene AEG-1 (MTDH, LYRIC) has been implicated recently in the development of hepatocellular carcinoma (HCC). In mice, HCC can be initiated by exposure to the carcinogen DEN, which has been shown to rely upon activation of NF-κB in liver macrophages. Because AEG-1 is an essential component of NF-κB activation, we interrogated the susceptibility of mice lacking the AEG-1 gene to DEN-induced hepatocarcinogenesis. AEG-1–deficient mice displayed resistance to DEN-induced HCC and lung metastasis. No difference was observed in the response to growth factor signaling or activation of AKT, ERK, and β-catenin, compared with wild-type control animals. However, AEG-1–deficient hepatocytes and macrophages exhibited a relative defect in NF-κB activation. Mechanistic investigations showed that IL6 production and STAT3 activation, two key mediators of HCC development, were also deficient along with other biologic and epigenetics findings in the tumor microenvironment, confirming that AEG-1 supports an NF-κB–mediated inflammatory state that drives HCC development. Overall, our findings offer in vivo proofs that AEG-1 is essential for NF-κB activation and hepatocarcinogenesis, and they reveal new roles for AEG-1 in shaping the tumor microenvironment for HCC development. Cancer Res; 74(21); 6184–93. ©2014 AACR.

Retinoid X receptor (RXR) regulates key cellular responses such as cell growth and development, and this regulation is frequently perturbed in various malignancies, including hepatocellular carcinoma (HCC). However, the molecule(s) that physically govern this deregulation are mostly unknown. Here, we identified RXR as an interacting partner of astrocyte-elevated gene-1 (AEG-1)/metadherin (MTDH), an oncogene upregulated in all cancers. Upon interaction, AEG-1 profoundly inhibited RXR/retinoic acid receptor (RAR)–mediated transcriptional activation. Consequently, AEG-1 markedly protected HCC and acute myelogenous leukemia (AML) cells from retinoid- and rexinoid-induced cell death. In nontumorigenic cells and primary hepatocytes, AEG-1/RXR colocalizes in the nucleus in which AEG-1 interferes with recruitment of transcriptional coactivators to RXR, preventing transcription of target genes. In tumor cells and AEG-1 transgenic hepatocytes, overexpressed AEG-1 entraps RXR in cytoplasm, precluding its nuclear translocation. In addition, ERK, activated by AEG-1, phosphorylates RXR that leads to its functional inactivation and attenuation of ligand-dependent transactivation. In nude mice models, combination of all-trans retinoic acid (ATRA) and AEG-1 knockdown synergistically inhibited growth of human HCC xenografts. The present study establishes AEG-1 as a novel homeostatic regulator of RXR and RXR/RAR that might contribute to hepatocarcinogenesis. Targeting AEG-1 could sensitize patients with HCC and AML to retinoid- and rexinoid-based therapeutics. Cancer Res; 74(16); 4364–77. ©2014 AACR.

LifeAct-GFP, a fluorescent reporter for actin filaments, is used to uncover the dynamics of actin cytoskeleton remodeling in real time during TGF-β–induced EMT. Efficient actin filament remodeling and complete transition to a mesenchymal phenotype depend on an increase in expression of the ERM protein moesin., Remodeling of actin filaments is necessary for epithelial–mesenchymal transition (EMT); however, understanding of how this is regulated in real time is limited. We used an actin filament reporter and high-resolution live-cell imaging to analyze the regulated dynamics of actin filaments during transforming growth factor-β–induced EMT of mammary epithelial cells. Progressive changes in cell morphology were accompanied by reorganization of actin filaments from thin cortical bundles in epithelial cells to thick, parallel, contractile bundles that disassembled more slowly but remained dynamic in transdifferentiated cells. We show that efficient actin filament remodeling during EMT depends on increased expression of the ezrin/radixin/moesin (ERM) protein moesin. Cells suppressed for moesin expression by short hairpin RNA had fewer, thinner, and less stable actin bundles, incomplete morphological transition, and decreased invasive capacity. These cells also had less α-smooth muscle actin and phosphorylated myosin light chain in cortical patches, decreased abundance of the adhesion receptor CD44 at membrane protrusions, and attenuated autophosphorylation of focal adhesion kinase. Our findings suggest that increased moesin expression promotes EMT by regulating adhesion and contractile elements for changes in actin filament organization. We propose that the transciptional program driving EMT controls progressive remodeling of actin filament architectures.

Actin filament binding by the focal adhesion (FA)-associated protein talin stabilizes cell-substrate adhesions and is thought to be rate-limiting in cell migration. Although F-actin binding by talin is known to be pH-sensitive in vitro , with lower affinity at higher pH, the functional significance of this pH dependence is unknown. Because increased intracellular pH (pH i ) promotes cell migration and is a hallmark of metastatic carcinomas, we asked whether it increases FA remodeling through lower-affinity talin–actin binding. Talin contains several actin binding sites, but we found that only the COOH-terminal USH-I/LWEQ module showed pH-dependent actin binding, with lower affinity and decreased maximal binding at higher pH. Molecular dynamics simulations and NMR of this module revealed a structural mechanism for pH-dependent actin binding. A cluster of titratable amino acids with upshifted pK a values, including His-2418, was identified at one end of the five-helix bundle distal from the actin binding site. Protonation of His-2418 induces changes in the conformation and dynamics of the remote actin binding site. Structural analyses of a mutant talin-H2418F at pH 6.0 and 8.0 suggested changes different from the WT protein, and we confirmed that actin binding by talin-H2418F was relatively pH-insensitive. In motile fibroblasts, increasing pH i decreased FA lifetime and increased the migratory rate. However, expression of talin-H2418F increased lifetime 2-fold and decreased the migratory rate. These data identify a molecular mechanism for pH-sensitive actin binding by talin and suggest that FA turnover is pH-dependent and in part mediated by pH-dependent affinity of talin for binding actin.

Non-thyroidal illness syndrome (NTIS), characterized by low serum 3,5,3'-triiodothyronine (T3) with normal l-thyroxine (T4) levels, is associated with malignancy. Decreased activity of type I 5'-deiodinase (DIO1), which converts T4 to T3, contributes to NTIS. T3 binds to thyroid hormone receptor, which heterodimerizes with retinoid X receptor (RXR) and regulates transcription of target genes, such as DIO1. NF-κB activation by inflammatory cytokines inhibits DIO1 expression. The oncogene astrocyte elevated gene-1 (AEG-1) inhibits RXR-dependent transcription and activates NF-κB. Here, we interrogated the role of AEG-1 in NTIS in the context of hepatocellular carcinoma (HCC). T3-mediated gene regulation was analyzed in human HCC cells, with overexpression or knockdown of AEG-1, and primary hepatocytes from AEG-1 transgenic (Alb/AEG-1) and AEG-1 knock-out (AEG-1KO) mice. Serum T3 and T4 levels were checked in Alb/AEG-1 mice and human HCC patients. AEG-1 and DIO1 levels in human HCC samples were analyzed by immunohistochemistry. AEG-1 inhibited T3-mediated gene regulation in human HCC cells and mouse hepatocytes. AEG-1 overexpression repressed and AEG-1 knockdown induced DIO1 expression. An inverse correlation was observed between AEG-1 and DIO1 levels in human HCC patients. Low T3 with normal T4 was observed in the sera of HCC patients and Alb/AEG-1 mice. Inhibition of co-activator recruitment to RXR and activation of NF-κB were identified to play a role in AEG-1-mediated down-regulation of DIO1. AEG-1 thus might play a role in NTIS associated with HCC and other cancers.

Astrocyte elevated gene-1 (AEG-1), also known as MTDH (metadherin) or LYRIC, is an established oncogene. However, the physiological function of AEG-1 is not known. To address this question, we generated an AEG-1 knock-out mouse (AEG-1KO) and characterized it. Although AEG-1KO mice were viable and fertile, they were significantly leaner with prominently less body fat and lived significantly longer compared with wild type (WT). When fed a high fat and cholesterol diet (HFD), WT mice rapidly gained weight, whereas AEG-1KO mice did not gain weight at all. This phenotype of AEG-1KO mice is due to decreased fat absorption from the intestines, not because of decreased fat synthesis or increased fat consumption. AEG-1 interacts with retinoid X receptor (RXR) and inhibits RXR function. In enterocytes of AEG-1KO mice, we observed increased activity of RXR heterodimer partners, liver X receptor and peroxisome proliferator-activated receptor-α, key inhibitors of intestinal fat absorption. Inhibition of fat absorption in AEG-1KO mice was further augmented when fed an HFD providing ligands to liver X receptor and peroxisome proliferator-activated receptor-α. Our studies reveal a novel role of AEG-1 in regulating nuclear receptors controlling lipid metabolism. AEG-1 may significantly modulate the effects of HFD and thereby function as a unique determinant of obesity.

Protooncogene c-kit receptor is implicated with spermatogenesis, melanogenesis, and hematopoeisis, and undergoes tissue/stage specific alternate splicing. We have isolated 2973-bp full-length cDNA sequence (CDS) of this gene from testis and other tissues of water buffalo Bubalus bubalis. Upon comparison, the c-kit sequences showed tissue specific nucleotide changes resulting in novel truncated peptides. These peptides lacked intracellular and/or transmembrane domains in all the tissues except testis. Other alternately spliced tissue-specific transcripts were also detected, which are the integral parts of the open reading frame and have been reported in other mammals. Phylogenetic analysis of the sequences revealed unique tyrosine kinase domain in buffalo. Copy number calculation and expressional analysis of c-kit using real-time PCR established its single copy status and highest expression (137-177 folds) in testis compared to that (least) in liver. c-kit expression was detected in semen samples although 10 times lesser compared to that in testis. The highest expression of c-kit in testis and the presence of mRNA transcript in sperms substantiate its predominant role in spermatogenesis. This study establishes unequivocal involvement of an autosomal gene c-kit receptor in testicular function.

Higher eukaryotes contain a wide variety of repetitive DNA, although their functions often remain unknown. We describe cloning, chromosomal localization, copy number assessment, and transcriptional status of 1378- and 673-bp repeat fractions in the buffalo genome. The pDS5, representing the 1378-bp fragment, showed FISH signals in the centromeric region of acrocentric chromosomes only, whereas pDS4, corresponding to 673 bp, detected signals in the centromeric regions of all the chromosomes. Crosshybridization studies of pDS5 and pDS4 with genomic DNA from different sources showed signals only in buffalo, cattle, goat, and sheep. Real-time PCR analysis uncovered 1234 and 3420 copies of pDS5 and pDS4 fragments per the haploid genome, corresponding to 30 and 68 copies per chromosome, respectively. Analysis of cDNA from different tissues of buffalo with Real-time PCR showed maximum expression of pDS5 and pDS4 in the spleen and liver, respectively. Phylogenetic analysis of these sequences showed a close relationship between buffalo and cattle. The prospect of this approach in comparative genomics is highlighted.

The protein phosphatases PP1(c), PP2A(c) and PP2Calpha are shown to dephosphorylate protein kinase Cdelta (PKCdelta) in vitro; of these PP2A(c) displayed the highest specific activity towards PKCdelta. The role of PP2A(c) in the dephosphorylation of PKCdelta in cells was supported by the demonstration that these proteins could be co-immunoprecipitated from NIH3T3 cells. However the observation that binding of Mg-ATP to PKCdelta could protect the enzyme from dephosphorylation by PP2A(c) in vitro indicates that an additional input/factor is required for dephosphorylation in vivo.

Minisatellites have been implicated with chromatin organization and gene regulation, but mRNA transcripts tagged with these elements have not been systematically characterized. The aim of the present study was to gain an insight into the transcribing genes associated with consensus of 33.6 repeat loci across the tissues in water buffalo, Bubalus bubalis. Using cDNA from spermatozoa and eight different somatic tissues and an oligo primer based on two units of consensus of 33.6 repeat loci (5′ CCTCCAGCCCTCCTCCAGCCCT 3′), we conducted minisatellite-associated sequence amplification (MASA) and identified 29 mRNA transcripts. These transcripts were cloned and sequenced. Blast search of the individual mRNA transcript revealed sequence homologies with various transcribing genes and contigs in the database. Using real-time PCR, we detected the highest expression of nine mRNA transcripts in spermatozoa and one each in liver and lung. Further, 21 transcripts were found to be conserved across the species; seven were specific to bovid whereas one was exclusive to the buffalo genome. The present work demonstrates innate potentials of MASA in accessing several functional genes simultaneously without screening the cDNA library. This approach may be exploited for the development of tissue-specific mRNA fingerprints in the context of genome analysis and functional and comparative genomics.

Background Transcriptionally quiescent spermatozoa have been established to be a repository of mRNA coding for several functionally essential cellular proteins. This entourage of mRNA is envisaged to be involved in post-fertilization and early embryogenesis. Minisatellites tagged with mRNA transcripts have been implicated with gene organization, regulation and function. However, the organization and expression of the minisatellite tagged transcript diversity, particularly in spermatozoa, remains unclear. Results In the present study, we identified and characterized 12 mRNA transcripts from the spermatozoa of water buffalo Bubalus bubalis employing minisatellite associated sequence amplification (MASA) and a consensus sequence of 33.15 repeat loci. Of these 33.15 tagged transcripts, only one was found to be homologous to Bovine steroid 21-hydroxylase (P-450-c21) gene. Other ten transcripts showed significant similarity with various mRNAs or chromosomal contigs across the species. The remaining one construed to be novel since this was unreported in the database (NCBI GenBank). All these uncharacterized and known transcripts showed highest expression in testis and spermatozoa compared to that in somatic tissues and ovary. Of these 12 mRNA transcripts, 4 showed differential expression in the forebrain and hindbrain of buffalo. Moreover, genes corresponding to all the 33.15 tagged spermatozoal transcripts were found to be conserved across 13 other species analyzed. Conclusion Our results show MASA as an important tool to capture mRNA transcript diversity tagged with minisatellites in the spermatozoa. Comprehensive characterization of these transcripts is envisaged to augment our understanding on the genes involved in testicular functions and sustenance of a viable paternal genome during pre- and post- fertilization events and early stages of development. Prospects of this approach in genome analysis in general and comparative genomics in particular are highlighted.

Background Simple sequence repeats (SSRs) of GACA/GATA have been implicated with differentiation of sex-chromosomes and speciation. However, the organization of these repeats within genomes and transcriptomes, even in the best characterized organisms including human, remains unclear. The main objective of this study was to explore the buffalo transcriptome for its association with GACA/GATA repeats, and study the structural organization and differential expression of the GACA/GATA repeat tagged transcripts. Moreover, the distribution of GACA and GATA repeats in the prokaryotic and eukaryotic genomes was studied to highlight their significance in genome evolution. Results We explored several genomes and transcriptomes, and observed total absence of these repeats in the prokaryotes, with their gradual accumulation in higher eukaryotes. Further, employing novel microsatellite associated sequence amplification (MASA) approach using varying length oligos based on GACA and GATA repeats; we identified and characterized 44 types of known and novel mRNA transcripts tagged with these repeats from different somatic tissues, gonads and spermatozoa of water buffalo Bubalus bubalis. GACA was found to be associated with higher number of transcripts compared to that with GATA. Exclusive presence of several GACA-tagged transcripts in a tissue or spermatozoa, and absence of the GATA-tagged ones in lung/heart highlights their tissue-specific significance. Of all the GACA/GATA tagged transcripts, ~30% demonstrated inter-tissue and/or tissue-spermatozoal sequence polymorphisms. Significantly, ~60% of the GACA-tagged and all the GATA-tagged transcripts showed highest or unique expression in the testis and/or spermatozoa. Moreover, ~75% GACA-tagged and all the GATA-tagged transcripts were found to be conserved across the species. Conclusion Present study is a pioneer attempt exploring GACA/GATA tagged transcriptome in any mammalian species highlighting their tissue, stage and species-specific expression profiles. Comparative analysis suggests the gradual accumulation of these repeats in the higher eukaryotes, and establishes the GACA richness of the buffalo transcriptome. This is envisaged to establish the roles of integral simple sequence repeats and tagged transcripts in gene expression or regulation.

Background Secreted modular calcium binding protein-1 (Smoc-1) belongs to the BM-40 family which has been implicated with tissue remodeling, angiogenesis and bone mineralization. Besides its anticipated role in embryogenesis, Smoc-1 has been characterized only in a few mammalian species. We made use of the consensus sequence (5' CACCTCTCCACCTGCC 3') of 33.15 repeat loci to explore the buffalo transcriptome and uncovered the Smoc-1 transcript tagged with this repeat. The main objective of this study was to gain an insight into its structural and functional organization, and expressional status of Smoc-1 in water buffalo, Bubalus bubalis. Results We cloned and characterized the buffalo Smoc-1, including its copy number status, in-vitro protein expression, tissue & age specific transcription/translation, chromosomal mapping and localization to the basement membrane zone. Buffalo Smoc-1 was found to encode a secreted matricellular glycoprotein containing two EF-hand calcium binding motifs homologous to that of BM-40/SPARC family. In buffalo, this single copy gene consisted of 12 exons and was mapped onto the acrocentric chromosome 11. Though this gene was found to be evolutionarily conserved, the buffalo Smoc-1 showed conspicuous nucleotide/amino acid changes altering its secondary structure compared to that in other mammals. In silico analysis of the Smoc-1 proposed its glycoprotein nature with a calcium dependent conformation. Further, we unveiled two transcript variants of this gene, varying in their 3'UTR lengths but both coding for identical protein(s). Smoc-1 evinced highest expression of both the variants in liver and modest to negligible in other tissues. The relative expression of variant-02 was markedly higher compared to that of variant-01 in all the tissues examined. Moreover, expression of Smoc-1, though modest during the early ages, was conspicuously enhanced after 1 year and remained consistently higher during the entire life span of buffalo with gradual increment in expression of variant-02. Immunohistochemically, Smoc-1 was localized in the basement membrane zones and extracellular matrices of various tissues. Conclusion These data added to our understandings about the tissue, age and species specific functions of the Smoc-1. It also enabled us to demonstrate varying expression of the two transcript variants of Smoc-1 amongst different somatic tissues/gonads and ages, in spite of their identical coding frames. Pursuance of these variants for their roles in various disease phenotypes such as hepatocellular carcinoma and angiogenesis is envisaged to establish broader biological significance of this gene.

Changes in intracellular pH regulate many cell behaviors, including proliferation, migration, and transformation. However, our understanding of how physiological changes in pH affect protein conformations and macromolecular assemblies is limited. We present design principles, current modeling predictions, and examples of pH sensors or proteins that have activities or ligand-binding affinities that are regulated by changes in intracellular pH.

The mammalian Ste20-like Nck-interacting kinase (NIK) and its orthologs Misshapen in Drosophila and Mig-15 in Caenorhabditis elegans have a conserved function in regulating cell morphology, although through poorly understood mechanisms. We report two previously unrecognized actions of NIK: regulation of lamellipodium formation by growth factors and phosphorylation of the ERM proteins ezrin, radixin, and moesin. ERM proteins regulate cell morphology and plasma membrane dynamics by reversibly anchoring actin filaments to integral plasma membrane proteins. In vitro assays show that NIK interacts directly with ERM proteins, binding their N termini and phosphorylating a conserved C-terminal threonine. In cells, NIK and phosphorylated ERM proteins localize at the distal margins of lamellipodia, and NIK activity is necessary for phosphorylation of ERM proteins induced by EGF and PDGF, but not by thrombin. Lamellipodium extension in response to growth factors is inhibited in cells expressing a kinase-inactive NIK, suppressed for NIK expression with siRNA oligonucleotides, or expressing ezrin T567A that cannot be phosphorylated. These data suggest that direct phosphorylation of ERM proteins by NIK constitutes a signaling mechanism controlling growth factor-induced membrane protrusion and cell morphology.

We conducted minisatellite-associated sequence amplification (MASA) with an oligo (5' CACCTCTCCACCTGCC 3') based on consensus of 33.15 repeat loci using cDNA from the testis, ovary, spleen, kidney, heart, liver, and lung of water buffalo Bubalus bubalis and uncovered 25 amplicons of six different sizes (1,263, 846/847, 602, 576, 487, and 324 base pairs). These fragments, cloned and sequenced, were found to represent several functional, regulatory, and structural genes. Blast search of all the 25 amplicons showed homologies with 43 transcribing genes across the species. Of these, the 846/847-bp fragment, having homology with the adenylate kinase gene, showed nucleotide changes at six identical places in the ovary and testis. The 1,263; 324; and 487-bp fragments showed homology with the secreted modular calcium binding protein (SMOC-1), leucine-rich repeat neuronal 6A (LRRN6A) mRNA, and human TTTY5 mRNA, respectively. Real-time PCR showed maximum expression of AKL, LRRN6A, and T-cell receptor gamma (TCR-gamma)-like genes in the testis, SMOC-1 in the liver, and the T-cell receptor-like (TCRL) gene in the spleen compared to those used as endogenous control. We construe that these genes have evolved from a common progenitor and conformed to various biological functions during the course of evolution. MASA approach coupled with real-time PCR has potentials to uncover accurate expression of a large number of genes within and across the species circumventing the screening of cDNA library.

Classical and novel protein kinase C (PKC) isoforms are down-regulated as a result of chronic activation by certain tumour promoters and physiological stimuli; however, the mechanisms leading to down-regulation are not fully understood. In the present study, we have studied the PMA ('TPA')-induced degradation of PKCΔ in NIH 3T3 cells under culture conditions where PKCΔ displays cell-cycle-dependent down-regulation. In contrast with previous studies, a hyperphosphorylated form of this PKC isoform, promoted by calyculin A, was rapidly degraded in PMA-treated cells. Similarly, the presence of calyculin A enhanced the down-regulation of PKCΔ observed on G1/S-phase progression through the cell cycle. Analysis of phosphorylation-site mutants indicated that the T-loop Thr505 phosphorylation site was critical for induced degradation.

The aim of this work was to determine the role of the ob gene in the obese phenotype observed in the Aston University Strain of ob/ob mouse and the Japanese Kuo Kondo (KK) mouse. After RT-PCR amplification of the ob RNA, the transcript was cloned into the vector pCR3 and three individual clones from each strain were sequenced. It was confirmed that the Aston University strain of ob/ob mice shared the same C-T mutation found in the Jackson Laboratory C57BL/6J ob/ob strain whereas the Japanese KK mice showed wild-type ob gene expression. This study indicates that the ob mutation has survived unchanged following the separation of the two strains of ob/ob mice, and secondly, that the molecular basis of the obese phenotype in the KK mice is not due to mutations in the ob gene.

The dithiol-reactive reagent phenylarsine oxide causes a pH-dependent stimulation of unidirectional K+ flux into respiring rat liver mitochondria. This stimulation is diminished by subsequent addition of either the dithiol 2,3-dimercaptopropanol or the monothiol 2-mercaptoethanol. In contrast, uncoupling by phenylarsine oxide is reversed by 2,3-dimercaptopropanol but not by 2-mercaptoethanol. The data suggest separate sites of interaction of phenylarsine oxide with mechanisms of K+ entry and ATP synthesis. Stimulatory effects of mersalyl and phenylarsine oxide on K+ influx are not additive. Thus PheASO and mersalyl may affect K+ influx at a common site. Pretreatment of the mitochondria with DCCD, which inhibits K+ influx, fails to alter sensitivity to PheAsO or mersalyl. Thus the DCCD binding site associated with the K+ influx mechanism appears to be separate from and independent of the sulfhydryl group(s) which mediate stimulation of K+ influx by PheAsO and mersalyl. PheAsO, like mersalyl, also increases the rate of unidirectional K+ efflux from respiring mitochondria. The combined presence of PheAsO plus mersalyl causes a greater stimulation of K+ efflux than is observed with either reagent alone.