2,110 results on '"Gang Wang"'
Search Results
2. Dual-targeting vaccine of FGL1/CAIX exhibits potent anti-tumor activity by activating DC-mediated multi-functional CD8 T cell immunity
- Author
-
Dafei Chai, Jiawei Wang, Zichun Zhang, Nan Jiang, Xiaoqing Shi, Jiage Ding, Pengli Xiao, Gang Wang, Junnian Zheng, Jie Yang, and Dong Qiu
- Subjects
Cancer Research ,T cell ,renal cancer ,chemical and pharmacologic phenomena ,macromolecular substances ,DNA vaccination ,chemistry.chemical_compound ,Immune system ,Antigen ,Immunity ,medicine ,Cytotoxic T cell ,Pharmacology (medical) ,FGL1 ,RC254-282 ,CAIX ,technology, industry, and agriculture ,Neoplasms. Tumors. Oncology. Including cancer and carcinogens ,therapeutic effects ,PLGA ,medicine.anatomical_structure ,Oncology ,chemistry ,tumor vaccine ,Cancer research ,Molecular Medicine ,Original Article ,multi-functional CD8+ T cells ,CD8 - Abstract
Tumor DNA vaccine as an effective therapeutic approach can induce systemic immunity against malignant tumors, but its therapeutic effect is still not satisfactory in advanced renal cancer. Herein, a novel DNA vaccine containing dual antigens of fibrinogen-like protein 1 (FGL1) and carbonic anhydrase IX (CAIX) was developed and intramuscularly delivered by PLGA/PEI nanoparticles for renal cancer therapy. Compared with PLGA/PEI-pCAIX immunization, PLGA/PEI-pFGL1/pCAIX co-immunization significantly inhibited the subcutaneous tumor growth and promoted the differentiation and maturation of CD11c+ DCs and CD11c+CD11b+ DCs subset. Likewise, the increased capabilities of CD8 T cell proliferation, CTL responses, and multi-functional CD8+ T cell immune responses were observed in PLGA/PEI-pFGL1/pCAIX vaccine group. Interestingly, depletion of CD8+ T cells by using CD8 mAb resulted in a loss of anti-tumor function of PLGA/PEI-pFGL1/pCAIX vaccine, suggesting that the anti-tumor activity of the vaccine was dependent on CD8+ T cell immune responses. Furthermore, PLGA/PEI-pFGL1/pCAIX co-immunization also suppressed the lung metastasis of tumor mice by enhancing the multi-functional CD8+ T cell responses. Therefore, these results indicate that PLGA/PEI-pFGL1/pCAIX vaccine could provide an effective protective effect for renal cancer by enhanced DC-mediated multi-functional CD8+ T cell immune responses. This vaccine strategy offers a potential approach for solid or metastatic tumor treatment., Graphical abstract, Here, Chai et al. investigate the therapy effect of dual-targeting vaccine of FGL1/CAIX in renal cancer. They found that the vaccine could induce DC-mediated multi-functional CD8 T cell immunity to suppress tumor growth and metastasis. This vaccine strategy offers a potential approach for cancer care.
- Published
- 2022
3. YF3/CoF3 co-doped 1D carbon nanofibers with dual functions of lithium polysulfudes adsorption and efficient catalytic activity as a cathode for high-performance Li-S batteries
- Author
-
Xiaoxiao Wang, Bowen Cheng, Nanping Deng, Gang Wang, Liying Wei, Weimin Kang, Yan Hao, and Qi Yang
- Subjects
Materials science ,Carbon nanofiber ,chemistry.chemical_element ,Lithium–sulfur battery ,Electrochemistry ,Sulfur ,Cathode ,Surfaces, Coatings and Films ,Electronic, Optical and Magnetic Materials ,law.invention ,Biomaterials ,chemistry.chemical_compound ,Colloid and Surface Chemistry ,chemistry ,Chemical engineering ,law ,Nanofiber ,Lithium ,Polysulfide - Abstract
Lithium-sulfur (Li-S) batteries have attracted extensive attention in the field of energy storage due to their high energy density and low cost. However, conundrums such as severe polarization, poor cyclic performance originating from shuttle effect of lithium polysulfides and sluggish sulfur redox kinetics are stumbling blocks for their practical application. Herein, a novel sulfur cathode integrating sulfur and polyvinylpyrrolidone(PVP)-derived N-doped porous carbon nanofibers (PCNFs) with embedded CoF3 and YF3 nanoparticles are designed and prepared though the electrostatic blowing technology and carbonization process. The unique flexible PCNFs with embedded polar CoF3 and YF3 nanoparticles not only offer enough voids for volume expansion to maintain the structural stability during the electrochemical process, but also promote the physical encapsulation and chemical entrapment of all sulfur species. Moreover, the uniform distribution of YF3/CoF3 nanoparticles also can expose more binding active sites to lithium polysulfide and present more catalytic sites to the greatest extent. Therefore, the assembled cells with the prepared cathode exhibited stable performances with an outstanding initial capacity of 1055.2 mAh g−1 and an extended cycling stability of 0.029% per cycle during the 300 cycles at 0.5C. Even at a high sulfur loading of 2.1 mg cm−2, The YF3/CoF3 doped-PCNFs exhibited a high discharge specific capacity of 1038 mAh g−1, and the decay rate is also as low as 0.05% over 1000 cycles. This work shares a convenient and safe strategy for the synthesis of multi-dimension, dual-functional and stable superstructure electrode for advanced Li-S batteries.
- Published
- 2022
4. The activation of inert NiFe Prussian Blue analogues to boost oxygen evolution reaction activity
- Author
-
Yali Xue, Jinwei Chen, Yi Jiao, Yong Yan, Chenyang Zhang, Ruilin Wang, Jie Zhang, Gang Wang, Yihan Chen, and Yan Luo
- Subjects
Inert ,Prussian blue ,Materials science ,Doping ,Oxygen evolution ,Conductivity ,Overpotential ,Hydrothermal circulation ,Surfaces, Coatings and Films ,Electronic, Optical and Magnetic Materials ,Gibbs free energy ,Oxygen ,Biomaterials ,chemistry.chemical_compound ,symbols.namesake ,Colloid and Surface Chemistry ,chemistry ,Chemical engineering ,symbols ,Ferrocyanides - Abstract
The inert sites of Prussian Blue Analogue (PBA) seriously affected its electrocatalytic activity and application, how to activate inert sites in PBA to fulfill effective oxygen evolution reduction (OER) is a major challenge. Herein, Mo substituted Fe sites and S doped in inert PBA were designed and synthesized by hydrothermal method to enhance structural stability and OER activity. PBA-SMo/NF shows the optimum activity with a low overpotential of 252 and 294 mV for harvesting current density 20 and 100 mA cm−2, respectively, and exhibits excellent durability under high current density. Theoretical calculation of H2O adsorption energy and Bader charges reveals that Mo sites in PBA-SMo possess favourable H2O adsorption kinetics. More important, Gibbs free energy diagram and DOS show PBA-SMo have lower energy barriers for OER and better conductivity. This work provides a kind of guidance for the design and optimization of PBA for broad applications.
- Published
- 2022
5. Structurally defined tandem-responsive nanoassemblies composed of dipeptide-based photosensitive derivatives and hypoxia-activated camptothecin prodrugs against primary and metastatic breast tumors
- Author
-
Yang Wang, Yulong Zheng, Zhonggui He, Tian Liu, Gang Wang, Qikun Jiang, Maosheng Cheng, Jin Sun, Hailun Jiang, Mengchi Sun, Bingjun Sun, and Xiao Tan
- Subjects
Dipeptide ,Chemistry ,Rational design ,Prodrug ,medicine.disease ,Metastasis ,chemistry.chemical_compound ,Breast cancer ,Apoptosis ,Cancer cell ,medicine ,Cancer research ,General Pharmacology, Toxicology and Pharmaceutics ,neoplasms ,Camptothecin ,medicine.drug - Abstract
Substantial progress in the use of chemo-photodynamic nano-drug delivery systems (nano-DDS) for the treatment of the malignant breast cancer has been achieved. The inability to customize precise nanostructures, however, has limited the therapeutic efficacy of the prepared nano-DDS to date. Here, we report a structurally defined tandem-responsive chemo-photosensitive co-nanoassembly to eliminate primary breast tumor and prevent lung metastasis. This both-in-one co-nanoassembly is prepared by assembling a biocompatible photosensitive derivative (pheophorbide-diphenylalanine peptide, PPA-DA) with a hypoxia-activated camptothecin (CPT) prodrug [(4-nitrophenyl) formate camptothecin, N-CPT]. According to computational simulations, the co-assembly nanostructure is not the classical core-shell type, but consists of many small microphase regions. Upon exposure to a 660 nm laser, PPA-DA induce high levels of ROS production to effectively achieve the apoptosis of normoxic cancer cells. Subsequently, the hypoxia-activated N-CPT and CPT spatially penetrate deep into the hypoxic region of the tumor and suppress hypoxia-induced tumor metastasis. Benefiting from the rational design of the chemo-photodynamic both-in-one nano-DDS, these nanomedicines exhibit a promising potential in the inhibition of difficult-to-treat breast tumor metastasis in patients with breast cancer.
- Published
- 2022
6. Mechanistic insight into methanol electro-oxidation catalyzed by PtCu alloy
- Author
-
Wei Zhang, Yang-Gang Wang, and Guang-Jie Xia
- Subjects
Exergonic reaction ,Chemistry ,Inorganic chemistry ,Alloy ,Rational design ,General Medicine ,engineering.material ,Dissociation (chemistry) ,Catalysis ,chemistry.chemical_compound ,engineering ,Dehydrogenation ,Density functional theory ,Methanol - Abstract
In this work, we have performed density functional theory (DFT) calculations to investigate the methanol electro-oxidation reaction (MOR) catalyzed by the Pt, PtCu alloy and Cu. The complex reaction networks, including the intermediate dehydrogenation, water dissociation and anti-poison reaction steps, are systematically investigated to explore the mechanisms. At the standard condition of pH = 0 and zero potential, for Cu, most dehydrogenation steps along the favorable pathway are endergonic, making it less active in MOR. For the Pt and PtCu alloy, their dehydrogenation steps are mainly exergonic, but the formed CO intermediate binds too tightly on Pt, that can accumulate on active sites to poison the electro-catalyst. The CO can be consumed by the thermodynamic reaction with OH*, which comes from water dissociation. DFT calculation shows alloying the Pt with Cu could not only reduce the free energy barrier for binding between CO* and OH*, but also assist the water dissociation to produce more OH* for that anti-poison reaction. That makes the PtCu alloy more active than the pure Pt electrode in experiment. The results reveal the importance of anti-poison reaction and water dissociation in MOR, which could be applied to the rational design of more active alloy electro-catalysts in future.
- Published
- 2022
7. Theory-Driven Design of Electrocatalysts for the Two-Electron Oxygen Reduction Reaction Based on Dispersed Metal Phthalocyanines
- Author
-
Zhan Jiang, Yongye Liang, Yang-Gang Wang, Xiao Zhang, Hongzhi Zheng, Yang Wang, Zisheng Zhang, Hua Zhou, and Yubo Yuan
- Subjects
Inorganic chemistry ,chemistry.chemical_element ,General Chemistry ,Electrochemistry ,Oxygen ,Peroxide ,Molecular engineering ,Metal ,Reduction (complexity) ,chemistry.chemical_compound ,chemistry ,visual_art ,visual_art.visual_art_medium ,Hydrogen peroxide ,Carbon - Abstract
The two-electron electrochemical reduction of oxygen is an appealing approach to produce hydrogen peroxide. Metal and heteroatom-doped carbon (M–X/C) materials have recently been recognized as comp...
- Published
- 2022
8. A Configurationally Tunable Perylene Bisimide Derivative‐based Fluorescent Film Sensor for the Reliable Detection of Volatile Basic Nitrogen towards Fish Freshness Evaluation
- Author
-
Ke Liu, Gang Wang, Shang Congdi, Zhaolong Wang, Yu Fang, Wenjun Xu, Xinyu Gou, Qingwei Jiang, and Taihong Liu
- Subjects
chemistry.chemical_compound ,chemistry ,%22">Fish ,chemistry.chemical_element ,General Chemistry ,Photochemistry ,Nitrogen ,Fluorescence ,Perylene ,Derivative (chemistry) - Published
- 2021
9. Corrosion of Corundum–MgAl2O4 Spinel-Based Castables in CaO–SiO2–Fe2O3–Al2O3-Based Slag at 1650 °C
- Author
-
Quanli Jia, Liu Guo, Hongxia Li, Gang Wang, Shuhe Hu, and Liugang Chen
- Subjects
Cement ,Materials science ,Aluminate ,Spinel ,Metallurgy ,Metals and Alloys ,Slag ,Corundum ,engineering.material ,Condensed Matter Physics ,Corrosion ,chemistry.chemical_compound ,Infiltration (hydrology) ,chemistry ,Flexural strength ,Mechanics of Materials ,visual_art ,Materials Chemistry ,visual_art.visual_art_medium ,engineering - Abstract
Corundum–MgAl2O4 spinel-based castables bonded with calcium aluminate cement (CAC) and hydratable alumina (HA) were studied to evaluate their performance as gas purging plugs in steel ladles. The thermomechanical properties and corrosion behavior of the as-prepared castables were investigated. The results indicate that the cold crushing strength and modulus of rupture of castables bonded with CAC and HA after firing at 1600 °C are in the same levels of 160 and 32 MPa, respectively. The sample bonded with HA showed lower permanent change of − 0.23 pct and slag infiltration index of 0.07 compared with CAC-bonded samples (> 0.34 pct and > 0.36, respectively), suggesting the better volume stability and corrosion and slag infiltration resistance to CaO–SiO2–Fe2O3–Al2O3-based slag of HA-bonded castable. The in situ-formed MgAl2O4 spinel changed the corrosion and infiltration indices of CAC-bonded castable to 0.09 and 0.39, respectively, compared with castable without in situ MgAl2O4 spinel, indicating that the corrosion resistance was improved but the infiltration resistance was reduced by the in situ-formed MgAl2O4 spinel.
- Published
- 2021
10. RETRACTED ARTICLE: Curcumin deactivates M2 macrophages to alleviate lung fibrosis in IgG4-related disease through activating the toll-like receptor 9 pathway
- Author
-
LiPeng Liu, Gang Wang, and Jian Zhu
- Subjects
Curcumin ,Pulmonary Fibrosis ,Immunology ,Apoptosis ,Toxicology ,medicine.disease_cause ,chemistry.chemical_compound ,Fibrosis ,Cell Line, Tumor ,parasitic diseases ,Pulmonary fibrosis ,medicine ,Humans ,Immunology and Allergy ,Macrophage ,Receptor ,Pharmacology ,Lung ,Chemistry ,Macrophages ,Reproducibility of Results ,General Medicine ,medicine.disease ,Molecular biology ,Blot ,medicine.anatomical_structure ,Toll-Like Receptor 9 ,Immunoglobulin G4-Related Disease ,Oxidative stress - Abstract
Objectives To explore the effects and mechanism of Curcumin on pulmonary fibrosis in IgG4-related disease (IgG4-RD). Methods The expression of fibrosis factors, inflammatory factors and markers of M1/M2 macrophages in lung tissue of IgG4-RD patients was detected by RT-qPCR or Western blotting. The macrophages of IgG4-RD patients were isolated and treated with different concentrations of Curcumin, and the markers of M1/M2 macrophages were detected by RT-qPCR, Western blotting or ELISA. Next, the pulmonary fibroblasts of IgG4-RD patients were isolated and cultured with the supernatant of macrophages treated with Curcumin. Cell proliferation and migration were detected by CCK-8 and Transwell assay, respectively. SOD activity and ROS content were detected by the xanthine oxidase method and flow cytometry, respectively. Then the expression of Toll-like Receptor 9 (TLR9) and its downstream proteins were detected by Western blotting. After treating the cells with TLR9 antagonist IRS869, the changes in the above indicators were further detected. Results The collagen deposition, inflammatory factors secretion and M2 polarization of macrophages were increased in lung tissue of IgG4-RD patients. Curcumin decreased the macrophage M2 polarization and inhibited the proliferation and migration of fibroblasts, reduced the level of oxidative stress, and suppressed the occurrence of fibrosis. The TLR9 pathway was inhibited in IgG4-RD lung tissues, and Curcumin activated this pathway and reduced macrophage M2 polarization. And the inhibitory effect of Curcumin on pulmonary fibrosis could be reversed by IRS869. Conclusions Curcumin inhibited the occurrence of pulmonary fibrosis in IgG4-RD by inhibiting the TLR9 signaling pathway-mediated macrophage M2 polarization.
- Published
- 2021
11. Orthogonal carbazole-perylene bisimide pentad: a photoconversion-tunable photosensitizer with diversified excitation and excited-state relaxation pathways
- Author
-
Zhaolong Wang, Yue Sun, Pi-Tai Chou, Yu Fang, Gang Wang, Gang He, Yu-Chen Wei, Taihong Liu, Xingmao Chang, Simin Lin, Shengye Jin, and Xinyu Gou
- Subjects
chemistry.chemical_compound ,Materials science ,chemistry ,Absorption spectroscopy ,Carbazole ,Excited state ,Intramolecular force ,Ultrafast laser spectroscopy ,Photosensitizer ,General Chemistry ,Photochemistry ,Luminescence ,Perylene - Abstract
Integrating multiple photosensitive properties into an “all-in-one” photosensitizer (PS) shows great promise for the treatment of cancers owing to synergistic effect among them. However, the development of such PSs, especially those that need a single laser source, remains a challenge. Herein, we report an orchestration of electron donors and acceptors in a propeller-like pentad, PBI-4Cz, where four carbazole (Cz) units are covalently linked to the ortho-positions of the perylene bisimide (PBI) core. Strong intramolecular donor-acceptor interaction significantly quenches the luminescence and largely extends the absorption spectra to near-infrared region. Excited-state dynamics investigated via femto- and nano-second transient absorption spectroscopy revealed exclusive charge separation of the PBI-4Cz within initial 0.5 ps when photoexcited regardless of which intermediate is involved. Energy dissipation of the resulting charge-separated state (PBI•−-4Cz•−) is subjected to the toggle between intersystem-crossing toward excited triplet states and charge recombination toward ground states. Relative importance of the two pathways can be tuned by micro-environmental polarity, which endows PBI-4Cz remarkable performances of singlet-oxygen generation (>90.0%) in toluene and photothermal conversion (∼28.6%) in DMSO. Harnessing intrinsic photostability and excited-state processes of heavy-atom-free PBI derivatives not only holds a promise for multifunctional phototheranostics, but also provides a prototype for designing high-performance PSs with tunable photoconversion pathways.
- Published
- 2021
12. Novel Nanostructured WO3@Prussian Blue Heterojunction Photoanodes for Efficient Photoelectrochemical Water Splitting
- Author
-
Gang Wang, Heng Wu, Li Zhang, Guobing Mao, Qi Liu, and Yawen Tang
- Subjects
Prussian blue ,Materials science ,Energy Engineering and Power Technology ,Nanotechnology ,Heterojunction ,Hydrothermal circulation ,chemistry.chemical_compound ,chemistry ,Materials Chemistry ,Electrochemistry ,Chemical Engineering (miscellaneous) ,Water splitting ,Nanorod ,Electrical and Electronic Engineering - Abstract
A simple hydrothermal method has been developed to prepare a WO3 nanorod array@Prussian blue (WO3@PB) composite material on FTO substrates with core–shell heterogeneous structures, aiming to enhanc...
- Published
- 2021
13. Protective effects of anthocyanins on neurodegenerative diseases
- Author
-
Xinwei Jiang, Ping Li, Gang Wang, Dou Feng, Jianxia Sun, Lingmin Tian, Weibin Bai, Xusheng Li, and Dacheng Yang
- Subjects
0301 basic medicine ,Inflammation ,Disease ,Pharmacology ,medicine.disease_cause ,Neuroprotection ,03 medical and health sciences ,chemistry.chemical_compound ,0302 clinical medicine ,In vivo ,medicine ,business.industry ,fungi ,Glutamate receptor ,food and beverages ,carbohydrates (lipids) ,030104 developmental biology ,chemistry ,Apoptosis ,Anthocyanin ,medicine.symptom ,business ,030217 neurology & neurosurgery ,Oxidative stress ,Food Science ,Biotechnology - Abstract
The neurodegenerative disease is a vital threat to the elders, the incidence is increasing but the efficient therapy is rare. A feasible strategy to treat neurodegenerative diseases is dietary prevention. Among them, anthocyanins are a group of phytochemicals that have shown rising evidences of ameliorating neurodegenerative disease. This review summarized the neuroprotective effect of anthocyanins in vitro and in vivo and discussed the related pathways. Anthocyanins alleviated neurological dysfunction such as cognitive and memory functions via the protection of neurons, glial cells and hippocampal nerve cells against the damage of Aβ-proteins, glutamate, and lipopolysaccharides. In addition, anthocyanins reduced oxidative stress, suppressed inflammation, inhibited apoptosis in nerve cells. The neuroprotection of anthocyanin is also related to the intestinal metabolites. The human study is inadequate but the accumulated evidences indicated that anthocyanins could be the potential dietary supplement to prevent against neurodegenerative diseases.
- Published
- 2021
14. Comparative study of thermally stratified tank using different heat transfer materials for concentrated solar power plant
- Author
-
Tieliu Jiang, Zijian Liu, Gang Wang, and Zeshao Chen
- Subjects
Materials science ,020209 energy ,Mechanical analysis ,Alloy ,02 engineering and technology ,engineering.material ,Thermal energy storage ,chemistry.chemical_compound ,020401 chemical engineering ,Nitrate ,Thermal ,Concentrated solar power ,0202 electrical engineering, electronic engineering, information engineering ,0204 chemical engineering ,Composite material ,Eutectic system ,Energy storage behavior ,Heavy liquid metal ,TK1-9971 ,Thermally stratified tank ,General Energy ,chemistry ,Heat transfer ,engineering ,Molten salt ,Electrical engineering. Electronics. Nuclear engineering ,Ternary operation - Abstract
This paper presents a comparative analysis of thermal and mechanical behaviors of the thermally stratified heat storage system using three different heat transfer materials, which are the binary nitrate salt, ternary nitrate salt and liquid lead–bismuth eutectic (LBE) alloy. The discharging behaviors of the tank using three different heat transfer materials are investigated by using both the algebraic and numerical models. For all the three materials, the algebraic results are consistent with the simulation ones. During the discharging process, in comparison, the thermal stratification thickness of the tank using the binary nitrate salt is relatively smaller, which can lead to a better discharging performance. The comparison results of expanding behaviors of the standby tank reveal that the thermal stratification thicknesses of tanks using the three different heat transfer materials all increase with the standby time increased. Compared with the other two materials, the thermal stratification thickness of the tank using the binary nitrate salt is the smallest at the same standby time. The comparison results of mechanical behaviors of the tank demonstrate that the maximum mechanical stress of the tank using the liquid LBE is the greatest, while the tank using the molten salts can have better mechanical properties.
- Published
- 2021
15. Improved oxygen activation over metal–organic-frameworks derived and zinc-modulated Co@NC catalyst for boosting indoor gaseous formaldehyde oxidation at room temperature
- Author
-
Yi Jiao, Ruilin Wang, Meng Huang, Jinwei Chen, Jie Zhang, Gang Wang, and Haiyan Tang
- Subjects
Materials science ,Inorganic chemistry ,Formaldehyde ,chemistry.chemical_element ,02 engineering and technology ,Zinc ,010402 general chemistry ,01 natural sciences ,Oxygen ,Catalysis ,Biomaterials ,chemistry.chemical_compound ,Colloid and Surface Chemistry ,Specific surface area ,Metal-Organic Frameworks ,Temperature ,021001 nanoscience & nanotechnology ,0104 chemical sciences ,Surfaces, Coatings and Films ,Electronic, Optical and Magnetic Materials ,chemistry ,Metal-organic framework ,Gases ,0210 nano-technology ,Cobalt ,Space velocity - Abstract
The indoor low-concentration formaldehyde (HCHO) removal in cobalt-based catalysts is still a “hot potato”. In this work, metal–organic-frameworks (MOF)-derived and Zinc (Zn)-modulated new cobalt nanoparticles catalyst (CZ-Co@NC-800) was designed and prepared. The CZ-Co@NC-800 performed outstanding elimination activities for ~1 ppm HCHO at 25 °C. In the static test condition, it achieves complete HCHO removal in 3 h at a relative humidity (RH) of ~55%. Moreover, 90.18% HCHO removal ratio is held after five recycle tests. In the dynamic test condition, it remains the characteristic to eliminate around 95.89% of HCHO within 8 h under an RH of ~55% and a gas hourly space velocity (GHSV) of ~150,000 mL·h−1g−1. Such advanced results should be ascribed to large specific surface area bringing about more cobalt active sites; and it is also because residual Zn metal affects the electronic structure of CZ-Co@NC-800 and enhance the surface charge transfer rate, thus the activation and dissociation ability of oxygen is promoted. Besides, a short HCHO reaction path over CZ-Co@NC-800 which was clarified by the In situ DRIFTs is also a reason for excellent catalytic performance. This work represents a crucial addition to expand the family of cobalt-based catalysts for indoor HCHO elimination.
- Published
- 2021
16. Preparation, structural characterization and neuroprotective effects of polysaccharides from the pericarp of Zanthoxylum bungeanum Maxim against H2O2-induced oxidative damage in PC12 cells
- Author
-
Qing Su, Yu-Jie Liu, Gang Wang, Zhi-Yang Chen, Lin Chen, and Mei-Bian Hu
- Subjects
Arabinose ,chemistry.chemical_classification ,Antioxidant ,Chromatography ,biology ,Rhamnose ,medicine.medical_treatment ,Extraction (chemistry) ,Plant Science ,Malondialdehyde ,Polysaccharide ,Superoxide dismutase ,chemistry.chemical_compound ,chemistry ,Lactate dehydrogenase ,medicine ,biology.protein - Abstract
The pericarp of Zanthoxylum bungeanum Maxim (PZM) is one of eight fascinating condiments and also used as a traditional herbal medicine to treat a variety of diseases. In this study, ultrasound-assisted extraction (UAE) was applied for the extraction of polysaccharides from PZM (PPZM) and the extraction conditions were optimized by response surface methodology (RSM). The obtained PPZM yield (2.60 ± 0.06%) was closely agreed with the predicted value (2.58%), and the optimal extraction conditions obtained were: liquid to solid ratio of 32 mL/g, extraction time of 42 min, and extraction temperature of 61 °C. PPZM was determined to be composed of mannose (Man), rhamnose (Rha), galacturonic acid (GalA), glucose (Glu), galactose (Gal), arabinose (Ara) with a molar ratio of 4.93: 5.03: 71.01: 16.01: 24.87: 18.79, and the average molecular weight (Mw) of PPZM was 1.72 × 105 Da. Typical polysaccharide characteristics were determined by fourier transform infrared spectroscopy (FT-IR). PPZM exhibited remarkable antioxidant activities in vitro. More importantly, PPZM effectively protected adrenal phaeochromocytoma PC12 cells against H2O2-induced damage by inhibiting the release of lactate dehydrogenase (LDH) and malondialdehyde (MDA), increasing the level of superoxide dismutase (SOD), and inhibiting abnormal apoptosis. Further experiments indicated that the anti-apoptotic effects of PPZM were closely related to down-regulating the expressions of Bax and Caspase-3, and up-regulating the expression of Bcl-2. Therefore, PPZM can be used as the source of natural antioxidants and neuroprotective agents.
- Published
- 2021
17. Phthalonitrile-etherified cardanol-phenol-formaldehyde resin: synthesis, characterization and properties
- Author
-
Zhang Dayong, Zhu Jinhua, Mi Changhong, Rong Liping, Zhao Ying, Li Xin, Gang Wang, Xiaohui Liu, and Xuefeng Bai
- Subjects
chemistry.chemical_classification ,Phthalonitrile ,Cardanol ,chemistry.chemical_compound ,Materials science ,chemistry ,Phenol formaldehyde resin ,Materials Chemistry ,Organic chemistry ,Surfaces, Coatings and Films - Abstract
Purpose The purpose of this study is to investigate the heat resistance and heat-resistant oxygen aging of 4-nitrophthalonitrile-etherified cardanol-phenol-formaldehyde (PPCF) to further use and develop the resin as the matrix resin of high-temperature resistant adhesives and coatings. Design/methodology/approach PPCF resin was synthesized by 4-nitrophthalonitrile and cardanol-phenol-formaldehyde (PCF). The structures of PPCF and PCF were investigated by Fourier transform infrared, differential scanning calorimetry and proton nuclear magnetic resonance. In addition, the heat resistance and processability of PPCF and PCF resins were studied by dynamic mechanical analysis, thermogravimetric analysis, scanning electronic microscopy (SEM), X-ray diffraction (XRD) techniques and rheological studies. Findings The results reveal that PPCF forms a cross-linked network at a lower temperature. PPCF resin has excellent resistance under thermal aging in an air atmosphere and that it still had a certain residual weight after aging at 500°C for 2 h, whereas the PCF resin is completely decomposed. Originality/value 4-Nitrophthalonitrile was introduced into PCF resin, and XRD and SEM were used to investigate the high temperature residual carbon rate and heat-resistant oxygen aging properties of PPCF and PCF resins.
- Published
- 2021
18. Updates on food and feed mycotoxin contamination and safety in Africa with special reference to Nigeria
- Author
-
Sana Ullah, Gang Wang, Edgar Mugizi Ankwasa, Francis Imade, Yongquan Zheng, Chenxi Zhang, Oyeyemi Adigun Dada, Fuguo Xing, Liu Yang, Hairong Geng, and Tanvir Ahmad
- Subjects
Agricultural commodity ,Mycotoxin contamination ,business.industry ,QH301-705.5 ,international trade ,technology, industry, and agriculture ,food and beverages ,Review ,agricultural commodities ,Biology ,Contamination ,Microbiology ,QR1-502 ,mycotoxin ,chemistry.chemical_compound ,Agricultural science ,Infectious Diseases ,contamination ,chemistry ,parasitic diseases ,Livestock ,Biology (General) ,Mycotoxin ,business - Abstract
Mycotoxin contamination of food and feed is a major concern in sub-Sahara African countries, particularly Nigeria. It represents a significant limit to health of human, livestock as well as the international trade. Aflatoxins, fumonisins, ochratoxin, zearalenone, deoxynivalenol and beauvericin are the major mycotoxins recognised in the aetiology of food safety challenges that precipitated countless number of diseases. In Nigeria, aflatoxins and fumonisin found in nearly all crops are the most common mycotoxins of economic and health importance such as sorghum, maize and groundnuts. Thus, consumption of food contaminated with mycotoxins are inevitable, hence the need for adequate regulation is necessary in these frontier economies as done in many developed economies to ensure food safety for human and animals. In low and middle-income countries, especially Nigeria, there is lack of awareness and sufficient information on the risk associated with consequent of mycotoxin contamination on wellbeing of human, animals health and the economy. It is based on the foregoing that this paper summarized the status of mycotoxin present in Nigerian food and feeds relative to the global regulatory standards. This aimed at preventing consuming mycotoxin contaminated food stuff while confronting its associated challenges. Suggestions on some possible control strategies to mitigate vending mycotoxin food and feeds were made.
- Published
- 2021
19. Unraveling the catalytically active phase of carbon dioxide hydrogenation to methanol on Zn/Cu alloy: Single atom versus small cluster
- Author
-
Hui-Min Yan, Wei Zhang, Yang-Gang Wang, Jie Zhang, Xiao-Kuan Wu, and Guang-Jie Xia
- Subjects
Alloy ,Energy Engineering and Power Technology ,02 engineering and technology ,engineering.material ,010402 general chemistry ,021001 nanoscience & nanotechnology ,Heterogeneous catalysis ,01 natural sciences ,Decomposition ,0104 chemical sciences ,Catalysis ,Metal ,Crystallography ,chemistry.chemical_compound ,Fuel Technology ,chemistry ,visual_art ,Electrochemistry ,visual_art.visual_art_medium ,engineering ,Cluster (physics) ,Work function ,Methanol ,0210 nano-technology ,Energy (miscellaneous) - Abstract
Methanol synthesis from CO2 hydrogenation catalyzed by Zn/Cu alloy has been widely studied, but there is still debate on its catalytic active phase and whether the Zn can be oxidized during the reaction process. What is more, as Zn atoms could locate on Zn/Cu alloy surface in forms of both single atom and cluster, how Zn surface distribution affects catalytic activity is still not clear. In this work, we performed a systematic theoretical study to compare the mechanistic natures and catalytic pathways between Zn single atom and small cluster on catalyst surface, where the surface oxidation was shown to play the critical role. Before surface oxidation, the Zn single atom/Cu is more active than the Zn small cluster/Cu, but its surface oxidation is difficult to take place. Instead, after the easy surface oxidation by CO2 decomposition, the oxidized Zn small cluster/Cu becomes much more active, which even exceeds the hardly-oxidized Zn single atom/Cu to become the active phase. Further analyses show this dramatic promotion of surface oxidation can be ascribed to the following factors: i) The O from surface oxidation could preferably occupy the strongest binding sites on the center of Zn cluster. That makes the O intermediates bind at the Zn/Cu interface, preventing their too tight binding for further hydrogenation; ii) The higher positive charge and work function on the oxidized surface could also promote the hydrogenation of O intermediates. This work provided one more example that under certain condition, the metal cluster can be more active than the single atom in heterogeneous catalysis.
- Published
- 2021
20. A novel worm-like micelles@MOFs precursor for constructing hierarchically porous CoP/N-doped carbon networks towards efficient hydrogen evolution reaction
- Author
-
Gang Wang, Daoyong Chen, Xucheng Zhang, Yuanjuan Bai, Xiayun Huang, Yunlong Zou, and Yanran Li
- Subjects
Materials science ,Phosphide ,Nanoparticle ,chemistry.chemical_element ,02 engineering and technology ,Electrolyte ,010402 general chemistry ,Electrocatalyst ,01 natural sciences ,Nanocomposites ,Biomaterials ,chemistry.chemical_compound ,Colloid and Surface Chemistry ,Micelles ,Nanocomposite ,021001 nanoscience & nanotechnology ,Carbon ,0104 chemical sciences ,Surfaces, Coatings and Films ,Electronic, Optical and Magnetic Materials ,chemistry ,Chemical engineering ,Nanofiber ,0210 nano-technology ,Porosity ,Hydrogen ,Zeolitic imidazolate framework - Abstract
Constructing electrocatalysts with plentiful active sites, great mass transfer ability, and high electrical conductivity is critical to realize efficient hydrogen evolution reaction (HER). Hierarchically porous cobalt phosphide/N-doped nanotubular carbon networks (CoP/NCNs) that have all the features were fabricated in this work. For the fabrication, the polymeric worm-like micelles (PWs) with a large aspect ratio were coated by a uniform nanolayer of Zn-Co zeolitic imidazolate frameworks (Zn-Co-ZIFs) on their surface, resulting in the hybrid nanofibers PWs@Zn-Co-ZIFs (HPWs). Inheriting the randomly curved and entanglement properity of PWs, the rigid HPWs formed hybrid networks with the packing voids sized tens to 200 nm. Then, the hybrid networks were treated by pyrolysis-oxidation-phosphidation and ZnO-removal processes, leading to the hierarchically porous CoP/NCNs. In the CoP/NCNs, there are plentiful CoP nanoparticles embedded on the surface of conductive carbon network and fully exposed. When used for HER electrocatalyst, the CoP/NCNs only need small overpotentials (98 and 118 mV in acid and alkaline electrolyte) at 10 mA cm−2. This novel strategy is instructive for tailoring hierarchically porous transition metal phosphide/carbon nanocomposites as promising electrocatalysts.
- Published
- 2021
21. A novel 31bp deletion within the CDKL5 gene is significantly associated with growth traits in Dezhou donkey
- Author
-
Chuzhao Lei, Zhaofei Wang, Tingjin Chang, Fu-Wen Wang, Gang Wang, Ge Yang, Baligen Dalielihan, and Ruihua Dang
- Subjects
Genetics ,education.field_of_study ,Rump ,Population ,Bioengineering ,Biology ,chemistry.chemical_compound ,chemistry ,Molecular marker ,Genotype ,Animal Science and Zoology ,Donkey ,Indel ,education ,Gene ,Biotechnology ,Genetic association - Abstract
The discovery of molecular markers which associate with livestock economic traits is of great significance for livestock breeding. Selective analysis has found a potential correlation between CDKL5 and growth traits, but there is still a lack of experimental proof. In this study, a 31-bp deletion (g.176595_176626delATGTCACATGTGGTACTGCCATGTGGAATTT) of CDKL5 gene was found by sequencing. The 31-bp indel was then genotyped in 380 individuals of Dezhou donkeys by polyacrylamide gel electrophoresis and there were three genotypes in this population. After the association analysis between growth traits and genotypes, it was found that this 31-bp indel polymorphism was significantly associated with the chest circumference of Dezhou donkeys (p < 0.05), and body length, chest depth and rump width (p < 0.01). In addition, all individuals with DD genotype were better than those with other genotypes in growth traits. This study revealed that a newly identified polymorphic locus in the CDKL5 gene is related to growth traits, which provides a molecular marker for genetic improvement of Dezhou donkey and may lay a solid foundation for the breeding of Dezhou donkey.
- Published
- 2021
22. Mechanism-guided elaboration of ternary Au–Ti–Si sites to boost propylene oxide formation
- Author
-
Gang Wang, Jialun Xu, Xuezhi Duan, Gang Qian, Wenyao Chen, De Chen, Wei-Kang Yuan, Zhihua Zhang, Yueqiang Cao, Wei Du, and Xinggui Zhou
- Subjects
Materials science ,Silylation ,Kinetics ,Catalysis ,Silanol ,chemistry.chemical_compound ,chemistry ,Chemical engineering ,General Earth and Planetary Sciences ,Moiety ,Propylene oxide ,Selectivity ,Ternary operation ,General Environmental Science - Abstract
Summary Mechanism-guided catalyst design and engineering at the scale of active sites has been developed as a powerful tool for boosting catalytic performance. Herein, we report an efficient selective silylation strategy for the elaborate fabrication of ternary Au–Ti–Si sites to boost propylene epoxidation with H2 and O2. Kinetics (isotopic) analysis, Fourier transform infrared measurements, and theoretical calculations indicate an urgent necessity for selective consuming silanol sites not only to suppress propylene oxide (PO) ring opening to byproducts promoted by H2 spillover but also to minimize PO inhibition effects. A continuous silylation treatment was developed to encourage the kinetically favorable formation of ternary Au–Ti(–OH)–Si(–O–SiR3) moiety. This delivers significantly improved H2 efficiency of 42.5% in addition to the promising PO formation rate of 193 g h−1 kgcat−1 and PO selectivity of 95.7% with the long-term stability in excess of 200 h. These insights could pave the way for rationally fabricating catalyst active sites toward optimized performance.
- Published
- 2021
23. Altered fecal microbiota composition in individuals who abuse methamphetamine
- Author
-
Yongde Yang, Xuebing Liu, Kuan Zeng, Xuan Yu, Gang Wang, and Guangya Liu
- Subjects
Adult ,Male ,Psychosis ,media_common.quotation_subject ,Science ,Amphetamine-Related Disorders ,Diseases ,Gut flora ,Microbiology ,Article ,Methamphetamine ,chemistry.chemical_compound ,Feces ,Cognition ,medicine ,Humans ,Phylogeny ,media_common ,Principal Component Analysis ,Multidisciplinary ,biology ,business.industry ,Addiction ,Lachnospiraceae ,Age Factors ,Fusobacteria ,Meth ,Biodiversity ,Middle Aged ,medicine.disease ,biology.organism_classification ,Gastrointestinal Microbiome ,chemistry ,Schizophrenia ,Case-Control Studies ,Immunology ,Medicine ,Female ,Schizophrenic Psychology ,business ,medicine.drug - Abstract
As a severe public health problem, methamphetamine (METH) abuse places a heavy burden on families and society. A growing amount of evidence has indicated communication between gut microbiota and the CNS in drug addiction, with associations to neural, endocrine and immune pathways. Thus, we searched for alterations in the gut microbiota and their potential effects in METH users through 16S rRNA gene sequencing. A decreased Shannon index indicated lower bacterial diversity in the METH users than in the age-matched control group. The gut microbial community composition in the METH users was also altered, including reductions in Deltaproteobacteria and Bacteroidaceae abundances and increases in Sphingomonadales, Xanthomonadales, Romboutsia and Lachnospiraceae abundances. Moreover, the Fusobacteria abundance was correlated with the duration of METH use. Enterobacteriaceae, Ruminococcaceae, Bacteroides, and Faecalibacterium had statistically significant correlations with items related to the positive and negative symptoms of schizophrenia and to general psychopathology in the METH users, and all have previously been reported to be altered in individuals with psychotic syndromes, especially depression. Abstraction, one of the items of the cognitive assessment, was positively related to Blautia. These findings revealed alterations in the gut microbiota of METH users, and these alterations may play a role in psychotic syndrome and cognitive impairment. Although the mechanisms behind the links between these disorders and METH abuse are unknown, the relationships may indicate similarities in the pathogenesis of psychosis induced by METH abuse and other causes, providing a new paradigm for addiction and METH use disorder treatment.
- Published
- 2021
24. Lithium chloride prevents glucocorticoid-induced osteonecrosis of femoral heads and strengthens mesenchymal stem cell activity in rats
- Author
-
Yue-Lei Zhang, Zhen-Zhong Zhu, Le-Cheng Zhang, Gang Wang, and Li-Shao Guo
- Subjects
medicine.medical_specialty ,Lithium (medication) ,Proliferation ,H&E stain ,Lithium ,Rats, Sprague-Dawley ,chemistry.chemical_compound ,Femur Head Necrosis ,Osteogenesis ,Osteogenic differentiation ,Internal medicine ,medicine ,Animals ,Glucocorticoids ,ONFH ,biology ,Chemistry ,Mesenchymal stem cell ,Cell Differentiation ,Femur Head ,Mesenchymal Stem Cells ,X-Ray Microtomography ,Original Articles ,General Medicine ,Rats ,Bone marrow-derived mesenchymal stem cell ,Endocrinology ,Osteocalcin ,biology.protein ,Lithium chloride ,Alkaline phosphatase ,Medicine ,Osteonecrosis of femoral heads ,Lithium Chloride ,Ex vivo ,Glucocorticoid ,medicine.drug - Abstract
Background:. Accumulating evidence suggests that lithium influences mesenchymal stem cell (MSC) proliferation and osteogenic differentiation. As decreased bone formation in femoral heads is induced by glucocorticoids (GCs), we hypothesized that lithium has a protective effect on GC-induced osteonecrosis of femoral heads (ONFH). Methods:. A rat ONFH model was induced by methylprednisolone (MP) and the effect of lithium chloride on the models was evaluated. Micro-computed tomography (CT)-based angiography and bone scanning were performed to analyze the vessels and bone structure in the femoral heads. Hematoxylin and eosin and immunohistochemical staining were performed to evaluate the trabecular structure and osteocalcin (OCN) expression, respectively. Bone marrow-derived MSCs were isolated from the models, and their proliferative and osteogenic ability was evaluated. Western blotting and quantitative real-time polymerase chain reaction were performed to detect osteogenic-related proteins including Runx2, alkaline phosphatase, and Collagen I. Results:. Micro-CT analysis showed a high degree of osteonecrotic changes in the rats that received only MP injection. Treatment with lithium reduced this significantly in rats that received lithium (MP + Li group); while 18/20 of the femoral heads in the MP showed severe osteonecrosis, only 5/20 in the MP + Li showed mild osteonecrotic changes. The MP + Li group also displayed a higher vessel volume than the MP group (0.2193 mm3vs. 0.0811 mm3, P
- Published
- 2021
25. Engineering heterointerfaces coupled with oxygen vacancies in lanthanum–based hollow microspheres for synergistically enhanced oxygen electrocatalysis
- Author
-
Jie Zhang, Honggang Liu, Yan Luo, Chenyang Zhang, Yihan Chen, Gang Wang, Jinwei Chen, Yingjian Luo, Yali Xue, and Ruilin Wang
- Subjects
Materials science ,Oxygen evolution ,Oxide ,Energy Engineering and Power Technology ,chemistry.chemical_element ,02 engineering and technology ,010402 general chemistry ,021001 nanoscience & nanotechnology ,Electrocatalyst ,01 natural sciences ,Oxygen ,0104 chemical sciences ,Catalysis ,chemistry.chemical_compound ,Fuel Technology ,chemistry ,Lanthanum oxide ,Chemical engineering ,Electrochemistry ,Lanthanum ,0210 nano-technology ,Bifunctional ,Energy (miscellaneous) - Abstract
The development of high–efficiency and low–cost bifunctional oxygen electrocatalysts is critical to enlarge application of zinc–air batteries (ZABs). However, it still remains challenges due to their uncontrollable factor at atomic level during the catalysts preparation, which requires the precise regulation of active sites and structure engineering to accelerate the reaction kinetics for both oxygen reduction reaction (ORR) and oxygen evolution reaction (OER). Herein, a novel Co–doped mixed lanthanum oxide and hydroxide heterostructure (termed as Co–LaMOH|OV@NC) was synthesized by pyrolysis of La–MOF–NH2 with spontaneous cobalt doping. Synergistic coupling of its hollow structure, doping effect and abundant oxygen vacancies creates more active sites and leads to higher electroconductivity, which contribute to the better performance. As employed as a bifunctional oxygen electrocatalyst, the resulting 3Co–LaMOH|OV@NC exhibits superior electrocatalytic activity for both ORR and OER. In assembled ZAB, it also demonstrates an excellent power density of 110.5 mW cm−2, high specific capacity of 810 mAh gZn−1, and good stability over 100 h than those of Pt/C + RuO2. Density functional theory (DFT) calculation reveals that the heterointerfaces coupled with oxygen vacancies lead to an enhanced charge state and electronic structure, which may optimize the conductivity, charge transfer, and the reaction process of catalysts. This study provides a new strategy for designing highly efficient bifunctional oxygen electrocatalysts based on rare earth oxide and hydroxides heterointerface.
- Published
- 2021
26. Effects of dietary citrus extract on growth performance, carcass characteristics and meat quality of pigs
- Author
-
Liu Zhichang, Gang Wang, Weidong Chen, Tian Zhimei, Cui Yiyan, Xianyong Ma, and Deng Dun
- Subjects
Chlortetracycline ,Citrus ,Meat ,Swine ,food and beverages ,Superoxide dismutase activity ,Biology ,Malondialdehyde ,Free amino ,Animal Feed ,Diet ,chemistry.chemical_compound ,Animal science ,Food Animals ,chemistry ,Body Composition ,medicine ,Animals ,Female ,Animal Science and Zoology ,Intramuscular fat ,medicine.drug - Abstract
This study investigated the effects of citrus extract on growth, carcass and meat quality of Duroc × Landrace × Large White pigs. One hundred and eight pigs (54 barrows, 54 females) were assigned to one of three dietary treatments for 138 days. The dietary treatments were (1) basic diet; (2) basic diet supplemented with 75 mg/kg chlortetracycline; and (3) basic diet supplemented with citrus extract (0.25 ml/kg during 56-112 days of age and 0.20 ml/kg during 113-194 days of age). No significant differences among treatments were found for growth performance, carcass characteristics, meat quality and free amino acids (p > 0.05). Feeding citrus extract tended to increase intramuscular fat (p = 0.052). Citrus extract and chlortetracycline increased C15:0 concentration (p = 0.016) and superoxide dismutase activity (p = 0.004). The pigs that received chlortetracycline exhibited the lowest (p = 0.033) muscle malondialdehyde concentration. Overall, citrus extract ameliorated some meat quality indicators without adverse effects on pig growth or carcass performance.
- Published
- 2021
27. Metformin alleviates hydrogen peroxide–induced inflammation and oxidative stress via inhibiting P2X7R signaling in spinal cord tissue cells neurons
- Author
-
Wei Wang, Yankun Li, Shurui Chen, Xifan Mei, Liang Mao, Zhenya Shao, Gang Wang, and Jian Li
- Subjects
0301 basic medicine ,Physiology ,Inflammation ,Pharmacology ,medicine.disease_cause ,Neuroprotection ,03 medical and health sciences ,chemistry.chemical_compound ,0302 clinical medicine ,Physiology (medical) ,medicine ,Hydrogen peroxide ,Mechanism (biology) ,business.industry ,Type 2 Diabetes Mellitus ,Hydrogen Peroxide ,General Medicine ,Spinal cord ,Metformin ,Oxidative Stress ,030104 developmental biology ,medicine.anatomical_structure ,chemistry ,medicine.symptom ,business ,030217 neurology & neurosurgery ,Oxidative stress ,medicine.drug - Abstract
Metformin, the first medication that is often prescribed for the treatment of type 2 diabetes mellitus, was recently found to be neuroprotective. To study the mechanism underlying the neuroprotective effect of metformin, we pretreated primary spinal cord neurons with 50 µM or 100 µM metformin for 2 h prior to treatment with hydrogen peroxide (H2O2) for up to 48 h. Our results showed that H2O2 increased the expression of purinergic receptor P2X7 (P2X7R) in spinal cord neurons, which promoted the downstream pro-inflammatory cytokines release and oxidative stress. We found that metformin could reverse these pro-inflammatory and pro-oxidative effects of H2O2. Besides, P2X7R knockdown by siRNA suppressed H2O2-induced pro-inflammatory cytokine release and oxidative stress response. In conclusion, our results show that metformin can alleviate H2O2-induced inflammation and oxidative stress via modulating the P2X7R signaling pathway.
- Published
- 2021
28. MicroRNA-133a Regulates the Viability and Differentiation Fate of Bone Marrow Mesenchymal Stem Cells via MAPK/ERK Signaling Pathway by Targeting FGFR1
- Author
-
Yuelei Zhang, Chao Yan, Gang Wang, Lifu Wan, and Lecheng Zhang
- Subjects
0301 basic medicine ,MAPK/ERK pathway ,Cell Survival ,MAP Kinase Signaling System ,Bone Marrow Cells ,Biology ,Mice ,03 medical and health sciences ,chemistry.chemical_compound ,0302 clinical medicine ,microRNA ,Adipocytes ,Genetics ,medicine ,Animals ,Humans ,Antagomir ,Receptor, Fibroblast Growth Factor, Type 1 ,Viability assay ,Protein kinase A ,Molecular Biology ,Cells, Cultured ,Osteoporosis, Postmenopausal ,Osteoblasts ,Kinase ,Cell growth ,Antagomirs ,Cell Differentiation ,Mesenchymal Stem Cells ,Osteoblast ,Cell Biology ,General Medicine ,Cell biology ,Mice, Inbred C57BL ,MicroRNAs ,030104 developmental biology ,medicine.anatomical_structure ,chemistry ,030220 oncology & carcinogenesis ,Female - Abstract
Dysfunction of bone marrow mesenchymal stem cells (BMSCs) is recognized critical in bone deteriorations of osteoporosis. However, the specific mechanisms that determine the fate of BMSCs remain elusive. MicroRNA-133a (miR-133a), a highly conserved microRNA, was investigated under both in vitro and in vivo conditions. In the in vitro study, cell proliferation, cell apoptosis, and osteoblast/adipocyte differentiation of BMSCs as a result of overexpression or knockdown of miR-133a was investigated. In the in vivo study, the ovariectomy (OVX) model was applied on mice, with further treatment of the models with BMSC-specific miR-133a antagomir through femur intramedullary injection. Microcomputed tomography scanning and histological analysis of the proximal and middle femur were performed to evaluate the morphological changes. The results revealed that overexpression of miR-133a suppressed cell proliferation, cell viability, and osteoblast differentiation of BMSCs, but increased adipocyte differentiation. We also found that FGFR1, an important upstream regulator of mitogen-activated protein kinase/extracellular signal-regulated kinase (MAPK/ERK) signal pathway, was a major target of miR-133a. We also recorded that BMSC-specific knockdown of miR-133a attenuates bone loss in OVX mice. Our study suggested that miR-133a played an important role in maintaining the viability and balance between osteoblast and adipocyte differentiation of BMSCs through the MAPK/ERK signaling pathway by targeting FGFR1.
- Published
- 2021
29. Phosphoric acid modified Al-TUD-1 material to enhance hydrodesulfurization activities of dibenzothiophene and FCC diesel
- Author
-
Aijun Duan, Di Hu, Jinlin Mei, Guiyuan Jiang, Gang Wang, Chengkun Xiao, Jian Liu, Yu Shi, and Peng Zheng
- Subjects
02 engineering and technology ,General Chemistry ,010402 general chemistry ,021001 nanoscience & nanotechnology ,Fluid catalytic cracking ,01 natural sciences ,Catalysis ,0104 chemical sciences ,Diesel fuel ,chemistry.chemical_compound ,chemistry ,Dibenzothiophene ,Specific surface area ,Hydrodenitrogenation ,0210 nano-technology ,Phosphoric acid ,Hydrodesulfurization ,Nuclear chemistry - Abstract
Al-TUD-1 (AT) material was successfully prepared via sol-gel method and modified by phosphoric acid. A series characterization of NiMoP/AT catalysts results indicated that after the addition of phosphoric acid, the NiMoP/AT-x series catalysts still retained the large specific surface area and pore structure, which accommodated the active metals for better dispersion. Phosphoric acid could effectively ameliorate the acidity of catalyst and modulate metal-support-interaction (MSI), then the molybdenum species were sulfided to transform into octahedral MoS2 active species with higher degree of sulfurization and dispersion degree. Catalytic performances of different catalysts were estimated using Dibenzothiophene (DBT) and Fluid Catalytic Cracking (FCC) diesel as feedstock, The NiMoP/AT-2 exhibited the maximal DBT hydrodesulfurization (HDS) efficiency of 98.6 % and the highest values of HDS (99.1 %) and hydrodenitrogenation (HDN) (98.5 %) efficiencies for FCC diesel.
- Published
- 2021
30. Characterization of fragment sizes, copy number aberrations and 4‐mer end motifs in cell‐free DNA of hepatocellular carcinoma for enhanced liquid biopsy‐based cancer detection
- Author
-
Yang Liu, Jiyan Yu, Shaogui Wan, Hongping Li, Jinliang Xing, Chao Jin, Liping Su, Fei Xu, Jiayun Liu, Dengke Bao, Xiaoming Gu, Xu Guo, Xiaonan Liu, Bo Xu, Qiong Zhang, Xiaohuan Lai, Wenyuan Zheng, and Gang Wang
- Subjects
Hepatitis B virus ,Cancer Research ,Carcinoma, Hepatocellular ,DNA Copy Number Variations ,Hepacivirus ,Cancer detection ,Biology ,medicine.disease_cause ,chemistry.chemical_compound ,Biomarkers, Tumor ,Genetics ,medicine ,Humans ,Copy-number variation ,Liquid biopsy ,fragment sizes ,RC254-282 ,Research Articles ,circulating cell‐free DNA ,Whole Genome Sequencing ,Liver Neoplasms ,copy number variation ,Liquid Biopsy ,Neoplasms. Tumors. Oncology. Including cancer and carcinogens ,Cancer ,hepatocellular carcinoma ,General Medicine ,tumor fraction ,medicine.disease ,Molecular biology ,digestive system diseases ,Circulating Cell-Free DNA ,Oncology ,chemistry ,Hepatocellular carcinoma ,Molecular Medicine ,Cell-Free Nucleic Acids ,end motifs ,DNA ,Research Article - Abstract
Circulating cell‐free DNA (cfDNA) fragmentomics, which encompasses the measurement of cfDNA length and short nucleotide motifs at the ends of cfDNA molecules, is an emerging field for cancer diagnosis. The utilization of cfDNA fragmentomics for the diagnosis of patients with hepatocellular carcinoma (HCC) caused by hepatitis B virus (HBV) is currently limited. In this study, we utilized whole‐genome sequencing data of cfDNA in samples from patients with HCC (n = 197) and HBV (n = 187) to analyze the association of fragment size selection (, Circulating cell‐free DNA (cfDNA) fragmentomics, encompassing the measurement of cfDNA length and short nucleotide motifs at cfDNA ends, is an emerging field in cancer diagnostics. In this study, we utilized whole‐genome sequencing data of cfDNA in patients with hepatocellular carcinoma (HCC). We observed that representative abnormal copy number variation (CNV) alterations and shorter fragment size (
- Published
- 2021
31. NiCo2S4 microspheres grown on N, S co-doped reduced graphene oxide as an efficient bifunctional electrocatalyst for overall water splitting in alkaline and neutral pH
- Author
-
Jianxiang Pang, Yulin Shi, Li Haoquan, Long Chen, Juan Hou, Jin Pengfei, Yafei Li, Gang Wang, and Shanglong Peng
- Subjects
Materials science ,Graphene ,Inorganic chemistry ,Oxygen evolution ,Oxide ,Condensed Matter Physics ,Electrochemistry ,Electrocatalyst ,Atomic and Molecular Physics, and Optics ,law.invention ,Catalysis ,chemistry.chemical_compound ,chemistry ,law ,Water splitting ,General Materials Science ,Electrical and Electronic Engineering ,Bifunctional - Abstract
It is of vital importance to design efficient and low-cost bifunctional catalysts for the electrochemical water splitting under alkaline and neutral pH conditions. In this work, we report an efficient and stable NiCo2S4/N, S co-doped reduced graphene oxide (NCS/NS-rGO) electrocatalyst for water splitting, in which NCS microspheres are composed of one-dimentional (1D) nanorods grown homogeneously on the surface of NS-rGOs). The synergetic effect, abundant active sites, and hybridization of NCS/NS-rGO endow their outstanding electrocatalytic performance for hydrogen evolution reaction (HER) and oxygen evolution reaction (OER) in both alkaline and neutral conditions. Furthermore, NCS/NS-rGO employed as both anode and cathode in a two-electrode alkaline and neutral system electrolyzers deliver 10 mA/cm2 with the low cell voltage of 1.58 V in alkaline and 1.91 V in neutral condition. These results illustrate the rational design of carbon-supported nickel-cobalt based bifunctional materials for practical water splitting over a wide pH range.
- Published
- 2021
32. Effects of Confinement and Ion Adsorption in Ionic Liquid Supercapacitors with Nanoporous Electrodes
- Author
-
Huikuan Chao, Zhen-Gang Wang, and Zengju Lian
- Subjects
Supercapacitor ,Materials science ,Nanoporous ,General Engineering ,General Physics and Astronomy ,Critical value ,Capacitance ,Ion ,Quantitative Biology::Subcellular Processes ,chemistry.chemical_compound ,Transition point ,chemistry ,Chemical physics ,Ionic liquid ,Electrode ,General Materials Science - Abstract
We investigate the effects of pore size and ion adsorption on the room-temperature ionic liquid capacitor with nanoporous electrodes, with a focus on optimizing the capacitance and energy storage. Using a recently developed modified BSK model accounting for both ion correlations and nonelectrostatic interactions, we find that ion crowding proximate to the electrode surface induced by the spontaneous charge separation due to strong ion correlations is responsible for the anomalous increase in the capacitance with decreasing pore sizes observed in experiments. Reducing the strength of ion correlations increases the capacitance and suppresses the anomalous size dependence. For a given pore size, the capacitance peak diverges when the ion correlation strength α reaches a critical value, α_(sc,L). The capacitance peak shifts to smaller pore size as α decreases because of rapid decrease of α_(sc,L) with decreasing pore size. Asymmetric preferential ion adsorption is shown to lead to significantly enhanced energy storage close to the transition point for any pore sizes. For a given correlation strength, the energy storage is optimal at a pore size where α = α_(sc,L).
- Published
- 2021
33. Evolution in properties of high alumina castables containing basic zinc carbonate
- Author
-
Quanli Jia, Gang Wang, Yuandong Mu, Xiaoyu Wang, Ye Li, Liugang Chen, and Liu Guo
- Subjects
010302 applied physics ,Cement ,Materials science ,Scanning electron microscope ,Process Chemistry and Technology ,Aluminate ,Energy-dispersive X-ray spectroscopy ,chemistry.chemical_element ,02 engineering and technology ,Zinc ,021001 nanoscience & nanotechnology ,Microstructure ,01 natural sciences ,Surfaces, Coatings and Films ,Electronic, Optical and Magnetic Materials ,chemistry.chemical_compound ,chemistry ,Flexural strength ,Chemical engineering ,0103 physical sciences ,Materials Chemistry ,Ceramics and Composites ,Carbonate ,0210 nano-technology - Abstract
To improve the properties of high alumina castables containing calcium aluminate cement (CAC) after firing at elevated temperatures, micro-sized basic zinc carbonate (BZC) was introduced as ZnO-based nano fragments into castables. To account for the influence of BZC on the evolution of castable properties, the phase composition and microstructure of castable matrices were examined with X-ray diffraction and scanning electron microscopy equipped with energy dispersive spectroscopy, respectively. Properties of castables having BZC were compared with those with Zn(OH)2. Results show that strength of castables added with BZC after firing at both medium temperatures and 1550 °C was improved. The volume stability and hot modulus of rupture at 1550 °C of fired castables containing BZC were also enhanced.
- Published
- 2021
34. Study on Preparation of BiFeO3/Bi2Fe4O9 Composite Photocatalyst and Photocatalytic Degradation of Various Organic Dyes in Waste Water
- Author
-
Ping-an Gao, Xiao-wei Li, Gang Li, Fu-gang Wang, and Li Tian
- Subjects
chemistry.chemical_compound ,chemistry ,Methyl blue ,Methyl red ,Composite number ,Photocatalysis ,Methyl orange ,Rhodamine B ,Physical and Theoretical Chemistry ,Congo red ,Nuclear chemistry ,Catalysis - Abstract
BiFeO3/Bi2Fe4O9 composite photocatalyst was prepared by one-step sol–gel method. The phase structure, morphology, optical properties and photocatalytic activity of Bi2Fe4O9 and BiFeO3/Bi2Fe4O9 composite photocatalyst have been systematically studied. The introduction of excessive Bi and Fe nitrate into Bi photocatalyst effectively enhanced the light absorption capacity of BiFeO3/Bi2Fe4O9 composite photocatalyst. The effects substrate nature on photocatalytic activity of BiFeO3/Bi2Fe4O9 composite photocatalyst were studied with methyl orange (MO), methyl blue (MB), rhodamine B (RhB), methyl red (MR), acid red (AR), and Congo red (CR) as the target degradation dyes. The effects of dye concentration, catalyst content and pH on photocatalytic activity of BiFeO3/Bi2Fe4O9 composite photocatalyst were systematically studied with methyl orange as the main degradation dye. Photocatalytic experiments showed that the optimal dye concentration, catalyst content, and pH value were 15 mg/L, 20 mg/L, and 5, respectively. In the whole photocatalytic reaction process, hole, and hydroxyl radical play the most important role.
- Published
- 2021
35. Lattice oxygen self-spillover on reducible oxide supported metal cluster
- Author
-
Shujiang Ding, Guang Jie Xia, Ya Qiong Su, Yanyang Qin, Yang-Gang Wang, and Inorganic Materials & Catalysis
- Subjects
Reaction mechanism ,chemistry.chemical_compound ,Materials science ,chemistry ,Cluster (physics) ,Oxide ,Density functional theory ,General Chemistry ,Photochemistry ,Dissociation (chemistry) ,Water-gas shift reaction ,Catalysis ,Nanoclusters - Abstract
In this work we have tackled one of the most challenging problems in nanocatalysis namely understanding the role of reducible oxide supports in metal catalyzed reactions. As a prototypical example, the very well-studied water gas shift reaction catalyzed by CeO2supported Cu nanoclusters is chosen to probe how the reducible oxide support modifies the catalyst structures, catalytically active sites and even the reaction mechanisms. By employing density functional theory calculations in conjunction with a genetic algorithm andab initiomolecular dynamics simulations, we have identified an unprecedented spillover of the surface lattice oxygen from the ceria support to the Cu cluster, which is rarely considered previously but may widely exist in oxide supported metal catalysts under realistic conditions. The oxygen spillover causes a highly energetic preference of the monolayered configuration of the supported Cu nanocluster, compared to multilayered configurations. Due to the strong metal-oxide interaction, after the O spillover the monolayered cluster is highly oxidized by transferring electrons to the Ce 4f orbitals. The water-gas-shift reaction is further found to more favorably take place on the supported copper monolayer than the copper-ceria periphery, where the on-site oxygen and the adjacent oxidized Cu sites account for the catalytically active sites, synergistically facilitating the water dissociation and the carboxyl formation. The present work provides mechanistic insights into the strong metal-support interaction and its role in catalytic reactions, which may pave a way towards the rational design of metal-oxide catalysts with promising stability, dispersion and catalytic activity.
- Published
- 2021
36. Dual-Phase Emission AIEgen with ICT Properties for VOC Chromic Sensing
- Author
-
Wan Fang, Haonan Peng, Taihong Liu, Gang Wang, Rongrong Huang, Liping Ding, Yuzhe Liang, Yu Fang, Ke Liu, and Junxia Peng
- Subjects
Quenching (fluorescence) ,Fluorophore ,010401 analytical chemistry ,010402 general chemistry ,Photochemistry ,01 natural sciences ,Emission intensity ,Fluorescence ,0104 chemical sciences ,Analytical Chemistry ,chemistry.chemical_compound ,chemistry ,Intramolecular force ,Phase (matter) ,Pyrene ,Luminescence - Abstract
In a film-based fluorescence sensor, luminogens are of vital importance since they play the role of probes or indicators. Traditional organic luminogens like pyrene show high luminescence quantum yields in dilute solutions, but their applications are usually limited by the aggregation-caused quenching (ACQ) effect and bad photochemical stability. Thus, this paper reports a novel aggregation-induced emission luminogen (AIEgen) containing both pyrene and o-carborane (CB-PY), which possesses unique dual-phase emission both in solution and solid state and intramolecular charge transfer (ICT) properties, fulfilling the gap between ACQ and AIE compounds. Importantly, the fluorophore presents extraordinary stability that there was almost no attenuation in the emission intensity of CB-PY in the solid state after 4 months of exposure at ambient conditions. It is these merits that make CB-PY exhibit outstanding sensing performances for volatile organic compounds (VOCs), where the fluorescence test strip shows fast, reversible, and visual discrimination of four organic solvents with varied polarities. Moreover, 92#, 95#, and 98# gasolines could be discriminated with CB-PY, showing different colors under UV illumination.
- Published
- 2021
37. The relationship between serum lactate dehydrogenase level and mortality in critically ill patients
- Author
-
Gang Wang, Jingjing Zhang, Xuting Jin, Jiajia Ren, Jiamei Li, Ruohan Li, Ya Gao, and Dan Su
- Subjects
Male ,medicine.medical_specialty ,Critical Illness ,Clinical Biochemistry ,Logistic regression ,Risk Assessment ,law.invention ,Sepsis ,03 medical and health sciences ,chemistry.chemical_compound ,0302 clinical medicine ,law ,Lactate dehydrogenase ,Internal medicine ,Drug Discovery ,medicine ,Humans ,Hospital Mortality ,030212 general & internal medicine ,Lactate Dehydrogenases ,Aged ,Retrospective Studies ,Critically ill ,business.industry ,Biochemistry (medical) ,Middle Aged ,Prognosis ,medicine.disease ,Intensive care unit ,Survival Rate ,Intensive Care Units ,chemistry ,Quartile ,Health evaluation ,030220 oncology & carcinogenesis ,Female ,business ,Biomarkers ,Follow-Up Studies ,Serum lactate dehydrogenase level - Abstract
Background: To assess the association between serum lactate dehydrogenase (LDH) levels and mortality in intensive care unit patients. Materials & methods: A total of 1981 patients in the eICU Collaborative Research Database were divided into four groups according to quartiles of LDH levels. Logistic regressions were performed. Results: Elevated LDH levels were significantly associated with higher mortality (intensive care unit mortality: Q2 vs Q1: 1.046 [0.622–1.758]; Q3 vs Q1: 1.667 [1.029–2.699]; and Q4 vs Q1: 1.760 [1.092–2.839]). Similar results persisted in patients with different acute physiology and chronic health evaluation IV scores, and with or without sepsis. Conclusion: The serum LDH level may aid in the early identification of mortality risk in critically ill patients.
- Published
- 2021
38. Production of lactic and acetic acids during fermentation of milk fortified with kiwi juice using Saccharomyces boulardii and lactobacilli
- Author
-
Hao Zhang, Ahmed Hassan Mousa, and Gang Wang
- Subjects
food.ingredient ,biology ,Inoculation ,Chemistry ,food and beverages ,Pharmaceutical Science ,Kiwi juice ,biology.organism_classification ,Acid production ,Lactic acid ,Acetic acid ,chemistry.chemical_compound ,fluids and secretions ,food ,Skimmed milk ,Pharmacology (medical) ,Fermentation ,Food science ,Saccharomyces boulardii - Abstract
Purpose: To investigate the synergistic effect of Saccharomyces boulardii and lactobacilli on lactic and acetic acids produced during fermentation of milk fortified with kiwi juice, relative to fermentation of unfortified milk. Methods: Skimmed milk was fortified with kiwi juice (4 % v/v) and fermented for 12 h at 37 °C by a combination of S. boulardii and lactobacilli strains. Lactic and acetic acids were determined using gas chromatography-mass spectrometry (GS-MS). Results: The presence of kiwi juice in the milk stimulated the production of lactic (1.35 g/100g) and acetic (0.29 mg/g) by S. boulardii in the absence of lactobacilli. When S. boulardii was inoculated with Lb. casei 20975, the production of lactic acid and acetic acid increased to 2.36 g/100 g and 0.71 mg/g, respectively. Furthermore, acid production increased when Lb. plantarum RS (35-11), Lb. casei LCS, and Lb. plantarum JXJ (6 - 12) were inoculated into milk free of kiwi juice in which S. boulardii was grown. Saccharomyces boulardii resulted in marginal production of acids by Lb. fermentum F9. Conclusion: These results show that acid production is positively affected by some lactobacilli strains in the milk whether fortified with kiwi juice or free of this juice. However, fermentation of these formulations for a period longer than 6 h may result in losses in acid yield.
- Published
- 2021
39. Increased Reactive Oxygen Species–Mediated Ca 2+ /Calmodulin-Dependent Protein Kinase II Activation Contributes to Calcium Handling Abnormalities and Impaired Contraction in Barth Syndrome
- Author
-
Yuxuan Guo, Michael Schlame, Sofia de la Serna Buzon, Donghui Zhang, Fujian Lu, Gang Wang, William T. Pu, Maksymilian Prondzynski, Suya Wang, Ling Xiao, Xujie Liu, David J. Milan, Yifei Li, Vassilios J. Bezzerides, Xiaoling Guo, Yang Xu, Justin Cotton, Roza Ogurlu, and Qing Ma
- Subjects
0303 health sciences ,Contraction (grammar) ,biology ,business.industry ,Cardiomyopathy ,Tafazzin ,Barth syndrome ,030204 cardiovascular system & hematology ,medicine.disease ,Cell biology ,03 medical and health sciences ,chemistry.chemical_compound ,0302 clinical medicine ,chemistry ,Physiology (medical) ,Ca2+/calmodulin-dependent protein kinase ,medicine ,biology.protein ,Cardiolipin ,Cardiology and Cardiovascular Medicine ,business ,Inner mitochondrial membrane ,Biogenesis ,030304 developmental biology - Abstract
Background: Mutations in tafazzin ( TAZ ), a gene required for biogenesis of cardiolipin, the signature phospholipid of the inner mitochondrial membrane, causes Barth syndrome (BTHS). Cardiomyopathy and risk of sudden cardiac death are prominent features of BTHS, but the mechanisms by which impaired cardiolipin biogenesis causes cardiac muscle weakness and arrhythmia are poorly understood. Methods: We performed in vivo electrophysiology to define arrhythmia vulnerability in cardiac-specific TAZ knockout mice. Using cardiomyocytes derived from human induced pluripotent stem cells and cardiac-specific TAZ knockout mice as model systems, we investigated the effect of TAZ inactivation on Ca 2+ handling. Through genome editing and pharmacology, we defined a molecular link between TAZ mutation and abnormal Ca 2+ handling and contractility. Results: A subset of mice with cardiac-specific TAZ inactivation developed arrhythmias, including bidirectional ventricular tachycardia, atrial tachycardia, and complete atrioventricular block. Compared with wild-type controls, BTHS-induced pluripotent stem cell–derived cardiomyocytes had increased diastolic Ca 2+ and decreased Ca 2+ transient amplitude. BTHS-induced pluripotent stem cell–derived cardiomyocytes had higher levels of mitochondrial and cellular reactive oxygen species than wild-type controls, which activated CaMKII (Ca 2+ /calmodulin-dependent protein kinase II). Activated CaMKII phosphorylated the RYR2 (ryanodine receptor 2) on serine 2814, increasing Ca 2+ leak through RYR2. Inhibition of this reactive oxygen species–CaMKII–RYR2 pathway through pharmacological inhibitors or genome editing normalized aberrant Ca 2+ handling in BTHS-induced pluripotent stem cell–derived cardiomyocytes and improved their contractile function. Murine Taz knockout cardiomyocytes also exhibited elevated diastolic Ca 2+ and decreased Ca 2+ transient amplitude. These abnormalities were ameliorated by Ca 2+ /calmodulin-dependent protein kinase II or reactive oxygen species inhibition. Conclusions: This study identified a molecular pathway that links TAZ mutation with abnormal Ca 2+ handling and decreased cardiomyocyte contractility. This pathway may offer therapeutic opportunities to treat BTHS and potentially other diseases with elevated mitochondrial reactive oxygen species production.
- Published
- 2021
40. Sensitive, Reusable, Surface-Enhanced Raman Scattering Sensors Constructed with a 3D Graphene/Si Hybrid
- Author
-
Gang Wang, Wei Zhu, Siwei Yang, Zhiduo Liu, Qinglei Guo, Peng He, Guqiao Ding, Menghan Zhao, Da Chen, Xiaoqiang Feng, and Shiwei Tang
- Subjects
Materials science ,Silicon ,Graphene ,chemistry.chemical_element ,Heterojunction ,02 engineering and technology ,010402 general chemistry ,021001 nanoscience & nanotechnology ,Photochemistry ,01 natural sciences ,0104 chemical sciences ,law.invention ,Rhodamine 6G ,chemistry.chemical_compound ,symbols.namesake ,chemistry ,law ,Rhodamine B ,Phthalocyanine ,symbols ,Molecule ,General Materials Science ,0210 nano-technology ,Raman scattering - Abstract
Surface-enhanced Raman scattering (SERS) substrates based on graphene and its derivatives have recently attracted attention among those interested in the detection of trace molecules; however, these substrates generally show poor uniformity, an unsatisfactory enhancement factor, and require a complex fabrication process. Herein, we design and fabricate three-dimensional (3D) graphene/silicon (3D-Gr/Si) heterojunction SERS substrates to detect various types of molecules. Notably, the detection limit of 3D-Gr/Si can reach 10-10 M for rhodamine 6G (R6G) and rhodamine B (RB), 10-7 M for crystal violet (CRV), copper(II) phthalocyanine (CuPc), and methylene blue (MB), 10-8 M for dopamine (DA), 10-6 M for bovine serum albumin (BSA), and 10-5 M for melamine (Mel), which is superior to most reported graphene-based SERS substrates. Besides, the proposed 3D-Gr/Si heterojunction SERS substrates can achieve a high uniformity with relative standard deviations (RSDs) of less than 5%. Moreover, the 3D-Gr/Si SERS substrates are reusable after washing with ethyl alcohol to remove the adsorbed molecules. These excellent SERS performances are attributed to the novel 3D structure and abundantly exposed atomically thin edges, which facilitate charge transfer between 3D-Gr and probe molecules. We believe that the 3D-Gr/Si heterojunction SERS substrates offer potential for practical applications in biochemical molecule detection and provide insight into the design of high-performance SERS substrates.
- Published
- 2021
41. Transcriptome analysis of immune-related genes in Sesarmops sinensis hepatopancreas in reaction to peptidoglycan challenge
- Author
-
Mei-Ling Zhang, Qiu-Ning Liu, Ying-Yu Tang, Si-Pei Zhang, Bo-Ping Tang, Jiang Senhao, Gang Wang, Bao-Ming Ge, Chun-Lin Zhou, Yue-Tian Li, and Dai-Zhen Zhang
- Subjects
0106 biological sciences ,Brachyura ,Hepatopancreas ,Stimulation ,Peptidoglycan ,Biology ,01 natural sciences ,Immune related genes ,Transcriptome ,03 medical and health sciences ,chemistry.chemical_compound ,Immune system ,Genetics ,Animals ,Gene ,Pathogen ,Ecosystem ,030304 developmental biology ,0303 health sciences ,Gene Expression Profiling ,biology.organism_classification ,chemistry ,010606 plant biology & botany - Abstract
Sesarmops sinensis is a dominant omnivorous crab species, which plays an important ecological function in salt marsh ecosystems. To better understand its immune system and immune related genes under pathogen infection, the transcriptome was analyzed by comparing the data of S. sinensis hepatopancreas stimulated by PBS and PGN. A set of assembly and annotation identified 39,039 unigenes with an average length of 1105 bp, obtaining 1300 differentially expressed genes (DEGs) in all, which included 466 remarkably up-regulated unigenes and 834 remarkably down-regulated unigenes. In addition, based on mensurable real time-polymerase chain reaction and high-throughput sequencing, several immune responsive genes were found to be markedly up-regulated under PGN stimulation. In conclusion, in addition to enriching the existing transcriptome data of S. sinensis, this study also clarified the immune response of S. sinensis to PGN stimulation, which will help us to further understand the crustacean's immune system.
- Published
- 2021
42. Bi-functional electrocatalysis through synergetic coupling strategy of atomically dispersed Fe and Co active sites anchored on 3D nitrogen-doped carbon sheets for Zn-air battery
- Author
-
Yingjian Luo, Yihan Chen, Jie Zhang, Chenyang Zhang, Gang Wang, Yan Luo, Ruilin Wang, and Jinwei Chen
- Subjects
010405 organic chemistry ,Chemistry ,Oxygen evolution ,chemistry.chemical_element ,010402 general chemistry ,Electrocatalyst ,Electrochemistry ,01 natural sciences ,Catalysis ,0104 chemical sciences ,chemistry.chemical_compound ,Chemical engineering ,Density functional theory ,Physical and Theoretical Chemistry ,Bifunctional ,Carbon ,Zeolitic imidazolate framework - Abstract
Single atom catalysts (SACs) with unique structure gain much interest in the field of electrocatalysis and show a broad application prospect in long-life rechargeable Zn-air batteries. However, ingenious design and preparation of bi-metal SACs is still difficult to further enhance the bifunctional electrocatalytic activity. Herein, modified zeolitic imidazolate frameworks (SiO2@Fe-ZIF-8/67) was facilely designed to preparation atomically dispersed Fe and Co doping 3D nitrogen-doped carbon nanosheets (A-FeCo@NCNs). The Fe or Co single atoms are identified to be coordinated with N atoms and form FeN4, CoN4 or N3Fe-CoN3 anchored on 3D defect carbon, which act as reactive sites for the oxygen reduction reaction (ORR) and oxygen evolution reaction (OER). Through synergetic coupling effect, A-FeCo@NCNs exhibits excellent electrochemical performance with ORR/OER potential gap of 0.80 V. Density functional theory (DFT) calculations further indicate the synergistic effect between Fe and Co in A-FeCo@NCNs towards the enhancing ORR activity. The as-prepared catalyst assembled Zn-air battery shows a maximum power density, and superb cycling stability, surpassing that based on commercial Pt/C + IrO2. Results from this study may provide a facile method for precious control of dual-metal single sites doped carbon with highly activity and durability for bifunctional electrocatalysis.
- Published
- 2021
43. Mn, N, P-tridoped bamboo-like carbon nanotubes decorated with ultrafine Co2P/FeCo nanoparticles as bifunctional oxygen electrocatalyst for long-term rechargeable Zn-air battery
- Author
-
Ai-Jun Wang, Lu Zhang, You-Qiang Yao, Jiu-Ju Feng, Zhu Han, and Zhi-Gang Wang
- Subjects
Materials science ,Oxygen evolution ,Nanoparticle ,02 engineering and technology ,Carbon nanotube ,Overpotential ,010402 general chemistry ,021001 nanoscience & nanotechnology ,Electrocatalyst ,01 natural sciences ,0104 chemical sciences ,Surfaces, Coatings and Films ,Electronic, Optical and Magnetic Materials ,law.invention ,Catalysis ,Biomaterials ,chemistry.chemical_compound ,Colloid and Surface Chemistry ,Chemical engineering ,chemistry ,law ,0210 nano-technology ,Bifunctional ,Pyrolysis - Abstract
Rational synthesis of cost-effectiveness, ultra-stable and high-efficiency bifunctional oxygen catalysts are pivotal for Zn-air batteries. Herein, fine Co2P/FeCo nanoparticles (NPs) anchored on Mn, N, P-codoped bamboo-like carbon nanotubes (Co2P/FeCo/MnNP-BCNTs) are constructed in the coexistence of melamine, poly(4-vinylpyridine) and adenosine-5′-diphosphate disodium salt (ADP) by convenient pyrolysis and follow-up acid treatment. The as-prepared catalyst exhibits the higher onset potential (Eonset = 0.97 V vs. RHE) and half-wave potential (E1/2 = 0.88 V vs. RHE) for oxygen reduction reaction (ORR), coupled with excellent oxygen evolution reaction (OER) with the lower overpotential of 324 mV at 10 mA cm−2. Notably, the home-made Zn-air battery delivers the greater peak power density of 220 mW cm−2, together with the outstanding cycling stability. The excellent performances of Co2P/FeCo/MnNP-BCNTs catalyst are mainly attributed to the highly conductive carbon nanotubes and the synergistic effects between carbon nanotubes and Co2P/FeCo NPs. This work offers a novel strategy to explore advanced bifunctional oxygen catalysts for high-efficiency metal-air batteries.
- Published
- 2021
44. Ionic liquid catalyzed solvent-free synthesis of chalcone and its derivatives under mild conditions
- Author
-
Fei Xu, Fuxia Liao, Gang Wang, Cao Yijun, Qiu Zhao, Yifan Sha, Zengxi Li, and Chunshan Li
- Subjects
Chalcone ,Reaction mechanism ,Environmental Engineering ,Solvent free ,General Chemical Engineering ,02 engineering and technology ,General Chemistry ,021001 nanoscience & nanotechnology ,Biochemistry ,Medicinal chemistry ,Catalysis ,chemistry.chemical_compound ,020401 chemical engineering ,chemistry ,Aldol reaction ,Yield (chemistry) ,Ionic liquid ,0204 chemical engineering ,0210 nano-technology ,Selectivity - Abstract
An ionic liquid (IL) catalyzed solvent-free process was developed for the direct synthesis of chalcone and its derivatives by using substituted acetophenones and benzaldehydes via aldol reaction under mild conditions. A series of acidic and basic ILs were selected and screened. The influences of cations and reaction conditions on product yield and selectivity were systematically investigated. The [Bmim]OH was identified as the optimal IL, with the highest yield and selectivity reaching up to 96.7% and 100%, respectively. A reaction mechanism-based kinetic model was established and regressed with experimental data, revealing the β-Hydroxylketone dehydrolysis with activation barrier of 37.8 kJ·mol−1 was observed as the rate-controlling step.
- Published
- 2021
45. Pt modulates the electronic structure of Pd to improve the performance of Pd-based catalytic combustion catalyst
- Author
-
Falu Dang, Huanhuan Yang, Meijia Liu, Yu Yang, Mei Yang, and Gang Wang
- Subjects
Renewable Energy, Sustainability and the Environment ,Chemistry ,Binding energy ,Energy Engineering and Power Technology ,chemistry.chemical_element ,Catalytic combustion ,02 engineering and technology ,Electronic structure ,010402 general chemistry ,021001 nanoscience & nanotechnology ,Condensed Matter Physics ,01 natural sciences ,Oxygen ,0104 chemical sciences ,Catalysis ,chemistry.chemical_compound ,Fuel Technology ,Adsorption ,X-ray photoelectron spectroscopy ,Chemical engineering ,Sulfate ,0210 nano-technology - Abstract
The electronic modulation between the catalytic active components can improve the catalytic activity and stability of the catalyst. The Pd-based catalysts can easily react with SOX to form stable and inactive sulfates. In this paper, the Pd–Pt-based catalytic combustion catalyst was prepared by replacing part of Pd with a small amount of Pt. The storage tank VOCs catalytic combustion activity and the anti-SO2 poisoning performance of the Pd–Pt-based catalyst and Pd-based catalyst were tested. The Pd 3d binding energy of each Pd-based catalyst was detected by XPS characterization, and the electronic structure changes of Pd active components was analyzed by the change of Pd 3d binding energy. The effect of electrons transfer between Pd and Pt on the improvement of catalytic combustion activity and SO2 poisoning resistance of Pd-based catalysts was analyzed. The results show that the Pt addition can increase the electron cloud density of the Pd active components, and improve the performance of the Pd active components to adsorb and activate oxygen. The reaction of Pd and SOX to form sulfate needs to gain electrons. The increase in the electron cloud density of the Pd active components in Pd–Pt-based catalyst makes it difficult for the Pd active components to adsorb SOX and difficult to react with SOX to form sulfate, thereby preventing the Pd active components from being poisoned and deactivated.
- Published
- 2021
46. Antifungal activity of double Schiff bases of chitosan derivatives bearing active halogeno-benzenes
- Author
-
Fang Dong, Jingjing Zhang, Wenqiang Tan, Lijie Wei, Qing Li, Gang Wang, and Zhanyong Guo
- Subjects
Antifungal ,Antifungal Agents ,food.ingredient ,medicine.drug_class ,02 engineering and technology ,Biochemistry ,Chitosan ,03 medical and health sciences ,chemistry.chemical_compound ,food ,Structural Biology ,Fusarium oxysporum ,medicine ,Fourier transform infrared spectroscopy ,Molecular Biology ,Schiff Bases ,030304 developmental biology ,Botrytis cinerea ,Botrytis ,0303 health sciences ,Schiff base ,biology ,Chemistry ,Fungi ,General Medicine ,021001 nanoscience & nanotechnology ,biology.organism_classification ,Halogen ,0210 nano-technology ,Nuclear chemistry - Abstract
In this study, a series of chitosan derivatives bearing active halogenated aromatic imines were successfully synthesized via Schiff bases with the high degrees of substitution. Detailed structural characterization was carried out using Fourier transform infrared (FTIR) spectroscopy, solid-state 13C nuclear magnetic resonance (NMR) spectroscopy, and elemental analysis. Besides, the antifungal activity against three common plant pathogenic fungi, including Botrytis cinerea, Fusarium oxysporum f. sp. cucumerinum, and Fusarium oxysporum f. sp. niveum, was investigated using in vitro hyphal measurements. The results showed that double Schiff bases of chitosan derivatives exhibited enhanced antifungal activity compared with chitosan, especially at 1.0 mg/mL. The double Schiff bases of chitosan bearing halogeno-benzenes showed >95% inhibitory indices at 1.0 mg/mL against Botrytis cinereal since halogens had the stronger electron-withdrawing property. The higher degree of substitution was another positive effect to improve the antifungal activity. This study provides a practical strategy to synthesize new double Schiff bases of chitosan derivatives bearing halogeno-benzenes, which could be developed into stronger antifungal agents.
- Published
- 2021
47. A comparative study of peroxydisulfate and peroxymonosulfate activation by a transition metal–H2O2 system
- Author
-
Gang Wang, Yuan Liu, Yue Zhang, Ping Li, Yanli Zhu, and You-xian Zhang
- Subjects
Health, Toxicology and Mutagenesis ,Substrate (chemistry) ,General Medicine ,010501 environmental sciences ,01 natural sciences ,Pollution ,chemistry.chemical_compound ,chemistry ,Transition metal ,Peroxydisulfate ,Rhodamine B ,Environmental Chemistry ,Degradation (geology) ,Activation method ,0105 earth and related environmental sciences ,Nuclear chemistry - Abstract
In this study, the impacts of common activation methods, namely heating, the addition of zero-valent metals (Cu, Fe, Al, Co, and Ni) and the addition of H2O2, on peroxydisulfate (PS) and peroxymonsulfate (PMS) activation were investigated. Rhodamine B (Rhb, 50 mg/L) was chosen as the substrate to be tested. Results showed that the efficiency of PMS was higher than that of PS under the same heat activation conditions. Cu, Fe, and Ni activated PS, while Co exhibited detrimental effects; Among them, Cu was the best. Co was the best activator among the investigated metals for PMS. Additionally, the use of H2O2 achieved a higher removal of Rhb in the PS/Cu system but inhibited the PMS/Co system. Three common anions (SO42-, Cl-, NO3-) that exist in the Yellow River were investigated. Cl- was found to accelerate Rhb degradation, while SO42- and NO3- slowed Rhb degradation. Toxicity experiment results showed that the addition of H2O2 promoted the transformation of Cu (0) to Cu2+ and Co (0) to Co2+, which was dangerous for seed germination. Graphical abstract.
- Published
- 2021
48. One Reagent with Two Functions: Simultaneous Living Radical Polymerization and Chain-End Substitution for Tailoring Polymer Dispersity
- Author
-
Atsushi Goto, Chen-Gang Wang, Amerlyn Ming Liing Chong, School of Physical and Mathematical Sciences, and Division of Chemistry and Biological Chemistry
- Subjects
Polymers and Plastics ,Polymers ,Dispersity ,Radical polymerization ,Chemistry::Organic chemistry::Polymers [Science] ,02 engineering and technology ,010402 general chemistry ,01 natural sciences ,Catalysis ,Polymerization ,Inorganic Chemistry ,chemistry.chemical_compound ,Chain (algebraic topology) ,Polymer chemistry ,Materials Chemistry ,chemistry.chemical_classification ,Organic Compounds ,Organic Chemistry ,Polymer ,021001 nanoscience & nanotechnology ,0104 chemical sciences ,Molecular Weight ,chemistry ,Reagent ,Molar mass distribution ,Sodium azide ,Indicators and Reagents ,0210 nano-technology - Abstract
Molecular weight distribution of polymer, termed dispersity (Đ), is a fundamental parameter that determines polymer properties. Sodium azide (NaN3) functions as a catalyst in organocatalyzed living radical polymerization when the reaction medium is non-polar. In contrast, NaN3 can act as a nucleophile when the reaction medium is polar. In this paper, we report an efficient approach to dispersity control by exploiting the dual functions of NaN3 under the varied solvent polarity. Simultaneous polymerization and chain-end substitution allowed us to tune the Đ values of various polymethacrylates and poly(butyl acrylate). Notably, the Đ value could be tuned to a wide range approximately from 1.2 to 2.0 for polymethacrylates and to 3.8 for poly(butyl acrylate). This approach afforded polymer brushes on surfaces with tailored Đ values. An interesting finding was that the polymer brushes exhibited a unique interaction with external molecules, depending on the Đ value. National Research Foundation (NRF) Accepted version This work was supported by National Research Foundation (NRF) Investigatorship in Singapore (NRF-NRFI05-2019-0001).
- Published
- 2021
49. High-Performance Trichloroacetic Acid Sensor Based on the Intramolecular Hydrogen Bond Formation and Disruption of a Specially Designed Fluorescent o-Carborane Derivative in the Film State
- Author
-
Gang Wang, Jing Zhang, Taihong Liu, Ke Liu, Nannan Ding, Jinglin Kong, and Yu Fang
- Subjects
Detection limit ,Fluorophore ,Materials science ,010405 organic chemistry ,Hydrogen bond ,010402 general chemistry ,Photochemistry ,01 natural sciences ,Fluorescence ,0104 chemical sciences ,chemistry.chemical_compound ,chemistry ,Benzothiazole ,Intramolecular force ,Carborane ,General Materials Science ,Derivative (chemistry) - Abstract
Discriminative and sensitive detection of environmentally important and health-related trichloroacetic acid (TCA) suffers from various problems such as bulky instruments and time-consuming operation as well as complex sample processing. Herein, we present a rapid, sensitive, and specific method for the detection of gaseous TCA using a fluorescent single-molecule array. An o-carborane-based benzothiazole derivative (CB-BT-OCH3) with specific fluorescence properties was specifically designed and utilized to fabricate a film-based single-molecule array. It was revealed that the fluorescent film is photochemically stable and extremely sensitive to TCA vapor, depicting an observable fluorescence color change from green to blue. The experimental detection limit is 0.2 ppm, which is lower than the safety limit (1 ppm) required by the threshold limit values and biological exposure indices. In addition, the film could show detectable intensity change within 0.2 s. On the basis of multiple signal responses, a conceptual two-channel-based fluorescent TCA sensor was developed. Importantly, the proposed conceptual sensor paves a new route to the development of specific fluorescent film-based sensor arrays with a single fluorophore as sensing units.
- Published
- 2021
50. A Photolabile Carboxyl Protecting Group for Solid Phase Peptide Synthesis
- Author
-
Tao Peng, Gang Wang, Lin Wang, Yunbo Sun, Tingting Chen, Shuchen Liu, Shouguo Zhang, Hongpeng Yang, and Xiaoxue Wen
- Subjects
solid-phase synthesis ,Ultraviolet Rays ,linker molecules ,Peptide ,010402 general chemistry ,Cleavage (embryo) ,01 natural sciences ,chemistry.chemical_compound ,Solid-phase synthesis ,Phase (matter) ,Peptide synthesis ,Protecting group ,QD1-999 ,Nitrobenzenes ,Solid-Phase Synthesis Techniques ,chemistry.chemical_classification ,Full Paper ,010405 organic chemistry ,technology, industry, and agriculture ,General Chemistry ,Full Papers ,Combinatorial chemistry ,0104 chemical sciences ,Amino acid ,Chemistry ,chemistry ,Heptanoic Acids ,peptides ,photolabile compounds ,protecting groups ,Linker - Abstract
A new kind of photolabile protecting group (PLPG) for carboxyl moieties was designed and synthesized as the linker between resin and peptide. This group can be used for the protection of amino acid carboxyl groups. The peptide was synthesized on Nph (2‐hydroxy‐3‐(2‐nitrophenyl)‐heptanoic acid)‐derivatized resins and could be cleaved under UV exposure, thus avoiding the necessity for harsh acid‐mediated resin cleavage. The PLPG has been successfully used for solid‐phase synthesis of peptides., A photolabile protecting group (PLPG) for carboxyl derivatives was designed and synthesized. The newly derived molecule can be used for the protection of amino acid carboxyl groups and can be removed rapidly under the condition of 365 nm.
- Published
- 2021
Catalog
Discovery Service for Jio Institute Digital Library
For full access to our library's resources, please sign in.