Search

The complete mitochondrial genome ofStewartia sinensiswas obtained with long PCR approach. Amplification primers were designed according to mitogenome sequences of some other fish species. PCR reactions were according to Kong et al. (2009). The complete mitochondria sequence ofCleithenes herzensteinwas deposited in GenBank under the accession number KT223828. Structural and evolutionary analyses were also performed. The length of the complete mitochondrial DNA sequence was 17 175 bp, consisting of 13 protein-coding genes, 22 tRNA genes, and two rRNA genes. Other than D-loop, another non-coding region named ‘‘OL’’ region was found (Table 1). The ‘‘OL’’ region (CTTTTTCCCGCCTAGTTTAACCAGTAAAAGGCGGGAA) is 38 bp and has the potential to fold into a stem-loop secondary structure. Most of the genes were encoded on the heavy strand (H strand) except for ND6 and eight tRNA genes (Table 1). The base composition and gene arrangement of C.herzensteinmitogenome was identical to typical vertebrate. For sequence alignment, the mitogenome sequence ofC. herzensteinwas 96% and 95% similar to that ofPlatichthys stellatusandVerasper moseri, respectively. [ABSTRACT FROM AUTHOR]

The complete mitochondrial genome of a predominant parasitoid, Necremnus tutae (Hymenoptera: Eulophidae) (GenBank accession number MT916846) is 15,252 bp in length, and contains 13 protein-coding genes (PCGs), 22 transfer RNA genes (tRNAs), 2 ribosomal RNA genes, and an A + T-rich region. The overall base composition is 38.86% for A, 7.14% for C, 8.57% for G, and 45.43% for T, with a high AT bias of 84.29%. ATA, ATT, ATG were initiation codons and TAA and T were termination codons. All the 22 tRNAs displayed a typical cloverleaf secondary structure, except for trnS1 and trnR which lacked the dihydrouracil (DHU) arm. Phylogenetic analyses were performed using 13 PCGs showed that N. tutae is closely related to Tenthredo tienmushana, which in accordance with the traditional classification. [ABSTRACT FROM AUTHOR]

Background: Previous genome-wide association study (GWAS) of polycystic ovary syndrome (PCOS) in Han Chinese population has found that SNPs in LPP gene were nominally significant in PCOS patients (P around 10E-05). Replication of the GWAS was applied to further confirm the relationship between LPP gene and PCOS. Methods: Three polymorphisms of LPP gene (rs715790, rs4449306, rs6782041) were selected and replicated in additional 1132 PCOS cases and 1142 controls. Genotyping of LPP gene was carried out by Taqman-MGB method. Results: In rs715790, the allele frequency is significantly different between the PCOS group and the control group. Meta-analysis showed that the allele frequencies of the three SNPs rs715790 (Pmeta = 1.89E-05, OR = 1.23), rs4449306 (Pmeta = 3.0E- 04, OR = 1.10), rs6782041 (Pmeta = 2.0E-04, OR = 1.09), were significantly different between PCOS cases and controls. Conclusions: Our results suggest that LPP gene might be a novel candidate for PCOS. [ABSTRACT FROM AUTHOR]

Flavivirus methyltransferase catalyzes both guanine N7 and ribose 2′-OH methylations of the viral RNA cap (GpppA-RNA→m7GpppAm-RNA). The methyltransferase is physically linked to an RNA-dependent RNA polymerase (RdRp) in the flaviviral NS5 protein. Here, we report genetic interactions of West Nile virus (WNV) methyltransferase with the RdRp and the 5′-terminal stem-loop of viral genomic RNA. Genome-length RNAs, containing amino acid substitutions of D146 (a residue essential for both cap methylations) in the methyltransferase, were transfected into BHK-21 cells. Among the four mutant RNAs (D146L, D146P, D146R, and D146S), only D146S RNA generated viruses in transfected cells. Sequencing of the recovered viruses revealed that, besides the D146S change in the methyltransferase, two classes of compensatory mutations had reproducibly emerged. Class 1 mutations were located in the 5′-terminal stem-loop of the genomic RNA (a G35U substitution or U38 insertion). Class 2 mutations resided in NS5 (K61Q in methyltransferase and W751R in RdRp). Mutagenesis analysis, using a genome-length RNA and a replicon of WNV, demonstrated that the D146S substitution alone was lethal for viral replication; however, the compensatory mutations rescued replication, with the highest rescuing efficiency occurring when both classes of mutations were present. Biochemical analysis showed that a low level of N7 methylation of the D146S methyltransferase is essential for the recovery of adaptive viruses. The methyltransferase K61Q mutation facilitates viral replication through improved N7 methylation activity. The RdRp W751R mutation improves viral replication through an enhanced polymerase activity. Our results have clearly established genetic interactions among flaviviral methyltransferase, RdRp, and the 5′ stem-loop of the genomic RNA. [ABSTRACT FROM AUTHOR]

Fungal communities in decaying sapwood and heartwood of K. evelyniana were demonstrated through construction of four 18 S rRNA gene libraries. The 210 sequenced clones were clustered into 11 subgroups, belonging to Basidiomycota (71.9%) and to Ascomycota (22.4%) and unclassified (1 subgroup; 5.7%). The heartwood displayed higher species richness than the sapwood. Basidiomycota were dominant in either the heartwood or the sapwood. Phylogenetically diverse Homobasidiomycetes were detected in the heartwood, contrary to the sapwood, where Heterobasidiomycetes were detected. Clones close to Spongipellis unicolor dominated in the heartwood (21 of 99 clones), while those close to Hydnochaete olivacea dominated in the sapwood (41 of 111 clones). The common species between the two parts were those related to S. unicolor, Calocera cornea, Debaryomyces hansenii, Davidiella tassiana, and Nomuraea rileyi and those from Chaetothyriomycetes. [ABSTRACT FROM AUTHOR]

We quantitatively evaluated the errors of clone assignment based on the restriction fragment length polymorphism (RFLP) pattern of 16S rRNA genes. Eighty clones were randomly selected from a 16S rRNA gene library and were categorized into 35 operational taxonomic units (OTU) based on their indistinguishable enzyme restriction patterns of 3 tetrameric restriction enzymes RsaI, BsuRI, and HinfI. All of these clones were then sequenced and were reassigned into 36-53 OTUs using the DOTUR program when sequence similarities of 95%-100% were used. The number of the identically assigned clones ranged from 53 to 61 and the percentage varied from 66.3% to 76.3%. The Shannon-Weaver index for the bacterial community observed by RFLP analysis was 2.75, equal to that estimated by DOTUR at a 97% sequence similarity. Compared with clones assigned with the DOTUR program at a 97% sequence similarity, only 61 clones (76.3%) were correctly assigned by RFLP analysis. Six clones (7.5%) were assigned mistakenly at the phylum level, and the positions of 13 clones (16.2%) were phylogenetically different at a lower taxonomic rank. Nous avons évalué quantitativement les erreurs d’identification de clones basée sur le polymorphisme de longueur des fragments de restriction (RFLP) du gène de l’ARNr 16S. Quatre-vingt clones ont été choisis au hasard à partir d’une banque de gènes d’ARNr 16S, et ont été catégorisés en 35 unités taxonomiques opérationnelles (UTO) à partir de leurs patrons de restriction enzymatique jugés identiques, obtenus avec les 3 enzymes de restriction tétramères RsaI, BsuRI et HinfI. Tous ces clones ont alors été séquencés et ont été réassignés en 36 à 53 UTO par le programme DOTUR, lorsqu’un seuil de 95 % à 100 % de similarité de séquence était utilisé. Le nombre de clones assignés de façon identique allait de 53 à 61 et le pourcentage variait de 66,3 % à 76,3 %. L’index de Shannon-Weaver de la communauté bactérienne observé par l’analyse en RFLP était de 2,75, égal à celui estimé par DOTUR à un seuil de 97 % de similarité de séquence. En comparant l’affectation des clones par DOTUR à un seuil de 97 % de similarité de séquence, 61 clones seulement (76,3 %) étaient correctement assignés par l’analyse en RFLP. Six clones (7,5 %) ont été assignés de façon erronée à l’échelle du phylum et les positions de 13 clones (16,2 %) étaient différentes d’un point de vue phylogénique à des niveaux taxonomiques inférieurs. [ABSTRACT FROM AUTHOR]

Mosquito-borne flaviviruses, which include many important human pathogens such as West Nile virus (WNV), Dengue virus (DENV) and Zika virus (ZIKV), had caused numerous emerging epidemics in recent years. Knowledge on the viral genome functions necessary for effective viral replication in mosquito and vertebrate hosts remained obscure. Here, using ZIKV as a model, we found that the conserved downstream of AUG region (DAR), which is known as an essential element for the genome cyclization, involved in viral replication in a host specific manner. Mutational analysis of the DAR element showed that a single-nucleotide mismatch between 5'DAR-3'DAR had little effect on ZIKV replication in mammalian cells, but dramatically impaired viral propagation in mosquito cells. The revertant viruses passaged in mosquito cells generated compensatory mutations restoring the base pairing of DAR, further confirming the importance of the complementarity of DAR in mosquito cells. We demonstrated that a single nucleotide mutation in DAR is sufficient to destroy long-range RNA interaction of ZIKV genome, and affects de novo RNA synthesis at 28 °C instead of 37 °C, resulting in the different replication efficiencies of the mutant viruses in mosquito and mammalian cells. Our results reveal a novel function of the circular form of flavivirus genome in host-specific viral replication, providing new ideas to further explore the functions of viral genome during host adaptation. [ABSTRACT FROM AUTHOR]

Head and neck squamous cell carcinoma (HNSCC) is characterized by significant genomic instability that could lead to clonal diversity. Intratumor clonal heterogeneity has been proposed as a major attribute underlying tumor evolution, progression, and resistance to chemotherapy and radiation. Understanding genetic heterogeneity could lead to treatments specific to resistant and metastatic tumor cells. To characterize the degree of intratumor genetic heterogeneity within a single tumor, we performed whole-genome sequencing on three separate regions of an human papillomavirus (HPV)-positive oropharyngeal squamous cell carcinoma and two separate regions from one corresponding cervical lymph node metastasis. This approach achieved coverage of approximately 97.9%of the genome across all samples. In total, 5701 somatic point mutations (SPMs) and 4347 small somatic insertions and deletions (indels) were detected in at least one sample. Ninety-two percent of SPMs and 77% of indels were validated in a second set of samples adjacent to the discovery set. All five tumor samples shared 41% of SPMs, 57%of the 1805 genes with SPMs, and 34 of 55 cancer genes. The distribution of SPMs allowed phylogenetic reconstruction of this tumor's evolutionary pathway and showed that the metastatic samples arose as a late event. The degree of intratumor heterogeneity showed that a single biopsy may not represent the entiremutational landscape of HNSCC tumors. This approachmay be used to further characterize intratumor heterogeneity in more patients, and their sample-to-sample variations could reveal the evolutionary process of cancer cells, facilitate our understanding of tumorigenesis, and enable the development of novel targeted therapies. [ABSTRACT FROM AUTHOR]

The 5′ end of the flavivirus plus-sense RNA genome contains a type 1 cap (m7 GpppAmG), followed by a conserved stem-loop structure. We report that nonstructural protein 5 (NS5) from four serocomplexes of flaviviruses specifically methylates the cap through recognition of the 5′ terminus of viral RNA. Distinct RNA elements are required for the methylations at guanine N-7 on the cap and ribose 2′-OH on the first transcribed nucleotide. In a West Nile virus (WNV) model, N-7 cap methylation requires specific nucleotides at the second and third positions and a 5′ stem-loop structure; in contrast, 2′-OH ribose methylation requires specific nucleotides at the first and second positions, with a minimum 5′ viral RNA of 20 nucleotides. The cap analogues GpppA and m7 GpppA are not active substrates for WNV methytransferase. Footprinting experiments using Gppp- and m7 Gppp-terminated RNAs suggest that the 5′ termini of RNA substrates interact with NS5 during the sequential methylation reactions. Cap methylations could be inhibited by an antisense oligomer targeting the first 20 nucleotides of WNV genome. The viral RNA-specific cap methylation suggests methyltransferase as a novel target for flavivirus drug discovery. [ABSTRACT FROM AUTHOR]