Search

Sugar is appreciated to function as a signaling molecule by controlling gene expression, thereby regulating various developmental processes in plants. We screened sucrose-insensitive (sin) mutants in Arabidopsis that showed normal germination and seedling development under high concentration (438 mM) of sucrose. Compared to wild-type and other sugar mutants, sin mutants seedlings exhibited resistance to high glucose, high salt, and paclobutrazol, inhibitor of gibberellin biosynthesis. We discuss the unique characteristics of these sin mutants in this report.

In plants, pyrophosphate: fructose-6-phosphate 1-phosphotransferase (PFP) is a regulatory enzyme that participates in glycolysis and gluconeogenesis. Arabidopsis contains two PFPα subunit genes (PFPα1 and PFPα2) and two PFPβ subunit genes (PFPβ1 and PFPβ2). The single-knockout mutants of the PFP subunit genes were isolated, and double and quadruple pfp mutants were generated by crossing the single mutants. To elucidate the role of PFP in stress tolerance, the responses of the double and quadruple pfp knockout mutants to stress conditions, including osmotic and salt stresses, were examined. The seedling growth of the pfpα1/α2 and pfpβ1/β2 double mutants and the pfpα1/α2/β1/β2 quadruple mutant was severely retarded under salt and osmotic stress conditions compared with that of the wild type. The expression of PFP subunit genes increased in response to salt and osmotic stresses. In contrast, the vegetative growth of the wild type and pfp mutants after the seedling stage was similarly affected by salt and osmotic stresses. These findings suggest that PFP plays a role in the adaptation of Arabidopsis seedlings to salt and osmotic stresses.

Leaf starch synthesized during the day for transient storage of photoassimilated carbon is degraded the following night to support respiration and growth in plants. Maltose is a major product of starch degradation, and is exported to the cytosol through the maltose transporter (MEX1). The Arabidopsis mex1 mutant displays growth retardation and an exceptional chlorotic phenotype that is not observed in other mutants demonstrating defective starch synthesis or degradation. Consistent with the chlorotic phenotype, proteomic analysis revealed degeneration of the photosynthetic machinery in mex1, and the down-regulation of essential components for photosynthesis was also observed. The chlorosis observed in mex1 occurs during vegetative growth period under normal growth conditions, which is distinct from general senescence-induced chlorosis. No up-regulation of senescence-related genes was found in the proteomic analysis of mex1, suggesting that the chlorotic process occurring in mex1 is likely distinct from senescence-dependent processes. On the other hand, cellular processes needed to survive stress situations caused by the blocking of maltose export are induced in mex1 by up-regulation of stress-related proteins, such as a germin-like protein and glutathione S-transferase. The increased abundance of heat shock protein 93-V participating in chloroplast biogenesis and rubisco activase, a regulatory protein of photosynthesis, likely reflects an attempt by the mex1 mutant to maintain chloroplast function to survive stress conditions.

Nascent polypeptide associated complex (NAC) proteins bind to newly synthesized polypeptide chains from ribosome and are involved in various physiological processes. An in vitro pulldown assay demonstrated that the previously identified NAC protein interacts with phytochromes. Phytochrome-interacting NAC protein (PNAC) was expressed in the cytosol, and translocation of the PNAC protein into nucleus by irradiation was not observed. These findings suggest that PNAC is a possible cytosolic partner protein to phytochromes. Histochemical analysis of PNAC promoter-β-glucuronidase (GUS) transgenic plants showed that PNAC expression was increased by light treatment, especially red light, indicating that phytochromes likely modulate PNAC gene expression.

The ankyrin domain is one of the most common protein motifs in eukaryotic proteins. Repeated ankyrin domains are ubiquitous and their mediation of protein-protein interactions is involved in a number of physiological and developmental responses such as the cell cycle, signal transduction and cell differentiation. A novel putative phytochrome-interacting ankyrin repeat protein 2 (PIA2) containing three repeated ankyrin domains was identified in Arabidopsis. An in vitro pull-down and phosphorylation assay revealed that PIA2 is phosphorylated and interacts directly with oat phytochrome A. The N-terminal domain of PIA2 was specifically phosphorylated, whereas interactions between the domains of PIA2 and phytochrome A had no Pr/Pfr preference. PIA2 was ubiquitously expressed in most tissues and was localized in both the nucleus and the cytoplasm independent of treatment with light of specific wavelengths. Anthocyanin accumulation in seedlings grown under far-red light, a typical phenotype of wild-type plants, was reduced in a loss-of-function mutant of PIA2 (pia2), whereas anthocyanin accumulation was increased in an overexpressing plant (PIA2-OX). The gene expression of UDP-flavonoid-3'-glucosyl-transferase (UF3GT), a major enzyme in the anthocyanin biosynthesis processes, was decreased in pia2 knockout plants suggesting that decreased anthocyanin was because of the decreased expression of UF3GT. Our results suggest that PIA2 plays a role in the anthocyanin biosynthesis during seedling development as a novel phytochrome-interacting protein.

In the past 10 years, a lot of plant circadian rhythm researches have published in molecular biology and biochemistry. We discussed with published molecular studies of circadian clock and rhythmic genes in Arabidopsis, rice and algae. However past this studies are not sufficient to explain the whole rhythmic metabolism. Recently many researchers have concerned post-transcriptional, translational and post-translational modification of rhythmic proteins. From the view point of the high-throughput study, we could suggest the proteomic analysis with 2-DE gel electrophoresis and MS/MS techniques for the identification of modified proteins.

In Arabidopsis, the compartmentation of sugars into vacuoles is known to be facilitated by sugar transporters. However, vacuolar sugar transporters have not been studied in detail in other plant species. To characterize the rice (Oryza sativa) tonoplast monosaccharide transporters, OsTMT1 and OsTMT2, we analysed their subcellular localization using green fluorescent protein (GFP) and expression patterns using reverse-transcription polymerase chain reaction (RT-PCR), performed histochemical beta-glucuronidase (GUS) assay and in situ hybridization analysis, and assessed sugar transport ability using isolated vacuoles. Expression of OsTMT-GFP fusion protein in rice and Arabidopsis revealed that the OsTMTs localize at the tonoplast. Analyses of OsTMT promoter-GUS transgenic rice indicated that OsTMT1 and OsTMT2 are highly expressed in bundle sheath cells, and in vascular parenchyma and companion cells in leaves, respectively. Both genes were found to be preferentially expressed in the vascular tissues of roots, the palea/lemma of spikelets, and in the main vascular tissues and nucellar projections on the dorsal side of the seed coats. Glucose uptake studies using vacuoles isolated from transgenic mutant Arabidopsis (tmt1-2-3) expressing OsTMT1 demonstrated that OsTMTs are capable of transporting glucose into vacuoles. Based on expression analysis and functional characterization, our present findings suggest that the OsTMTs play a role in vacuolar glucose storage in rice.

Rho-related GTPase of plants (ROP) plays an important role in plant growth and development as a signaling protein. Plant RopGEFs are recently identified ROP activator proteins in Arabidopsis. In this study, we cloned 14 RopGEFs in Arabidopsis and characterized their expression patterns in response to abiotic stresses. Fourteen RopGEF genes were categorized into three groups based on their amino acid homologies and molecular sizes. Most RopGEFs were expressed predominantly in flower but some RopGEFs displayed a tissue-specific expression pattern. RopGEF1, 4, 5, and 11 were expressed in all tissues including root and leaves whereas RopGEF7, 8, 9, and 13 were expressed only in flowers. The transcript levels of 14 RopGEFs were changed significantly depending upon abiotic stresses such as cold, heat, drought and salts. RopGEF5 transcription was up-regulated by salt and drought treatment but down-regulated by heat. RopGEF14 transcript level was also increased by salt but decreased by heat stress. The transcript levels of RopGEF1, 7, 9, and 12 were enhanced in response to heat stress but showed no changes in response to cold stresses. Drought stress activated Group 3 RopGEFs such as RopGEF5 and 7. Taken together, 14 RopGEFs are responding to the abiotic stresses individually or as a group.

The Arabidopsis (Arabidopsis thaliana) hexokinase 1 (AtHXK1) is recognized as an important glucose (Glc) sensor. However, the function of hexokinases as Glc sensors has not been clearly demonstrated in other plant species, including rice (Oryza sativa). To investigate the functions of rice hexokinase isoforms, we characterized OsHXK5 and OsHXK6, which are evolutionarily related to AtHXK1. Transient expression analyses using GFP fusion constructs revealed that OsHXK5 and OsHXK6 are associated with mitochondria. Interestingly, the OsHXK5ΔmTP-GFP and OsHXK6ΔmTP-GFP fusion proteins, which lack N-terminal mitochondrial targeting peptides, were present mainly in the nucleus with a small amount of the proteins seen in the cytosol. In addition, the OsHXK5NLS-GFP and OsHXK6NLS-GFP fusion proteins harboring nuclear localization signals were targeted predominantly in the nucleus, suggesting that these OsHXKs retain a dual-targeting ability to mitochondria and nuclei. In transient expression assays using promoter∷luciferase fusion constructs, these two OsHXKs and their catalytically inactive alleles dramatically enhanced the Glc-dependent repression of the maize (Zea mays) Rubisco small subunit (RbcS) and rice α-amylase genes in mesophyll protoplasts of maize and rice. Notably, the expression of OsHXK5, OsHXK6, or their mutant alleles complemented the Arabidopsis glucose insensitive2-1 mutant, thereby resulting in wild-type characteristics in seedling development, Glc-dependent gene expression, and plant growth. Furthermore, transgenic rice plants overexpressing OsHXK5 or OsHXK6 exhibited hypersensitive plant growth retardation and enhanced repression of the photosynthetic gene RbcS in response to Glc treatment. These results provide evidence that rice OsHXK5 and OsHXK6 can function as Glc sensors.

Light signal transduction in plants involves an intricate series of pathways which is finely regulated by interactions between specific signalling proteins, as well as by protein modifications such as phosphorylation and ubiquitination. The identification of novel phytochrome-interacting proteins and the precise signalling mechanisms that they mediate is still ongoing. In our present study, we show that the newly identified putative phytochrome-associated protein, PAPP2C (phytochrome-associated protein phosphatase type 2C), interacts in the nucleus with phyA (phytochrome A) and phyB, both in vitro and in vivo. Moreover, the phosphatase activity of PAPP2C and its association with phytochromes were found to be enhanced by red light, indicating that it plays a role in mediating phytochrome signalling. In particular, PAPP2C specifically binds to the N-terminal PHY domain of the phytochromes. We thus speculate that this interaction reflects a unique regulatory function of this phosphatase toward established phytochrome-associated proteins. We also show that PAPP2C effectively dephosphorylates phytochromes in vitro. Interestingly, PAPP2C indirectly mediates the dephosphorylation of PIF3 (phytochrome-interacting factor 3) in vitro. Taken together, we suggest that PAPP2C functions as a regulator of PIF3 by dephosphorylating phytochromes in the nucleus.

Light signals recognized by phytochromes are transduced through interactions between down-stream signaling components. Phytochrome-interacting ankyrin repeat protein 2 (PIA2) was found to interact with phytochrome interacting factor 3 (PIF3), a well-known repressor of plant photomorphogenesis in response to phytochrome-mediated light signalling. Both PIA2 and PIF3 are known to be positive regulators of anthocyanin accumulation in Arabidopsis seedlings under far-red conditions. Thus, we investigated the functional relationship between PIA2 and PIF3 in light signalling. We found that PIA2 suppressed PIF3 phosphorylation by phyA. To elucidate how PIA2 modulates phyA-mediated PIF3 phosphorylation, we generated non-phosphorylation mutants and N-terminal α-helix breaking mutants of PIA2. PIF3 phosphorylation by phyA was not suppressed by α-helix breaking PIA2 mutants. The α-helix breaking mutations also resulted in remarkably decreased interactions between PIA2 and PIF3. However, the non-phosphorylation mutants exhibited no effect on phyA-mediated PIF3 phosphorylation. In addition, decreased anthocyanin accumulation in pia2 knockout plant seedlings was not rescued by overexpression of the α-helix breaking mutant in transgenic plants under far-red conditions. These results suggest that PIA2 modulates phyA-mediated PIF3 phosphorylation by physical interaction with PIF3 and that the secondary structure of the PIA2 N-terminus is important in this modulation.

Phytochrome A (phyA) is a light labile phytochrome that mediates plant development under red/far-red light condition. Degradation of phyA is initiated by red light-induced phyA-ubiquitin conjugation through the 26S proteasome pathway. The N-terminal of phyA is known to be important in phyA degradation. To determine the specific lysine residues in the N-terminal domain of phyA involved in light-induced ubiquitination and protein degradation, we aligned the amino acid sequence of the N-terminal domain of Arabidopsis phyA with those of phyA from other plant species. Based on the alignment results, phytochrome over-expressing Arabidopsis plants were generated. In particular, wild-type and mutant (substitutions of conserved lysines by arginines) phytochromes fused with GFP were expressed in phyA(-)211 Arabidopsis plants. Degradation kinetics of over-expressed phyA proteins revealed that degradation of the K206R phyA mutant protein was delayed. Delayed phyA degradation of the K206R phyA mutant protein resulted in reduction of red-light-induced phyA-ubiquitin conjugation. Furthermore, seedlings expressing the K206R phyA mutant protein showed an enhanced phyA response under far-red light, resulting in inhibition of hypocotyl elongation as well as cotyledon opening. Together, these results suggest that lysine 206 is the main lysine for rapid ubiquitination and protein degradation of Arabidopsis phytochrome A.

The committed step in the biosynthesis of the phytochrome chromophore phytochromobilin involves the oxidative cleavage of heme by a heme oxygenase (HO) to form biliverdin IXα. Through positional cloning of the photomorphogenic mutant hy1, the Arabidopsis HO (designated AtHO1) responsible for much of phytochromobilin synthesis recently was identified. Using theAtHO1 sequence, we identified families ofHO genes in a number of plants that cluster into two subfamilies (HO1- and HO2-like). The tomato (Lycopersicon esculentum) yg-2 andNicotiana plumbaginifolia pew1 photomorphogenic mutants are defective in specific HO genes. Phenotypic analysis of a T-DNA insertion mutant of Arabidopsis HO2 revealed that the second HO subfamily also contributes to phytochromobilin synthesis. Homozygous ho2-1 plants show decreased chlorophyll accumulation, reduced growth rate, accelerated flowering time, and reduced de-etiolation. A mixture of apo- and holo-phyA was detected in etiolated ho2-1 seedlings, suggesting that phytochromobilin is limiting in this mutant, even in the presence of functional AtHO1. The patterns of ArabidopsisHO1 and HO2 expression suggest that the products of both genes overlap temporally and spatially. Taken together, the family of HOs is important for phytochrome-mediated development in a number of plants and that each family member may uniquely contribute to the phytochromobilin pool needed to assemble holo-phytochromes.

Summary •In higher plants, the plastidic glucose translocator (pGlcT) is assumed to play a role in the export of starch degradation products, but this has not yet been studied in detail. •To elucidate the role of pGlcT in the leaves of Arabidopsis thaliana, we generated single and double mutants lacking three plastidic sugar transporters, pGlcT, the triose-phosphate/phosphate translocator (TPT), and the maltose transporter (MEX1), and analyzed their growth phenotypes, photosynthetic properties and metabolite contents. •In contrast to the pglct-1 and pglct-2 single mutants lacking a visible growth phenotype, the double mutants pglct-1/mex1 and tpt-2/mex1 displayed markedly inhibited plant growth. Notably, pglct-1/mex1 exhibited more severe growth retardation than that seen for the other mutants. In parallel, the most severe reductions in sucrose content and starch turnover were observed in the pglct-1/mex1 mutant. The concurrent loss of pGlcT and MEX1 also resulted in severely reduced photosynthetic activities and extreme chloroplast abnormalities. •These findings suggest that pGlcT, together with MEX1, contributes significantly to the export of starch degradation products from chloroplasts in A. thaliana leaves, and that this starch-mediated pathway for photoassimilate export via pGlcT and MEX1 is essential for the growth and development of A. thaliana.

Phytochromes enable plants to sense light information and regulate developmental responses. Phytochromes interact with partner proteins to transmit light signals to downstream components for plant development. PIRF1 (phytochrome-interacting ROP guanine-nucleotide exchange factor (RopGEF 1)) functions as a light-signaling switch regulating root development through the activation of ROPs (Rho-like GTPase of plant) in the cytoplasm. In vitro pulldown and yeast two-hybrid assays confirmed the interaction between PIRF1 and phytochromes. PIRF1 interacted with the N-terminal domain of phytochromes through its conserved PRONE (plant-specific ROP nucleotide exchanger) region. PIRF1 also interacted with ROPs and activated them in a phytochrome-dependent manner. The Pr form of phytochrome A enhanced the RopGEF activity of PIRF1, whereas the Pfr form inhibited it. A bimolecular fluorescence complementation analysis demonstrated that PIRF1 was localized in the cytoplasm and bound to the phytochromes in darkness but not in light. PIRF1 loss of function mutants (pirf1) of Arabidopsis thaliana showed a longer root phenotype in the dark. In addition, both PIRF1 overexpression mutants (PIRF1-OX) and phytochrome-null mutants (phyA-211 and phyB-9) showed retarded root elongation and irregular root hair formation, suggesting that PIRF1 is a negative regulator of phytochrome-mediated primary root development. We propose that phytochrome and ROP signaling are interconnected through PIRF1 in regulating the root growth and development in Arabidopsis.

In an attempt to understand the complex regulatory mechanisms underlying sucrose-induced flavonoid biosynthesis, we examined several Arabidopsis mutants with altered anthocyanin accumulation. We determined that disruption of ethylene signaling results in a dramatic increase in sucrose-induced anthocyanin accumulation. Furthermore, we investigated why the ein2-1 (ethylene insensitive) Arabidopsis mutant accumulates higher levels of anthocyanin in response to sucrose than wild-type Arabidopsis. An increased level of PAP1 transcript in the ein2-1 mutant appears to be the main factor responsible for the increased accumulation of anthocyanin in response to sucrose. Therefore, our results indicate that the ethylene signaling pathway plays a negative role in sucrose-induced anthocyanin accumulation. We believe that the explanation for this observation may be related to the initiation of the senescence program in plants.

Pyrophosphate: fructose-6-phosphate 1-phosphotransferase (PFP) catalyzes the reversible interconversion of fructose-6-phosphate and fructose-1,6-bisphosphate, a key step in the regulation of the metabolic flux toward glycolysis or gluconeogenesis. To examine the role of PFP in plant growth, we have generated transgenic Arabidopsis plants that either overexpress or repress Arabidopsis PFP sub-unit genes. The overexpressing lines displayed increased PFP activity and slightly faster growth relative to wild type plants, although their photosynthetic activities and the levels of metabolites appeared not to have significantly changed. In contrast, the RNAi lines showed significantly retarded growth in parallel with the reduced PFP activity. Analysis of photosynthetic activity revealed that the growth retardation phenotype of the RNAi lines was accompanied by the reduced rates of CO(2) assimilation. Microarray analysis of our transgenic plants further revealed that the altered expression of AtPFPbeta affects the expression of several genes involved in diverse physiological processes. Our current data thus suggest that PFP is important in carbohydrate metabolism and other cellular processes.

An Arabidopsis hy4 mutant that is specifically impaired in its ability to undergo blue light dependent photomorphogenesis was used to identify cryptochrome 1 signaling-related components. Proteomic analysis revealed about 205 differentially expressed protein spots in the blue light-irradiated hy4 mutant compared to the wild-type. The proteins corresponding to 28 up-regulated and 33 down-regulated spots were identified. Obvious morphological changes in the hy4 mutant were closely related to the expression of various transcription factors. Our findings suggest that blue light signals may be involved in many cellular processes including disease resistance and stress responses.

Arabidopsis harbors two alpha and two beta genes of pyrophosphate:fructose-6-phosphate 1-phosphotransferase (PFP). The spatial expression patterns of the two AtPFPalpha genes were analyzed using transgenic plants containing a promoter::ss-glucuronidase (GUS) fusion construct. Whereas the AtPFPalpha1 promoter was found to be ubiquitously active in all tissues, the AtPFPalpha2 promoter is preferentially expressed in specific heterotrophic regions of the Arabidopsis plant such as the trichomes of leaves, cotyledon veins, roots, and the stamen and gynoecium of the flowers. Serial deletion analysis of the AtPFPalpha2 promoter identified a key regulatory element from nucleotides -194 to -175, CGAAAAAGGTAAGGGTATAT, which we have termed PFPalpha2 and which is essential for AtPFPalpha2 gene expression. Using a GUS fusion construct driven by this 20-bp sequence in conjunction with a -46 CaMV35S minimal promoter, we also demonstrate that PFPalpha2 is sufficient for normal AtPFPalpha2 expression. Hence, this element can not only be used to isolate essential DNA-binding protein(s) that control the expression of the carbon metabolic enzyme AtPFPalpha2, but has also the potential to be utilized in the production of useful compounds in a specific organ such as the leaf trichomes.

Phytochrome-interacting proteins have been extensively studied to elucidate light-signaling pathway in plants. However, most of these proteins have been identified by yeast two-hybrid screening using the C-terminal domain of phytochromes. We used co-immunoprecipitation followed by proteomic analysis in plant cell extracts in an attempt to screen for proteins interacting either directly or indirectly with native holophytochromes including the N-terminal domain as well as C-terminal domain. A total of 16 protein candidates were identified, and were selected from 2-DE experiments. Using MALDI-TOF MS analysis, 7 of these candidates were predicted to be putative phytochrome A-interacting proteins and the remaining ones to be phytochrome B-interacting proteins. Among these putative interacting proteins, protein phosphatase type 2C (PP2C) and a 66-kDa protein were strong candidates as novel phytochrome-interacting proteins, as knockout mutants for the genes encoding these two proteins had impaired light-signaling functions. A transgenic knockout Arabidopsis study showed that a 66-kDa protein candidate regulates hypocotyl elongation in a light-specific manner, and altered cotyledon development under white light during early developmental stages. The PP2C knockout plants also displayed light-specific changes in hypocotyl elongation. These results suggest that co-immunoprecipitation, followed by proteomic analysis, is a useful method for identifying novel interacting proteins and determining real protein-protein interactions in the cell.