Search

Pre-existing SARS-CoV-2-specific T cells, but not antibodies, have been detected in some unexposed individuals. This may account for some of the diversity in clinical outcomes ranging from asymptomatic infection to severe COVID-19. Although age is a risk factor for COVID-19, how age affects SARS-CoV-2-specific T cell responses remains unknown. We found that some pre-existing T cell responses to specific SARS-CoV-2 proteins, Spike (S) and Nucleoprotein (N), were significantly lower in elderly donors (>70 years old) who were seronegative for S than in young donors. However, substantial pre-existing T cell responses to the viral membrane (M) protein were detected in some elderly donors. These responses likely compensate for loss of T cell responses specific to S and N. In contrast, young and elderly donors exhibited comparable T cell responses to S, N, and M proteins after infection with SARS-CoV-2. M-specific responses were mediated by CD4 T cells producing interferon-γ in both seronegative and seropositive individuals. T cells in seronegative elderly donors responded to various M-derived peptides, while the response after SARS-CoV-2 infection was apparently focused on a single peptide. These data suggest that diversity of target antigen repertoire for pre-existing SARS-CoV-2-specific T cells declines with age, but the magnitude of pre-existing T cell responses is maintained by T cells reactive to specific viral proteins such as M. A better understanding of the role of pre-existing SARS-CoV-2-specific T cells that are less susceptible to age-related loss may contribute to development of more effective vaccines for elderly people.

Severe clinical diseases associated to αCoronavirus (αCoV) infections were recently demonstrated for the first time in humans and a closely related but distinct canine CoV (CCoV) variant was identified in the nasopharyngeal swabs of children with pneumonia hospitalized in Malaysia, in 2017-2018. The complete genome sequence analysis demonstrated that the isolated strain, CCoV-HuPn-2018, was a novel canine-feline-like recombinant virus with a unique nucleoprotein. The occurrence of three human epidemics/pandemic caused by CoVs in the recent years and the detection of CCoV-HuPn-2018, raises questions about the ability of these viruses to overcome species barriers from their reservoirs jumping to humans. Interestingly, in this perspective, it is interesting to consider the report concerning new CCoV strains with a potential dual recombinant origin through partial S-gene exchange with porcine transmissible gastroenteritis virus (TGEV) identified in pups died with acute gastroenteritis in 2009. The significance of the ability of CCoVs to evolve is still unclear, but several questions arisen on the biology of these viruses, focusing important epidemiological outcomes in the field, in terms of both virus evolution and prophylaxis. The new CCoV-Hupn-2018 should lead researchers to pay more attention to the mechanisms of recombination among CoVs, rather than to the onset of variants as a result of mutations, suggesting a continuous monitoring of these viruses and in particular of SARS-CoV-2.

Monosynaptic tracing using rabies virus is an important technique in neuroscience, allowing brain- wide labeling of neurons directly presynaptic to a targeted neuronal population. A 2017 article reported development of a noncytotoxic version – a major advance – based on attenuating the rabies virus by addition of a destabilization domain to the C-terminus of a viral protein. However, this modification did not appear to hinder the ability of the virus to spread between neurons. We analyzed two viruses provided by the authors and show here that both were mutants that had lost the intended modification, explaining the paper’s paradoxical results. We then made a virus that actually did have the intended modification in at least the majority of virions and found that it did not spread efficiently under the conditions described in the original paper, namely, without an exogenous protease being expressed in order to remove the destabilization domain. We found that it did spread when the protease was supplied, although this also appeared to result in the deaths of most source cells by three weeks postinjection. We conclude that the new approach is not robust but that it could become a viable technique given further optimization and validation.SIGNIFICANCE STATEMENTRabies virus, which spreads between synaptically-connected neurons, has been one of the primary tools used by neuroscientists to reveal the organization of the brain. A new modification to rabies virus was recently reported to allow the mapping of connected neurons without adverse effects on the cells’ health, unlike earlier versions. Here we show that the conclusions of that study were probably incorrect and based on having used viruses that had lost the intended modification because of mutations. We also show that a rabies virus that does retain the intended modification does not spread efficiently between neurons under the conditions reported previously; however, it does spread between neurons under different conditions, suggesting that the approach may be successful if refined further.

We conducted a survey for group-specific indirect immunofluorescence antibody to mammarenaviruses by using Lassa fever and Mopeia virus antigens on serum specimens of 5,363 rodents of 33 species collected in South Africa and Zimbabwe during 1964–1994. Rodents were collected for unrelated purposes or for this study and stored at −70°C. We found antibody to be widely distributed in the 2 countries; antibody was detected in serum specimens of 1.2%–31.8% of 14 species of myomorph rodents, whereas 19 mammarenavirus isolates were obtained from serum specimens and viscera of 4 seropositive species. Phylogenetic analysis on the basis of partial nucleoprotein sequences indicates that 14 isolates from Mastomys natalensis, the Natal multimammate mouse, were Mopeia virus, whereas Merino Walk virus was characterized as a novel virus in a separate study. The remaining 4 isolates from 3 rodent species potentially constitute novel viruses pending full characterization.

The formation of condensed phase nucleoprotein assemblies, such as membraneless organelles (MLOs), that contribute to gene regulation and signaling within the cell is garnering widespread attention. A critical technical challenge is understanding how interactions between intrinsically disordered protein (IDP) and nucleic acid molecular components affect liquid–liquid phase separation (LLPS) into nucleoprotein condensates. To better understand the physics of LLPS that drive the formation of biomolecular condensates (known as coacervates), we investigate a model IDP system using a cationic elastin-like polypeptide (ELP), “E3”, that is engineered to phase separate and bind DNA upon coacervate formation. Using mean field Flory–Huggins (FH) theory, we create ternary phase diagrams to quantify DNA component partitioning within discrete protein- and solvent-rich phases across a range of salt and E3 compositions. We suggest a modified FH theory that combines canonical FH interaction parameters with an approximation of the Debye–Hückel theory to predict the strength of E3–DNA interactions and partitioning with a variable salt concentration. Finally, we establish a simple two-step DNA solution separation/purification assay to highlight the potential utility of our system. This model LLPS biopolymer platform represents an important chemical engineering-based contribution to synthetic biology and DNA technologies, with possible implications for origin of life discussions.

Humans are exposed to influenza virus through periodic infections. Due to these repeated exposures, human populations commonly have elevated antibody titers targeting the conserved internal influenza virus nucleoprotein (NP). Despite the presence of anti-NP antibodies, humans are acutely susceptible to drifted influenza viruses with antigenically different surface proteins and the protective potential of human NP antibodies is unclear. In this study, high levels of anti-NP antibody and NP-specific B cells were detected in both adult humans and influenza-infected mice, confirming that NP is a major target of humoral immunity. Through sorting single B cells from influenza-exposed human adults, we generated a panel of 11 anti-NP monoclonal antibodies (mAbs). The majority of anti-NP human mAbs generated were capable of engaging cellular Fc receptors and bound NP on the surface of influenza-infected cell lines in vitro, suggesting that anti-NP mAbs have the potential to mediate downstream Fc effector functions such as antibody-dependent cellular cytotoxicity and antibody-dependent phagocytosis. However, human anti-NP mAbs were not protective in vivo when passively transferred into a murine influenza challenge model. Future in vivo studies examining the synergistic effect of anti-NP mAbs infused with other influenza-specific mAbs are warranted.

Understanding the evolutionary adaptations that enable avian influenza viruses to transmit in mammalian hosts could allow better detection of zoonotic viruses with pandemic potential. We applied ancestral sequence reconstruction to gain viruses representing different adaptive stages of the European avian-like (EA) H1N1 swine influenza virus as it transitioned from avian to swine hosts since 1979. Ancestral viruses representing the avian-like precursor virus and EA swine influenza viruses from 1979–1983, 1984–1987 and 1988–1992 were reconstructed and characterized. Glycan-binding analyses showed stepwise changes in the haemagglutinin receptor–binding specificity of the EA swine influenza viruses—that is, from recognition of both α2,3- and α2,6-linked sialosides to recognition of α2,6-linked sialosides only; however, efficient transmission in piglets was enabled by adaptive changes in the viral polymerase protein and nucleoprotein, which have been fixed since 1983. PB1-Q621R and NP-R351K increased viral replication and transmission in piglets when introduced into the 1979–1983 ancestral virus that lacked efficient transmissibility. The stepwise adaptation of an avian influenza virus to a mammalian host suggests that there may be opportunities to intervene and prevent interspecies jumps through strategic coordination of surveillance and risk assessment activities. Ancestral avian influenza A viruses are used to identify adaptive changes in viral polymerase and nucleoproteins that enable efficient replication and transmission in pigs.

Avidity is defined as the binding strength of immunoglobulin G (IgG) toward its target epitope. Avidity is directly related to affinity, as both processes are determined by the best fit of IgG to epitopes. We confirm and extend data on incomplete avidity maturation of IgG toward severe acute respiratory syndrome coronavirus 2 (SARS‐CoV‐2) nucleoprotein (NP), spike protein‐1 (S1), and its receptor‐binding domain (RBD) in coronavirus disease 2019 (COVID‐19) patients. In SARS‐CoV‐2‐infected individuals, an initial rise in avidity maturation was ending abruptly, leading to IgG of persistently low or intermediate avidity. Incomplete avidity maturation might facilitate secondary SARS‐CoV‐2 infections and thus prevent the establishment of herd immunity. Incomplete avidity maturation after infection with SARS‐CoV‐2 (with only 11.8% of cases showing finally IgG of high avidity, that is, an avidity index > 0.6) was contrasted by regular and rapid establishment of high avidity in SARS‐CoV‐2 naïve individuals after two vaccination steps with the BioNTech messenger RNA (mRNA) Vaccine (78% of cases with high avidity). One vaccination step was not sufficient for induction of complete avidity maturation in vaccinated SARS‐CoV‐2 naïve individuals, as it induced high avidity only in 2.9% of cases within 3 weeks. However, one vaccination step was sufficient to induce high avidity in individuals with previous SARS‐CoV‐2 infection., Highlights After severe acute respiratory syndrome coronavirus 2 (SARS‐CoV‐2) infection, immunoglobulin G (IgG) toward viral nucleoprotein (NP), receptor‐binding domain (RBD), and spike protein‐1 (S1) shows immature avidity.The breakpoint of avidity maturation correlates with that of IgG production.Patients with more severe clinical symptoms show increased avidity maturation.Two vaccination steps lead to complete avidity maturation.Therefore, vaccination seems to induce protective immunity toward SARS‐CoV‐2 and coronavirus disease 2019 (COVID‐19).Preceding SARS‐CoV‐2 infections enhance avidity maturation after subsequent vaccination.

Nucleoid-associated proteins (NAPs) are crucial in organizing prokaryotic DNA and regulating genes. Vital to these activities are complex nucleoprotein structures, however, how these form remains unclear. Integration host factor (IHF) is an Escherichia coli NAP that creates very sharp bends in DNA at sequences relevant to several functions including transcription and recombination, and is also responsible for general DNA compaction when bound non-specifically. We show that IHF–DNA structural multimodality is more elaborate than previously thought, and provide insights into how this drives mechanical switching towards strongly bent DNA. Using single-molecule atomic force microscopy and atomic molecular dynamics simulations we find three binding modes in roughly equal proportions: “associated” (73° of DNA bend), “half-wrapped” (107°) and “fully-wrapped” (147°), only the latter occurring with sequence specificity. We show IHF bridges two DNA double helices through non-specific recognition that gives IHF a stoichiometry greater than one and enables DNA mesh assembly. We observe that IHF-DNA structural multiplicity is driven through non-specific electrostatic interactions that we anticipate to be a general NAP feature for physical organization of chromosomes.

The post-translational acetylation of lysine residues is found in many nonhistone proteins and is involved in a wide range of biological processes. Recently, we showed that the nucleoprotein of the influenza A virus is acetylated by histone acetyltransferases (HATs), a phenomenon that affects viral transcription. Here, we report that the PA subunit of influenza A virus RNA-dependent RNA polymerase is acetylated by the HATs, P300/CREB-binding protein-associated factor (PCAF), and general control nonderepressible 5 (GCN5), resulting in accelerated endonuclease activity. Specifically, the full-length PA subunit expressed in cultured 293T cells was found to be strongly acetylated. Moreover, the partial recombinant protein of the PA N-terminal region containing the endonuclease domain was also acetylated by PCAF and GCN5 in vitro, which facilitated its endonuclease activity. Mass spectrometry analyses identified K19 as a candidate acetylation target in the PA N-terminal region. Notably, the substitution of the lysine residue at position 19 with glutamine, a mimic of the acetyl-lysine residue, enhanced its endonuclease activity in vitro; this point mutation also accelerated influenza A virus RNA-dependent RNA polymerase activity in the cell. Our findings suggest that PA acetylation is important for the regulation of the endonuclease and RNA polymerase activities of the influenza A virus.

The influenza virus nucleoprotein binds to the viral RNA genome and is essential for virus replication. Here, the structure of the nucleoprotein from an H3N2 virus is presented at 2.2 Å resolution., Influenza A viruses of the H1N1 and H3N2 subtypes are responsible for seasonal epidemic events. The influenza nucleoprotein (NP) binds to the viral genomic RNA and is essential for its replication. Efforts are under way to produce therapeutics and vaccines targeting the NP. Despite this, no structure of an NP from an H3N2 virus has previously been determined. Here, the structure of the A/Northern Territory/60/1968 (H3N2) influenza virus NP is presented at 2.2 Å resolution. The structure is highly similar to those of the A/WSN/1933 (H1N1) and A/Hong Kong/483/97 (H5N1) NPs. Nonconserved amino acids are widely dispersed both at the sequence and structural levels. A movement of the 73–90 RNA-binding loop is observed to be the key difference between the structure determined here and previous structures. The data presented here increase the understanding of structural conservation amongst influenza NPs and may aid in the design of universal interventions against influenza.

Probing CD4 T cell immunity to SARS-CoV-2 A better understanding of CD4 + T cell responses to severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is crucial to the design of effective next-generation vaccines. Low et al. defined and estimated the CD4 + T cell repertoire of convalescent COVID-19 patients. After sorting various CD4 + T cell subsets, they generated numerous T cell clones that reacted to the SARS-CoV-2 spike protein. A large number of T cell clones from almost all individuals recognized a small conserved immunodominant region within the spike protein receptor-binding domain (RBD). The researchers isolated T cell clones that broadly reacted to the spike protein of other coronaviruses, providing evidence for the recall of preexisting cross-reactive memory T cells after SARS-CoV-2 infection. Science , abg8985, this issue p. 1336

Crimean-Congo hemorrhagic fever (CCHF) is an acute viral zoonotic disease. The widespread geographic distribution of the disease and the increase in the incidence of the disease from new regions, placed CCHF in a list of public health emergency contexts. The rapid diagnosis, in rural and remote areas where the majority of cases occur, is essential for patient management. Aptamers are considered as a specific and sensitive tool for being used in rapid diagnostic methods. The Nucleoprotein (NP) of the CCHF virus (CCHFV) was selected as the target for the isolation of aptamers based on its abundance and conservative structure, among other viral proteins. A total of 120 aptamers were obtained through 9 rounds of SELEX (Systematic Evolution of Ligands by Exponential Enrichment) from the ssDNA aptamer library, including the random 40-nucleotide ssDNA region between primer binding sites (GCCTGTTGTGAGCCTCCTAAC(N40)GGGAGACAAGAATAAGCA). The KD of aptamers was calculated using the SPR technique. The Apt33 with the highest affinity to NP was selected to design the aptamer-antibody ELASA test. It successfully detected CCHF NP in the concentration of 90 ng/ml in human serum. Evaluation of aptamer-antibody ELASA with clinical samples showed 100% specificity and sensitivity of the test. This simple, specific, and the sensitive assay can be used as a rapid and early diagnosis tool, as well as the use of this aptamer in point of care test near the patient. Our results suggest that the discovered aptamer can be used in various aptamer-based rapid diagnostic tests for the diagnosis of CCHF virus infection.

During the past 17 years, the coronaviruses have become a global public emergency, with the first appearance in 2012 in Saudi Arabia of the Middle East respiratory syndrome. Among the structural proteins encoded in the viral genome, the nucleocapsid protein is the most abundant in infected cells. It is a multifunctional phosphoprotein involved in the capsid formation, in the modulation and regulation of the viral life cycle. The N-terminal domain of N protein specifically interacts with transcriptional regulatory sequence (TRS) and is involved in the discontinuous transcription through the melting activity of double-stranded TRS (dsTRS).

There is an ongoing need of developing sensitive and specific methods for the determination of SARS-CoV-2 seroconversion. For this purpose, we have developed a multiplexed flow cytometric bead array (C19BA) that allows the identification of IgG and IgM antibodies against three immunogenic proteins simultaneously: the spike receptor-binding domain (RBD), the spike protein subunit 1 (S1) and the nucleoprotein (N). Using different cohorts of samples collected before and after the pandemic, we show that this assay is more sensitive than ELISAs performed in our laboratory. The combination of three viral antigens allows for the interrogation of full seroconversion. Importantly, we have detected N-reactive antibodies in COVID-19-negative individuals. Here we present an immunoassay that can be easily implemented and has superior potential to detect low antibody titers compared to current gold standard serology methods., Egia-Mendikute et al. develop a multiplexed flow cytometric bead array to simultaneously detect antibodies reactive to three immunogenic SARS-CoV-2 proteins. More sensitive than ELISA, they detected N-reactive antibodies in COVID-19-negative individuals with this assay, showing it to have superior potential to detect low antibody titres compared to current gold standard serology methods.

COVID-19 is an infectious disease caused by a newly discovered corona virus SARS-COV-2. It is the most dangerous epidemic existing currently all over the world. To date, there is no licensed vaccine and not any particular efficient therapeutic agent available to prevent or cure the disease. So development of an effective vaccine is the urgent need of the time. The proposed study aims to identify potential vaccine candidates by screening the complete proteome of SARS-COV-2 using the computational approach. From 14 protein entries in UniProtKB, 4 proteins were screened for epitope prediction based on consensus antigenicity predictions and various physico-chemical criteria like transmembrane domain, allergenicity, GRAVY value, toxicity, stability index. Comprehensive analysis of these 4 antigens revealed that spike protein (P0DTC2) and nucleoprotein (P0DTC9) show the greatest potential for experimental immunogenicity analysis. These 2 proteins have several potential CD4+ and CD8+ T-cell epitopes, as well as high probability of B-cell epitope regions as compared to well-characterized antigen the matrix protein 1 [Influenza A virus (H5N1)]. In addition, the epitope SIIAYTMSL predicted from spike protein (P0DTC2) and epitope SPRWYFYYL predicted from nucleoprotein (P0DTC9) exhibited more than 60% population coverage in the target populations Europe, North America, South Asia, Northeast Asia taken in this study. These epitopes have also been found to exhibit highly significant TCR-pMHC interactions having a joint Z value of 4.51 and 4.37 respectively. Therefore, this analysis suggests that the predicted epitopes might be suitable vaccine candidates and should be subjected to further in-vivo and in-vitro studies.

In the present study, a novel ELISA method used recombinant nucleocapsid protein (rNP) as the coating agent. Recombinant Newcastle disease virus (NDV) protein was cloned and expressed in Escherichia coli. Though the rNP-ELISA results were consistent with commercial ELISA results for the NDV-negative sera samples, qualitatively and quantitatively variable (often reduced) results were obtained with NDV-positive sera. Although the rNP-ELISA results for NDV detection were inconclusive, further improvement and standardization of the rNP-ELISA approach, such as using multiple recombinant proteins as the ELISA coating agent and performing comprehensive statistical analyses of combined recombinant protein ELISA, should help counter Newcastle disease outbreaks by improving NDV detection.

The nucleoprotein (NP) of influenza virus is the core component of the ribonucleoprotein (RNP) and performs multiple structural and functional roles. Structures of the influenza A, B and D NP molecules have been solved previously, but structural information on how NP interacts with RNA remains elusive. Here we present the crystal structure of an obligate monomer of H5N1 NP in complex with RNA nucleotides to 2.3 Å, and a C-terminal truncation of this mutant, also in complex with RNA nucleotides, to 3 Å. In both structures, three nucleotides were identified near two positive grooves of NP suggested to be important for RNA binding. Structural evidence supports that conformational changes of flexible loops and the C-terminal tail both play important roles in the binding of RNA. Based on the structure, we propose a mechanism by which NP captures RNA by flexible loops and transfers it onto the positive binding grooves. Binding of RNA by NP is a crucial step for template re-encapsidation during transcription and replication and cRNP formation. Our structures thus provide insights into the molecular virology of the influenza virus.

Antibodies against severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) nucleoprotein (NP) were purified from pig serum through two steps: (1) isolation of anti-NP IgG antibodies using magnetic beads with immobilized human SARS-CoV-2 NP and (2) filtration of anti-spike protein (SP) IgG antibodies using magnetic beads with immobilized human SARS-CoV SP. The enhanced specificity of the purified antibodies to the NP of SARS-CoV-2 was demonstrated using an immunoassay with anti-NP IgG antibodies after the isolation and filtration steps. The binding constants (Kd) of the purified anti-NP IgG antibodies to the NP of SARS-CoV-2 and the SP of SARS-CoV were estimated using a surface plasmon resonance biosensor (SPR). A competitive assay using the two-step purified anti-NP IgG antibodies from pig serum demonstrated (a) the detection of SARS-CoV-2 in viral fluid and (b) the discrimination of SARS-CoV-2 from SARS-CoV, MERS-CoV, and CoV strain 229E in viral fluids.

Lassa mammarenavirus (LASMV) is responsible for a specific type of acute viral hemorrhagic fever known as Lassa fever. Lack of effective treatments and counter-measures against the virus has resulted in a high mortality rate in its endemic regions. Therefore, in this study, a novel epitope-based vaccine has been designed using the methods of immunoinformatics targeting the glycoprotein and nucleoprotein of the virus. After numerous robust analyses, two CTL epitopes, eight HTL epitopes and seven B-cell epitopes were finally selected for constructing the vaccine. All these most promising epitopes were found to be antigenic, non-allergenic, nontoxic and non-human homolog, which made them suitable for designing the subunit vaccine. Furthermore, the selected T-cell epitopes which were found to be fully conserved across different isolates of the virus, were also considered for final vaccine construction. After that, numerous validation experiments, i.e. molecular docking, molecular dynamics simulation and immune simulation were conducted, which predicted that our designed vaccine should be stable within the biological environment and effective in combating the LASMV infection. In the end, codon adaptation and in silico cloning studies were performed to design a recombinant plasmid for producing the vaccine industrially. However, further in vitro and in vivo assessments should be done on the constructed vaccine to finally confirm its safety and efficacy. Communicated by Ramaswamy H. Sarma

Background: Lassa Virus (LV) infection is an endemic disease from West Africa posing threat to the entire world. A thorough understanding of the mechanistic workings of the genome products of LV may be a key to develop drug candidates for the treatment of LV infection. Methods: Molecular dynamic simulation has been used to provide insight into the mechanistic basis for total loss of ssRNA interaction in Nucleoprotein (NP) K309A, partial loss in S247A, and no loss in S237A by following the hydrogen bond interaction, water influx into the ssRNA pocket and glycosidic torsion angle (χ) of the ssRNA. Results: The results revealed that K309A mutation is associated with a complete loss of saltbridge interaction between lysine e-amino and U4-O2P phosphodiester linkage but not in S237A where S247-OG atom played a redundant role. S247A is also associated with partial loss of hydrogen bond between OG atom of S247 and C5-O2P phosphodiester bond as T178-OG1 group seems to have a seemingly redundant interaction with C5-O2P. While S247A is only associated with the alteration of χ rotation in U6/C7, both K309A and S247 but not S237A is associated with increased water influx into the ssRNA binding pocket. Conclusion: K309A mutation may result in non-viable Lassa viron as a loss of ssRNA interaction may negatively affect genome biochemistry, semi-viable Lassa viron in S247A mutation may be due to the loss of 3D arrangement of ssRNA due to splayed out nucleotides.

Anti-severe acute respiratory syndrome coronavirus 2 (anti-SARS-CoV-2) nucleoprotein (NP) antibodies were isolated from pig sera using human SARS-CoV-2 NP-immobilized magnetic beads. The binding properties of the isolated antibodies against SARS-CoV-2 NP were tested via flow cytometry using SARS-CoV-2 NP-immobilized magnetic beads. A competitive immunoassay was developed for detecting SARS-CoV-2 NP as well as SARS-CoV-2 in the culture fluid using magnetic beads with immobilized anti-SARS-CoV-2 NP antibodies. Selectivity tests were carried out during the competitive immunoassay for SARS-CoV, MERS-CoV, and CoV strain 229E in the culture fluid.

Aim. Production of recombinant viral antigens of the main immunodominant proteins: glycoprotein (GPΔMLD), nucleoprotein (NP) and matrix protein (VP40) of the Marburg virus, as well as the study of their antigenic and immunogenic properties.Materials and methods. To create recombinant proteins GPΔMLD, NP and VP40 of the Marburg virus, synthesized nucleotide sequences encoding these proteins cloned into the pET21a expression vector were used. The immunogenic and antigenic properties of the obtained recombinant proteins were tested using a number of biomodels (mice, chickens, and guinea pigs).Results and discussion. Recombinant plasmids containing genes encoding proteins GPΔMLD, NP, VP40 of the Marburg virus, as well as Escherichia coli producing strains, with the yield of purified preparations of recombinant proteins GPΔMLD, NP, VP40 from one liter of culture fluid – 5, 10, and 10 μg were obtained, respectively. When mice are immunized, recombinant proteins GP, NP, and VP40 MARV induce the synthesis of high titer antibodies (recombinant proteins NP and VP40 – more than 409600, and recombinant protein GPΔMLD – 12800). Mouse antibodies specific to recombinant proteins interact in an enzyme-linked immunosorbent assay (ELISA) with the antigen of inactivated MARV. Antibodies of chickens immunized with virus-like particles containing the surface glycoprotein of the Marburg virus and antibodies of guinea pigs immunized with an experimental DNA vaccine containing the GPΔMLD MARV gene recognize the recombinant GPΔMLD protein and the viral protein in the inactivated MARV. The resulting recombinant proteins are immunogenic/antigenic and can be used for the development of enzymelinked immunosorbent assay systems.

Integration Host Factor (IHF) is a heterodimeric site-specific nucleoid-associated protein (NAP), well known for its DNA bending ability. Although the IHF induced bending states of DNA have been captured by both X-ray Crystallography and Atomic Force Microscopy (AFM), the range of flexibility and degree of heterogeneity in terms of quantitative analysis of the nucleoprotein complex has largely remained unexplored. Binding of IHF leads to introduction of two kinks in the dsDNA that allowed us to come up with a quadrilateral model. The findings have further been extended by calculating the angles of flexibility, that gives the idea of the degree of dynamicity of the nucleoprotein complex. We have monitored and compared the trajectories of the conformational dynamics of a dsDNA upon binding of wild-type (wt) and single-chain (sc) IHF at millisecond resolution through single-molecule FRET (smFRET). Our findings reveal that the nucleoprotein complex exists in a ‘Slacked-Dynamic’ state throughout the observation window where many of them have switched between multiple ‘Wobbling States’ in the course of attainment of packaged form. This study opens up an opportunity to improve the understanding of the functions of other nucleoid-associated proteins (NAPs) by complementing the previous detailed atomic-level structural analysis, which eventually will allow accessibility towards a better hypothesis.

The detection of novel or re-emergent pathogens necessitates the development of rapid, easy-to-use diagnostic tests that can be readily adapted and utilized in both clinical laboratories and field settings. Heartland virus (HRTV) is the first pathogenic Phlebovirus responsible for serious and fatal cases in the United States. We developed a qualitative test based on recombinase-polymerase-amplification coupled with lateral flow reading (RPA-LF) for rapid detection of HRTV. The RPA-LF detected HRTV with a limit of detection of 1.19-1.54 plaque-forming unit equivalents/reaction. In addition, the RPA-LF was able to detect 0.6075 copies/μL of HRTV nucleoprotein gene-containing plasmid. We evaluated six clinical samples that were previously found to be real-time PCR positive for HRTV and found five out of six samples to be positive by RPA-LF, yielding 83.3% concordance with real-time PCR. All six samples had Ct values between 29 and 39 by real-time PCR. We also determined that the HRTV primers and probe do not cross-react with other tick-transmitted viruses such as Bourbon and Powassan, or other related viruses, including Lonestar tick virus and Sunday canyon virus (100% specificity). This is the first isothermal amplification test developed for a tick-borne virus, which will allow for rapid differentiation between HRTV and other pathogens producing similar clinical manifestations.

RNA viruses include many important human and animal pathogens, such as the influenza viruses, respiratory syncytial virus, Ebola virus, measles virus and rabies virus. The genomes of these viruses consist of single or multiple RNA segments that assemble with oligomeric viral nucleoprotein into ribonucleoprotein complexes. Replication and transcription of the viral genome is performed by ~250–450 kDa viral RNA-dependent RNA polymerases that also contain capping or cap-snatching activity. In this Review, we compare recent high-resolution X-ray and cryoelectron microscopy structures of RNA polymerases of negative-sense RNA viruses with segmented and non-segmented genomes, including orthomyxoviruses, peribunyaviruses, phenuiviruses, arenaviruses, rhabdoviruses, pneumoviruses and paramyxoviruses. In addition, we discuss how structural insights into these enzymes contribute to our understanding of the molecular mechanisms of viral transcription and replication, and how we can use these insights to identify targets for antiviral drug design., In this Review, Fodor and colleagues discuss recent structural insights into the RNA polymerases of negative-sense RNA viruses and their use to identify novel targets for the development of antiviral agents.

One of the most important serious malignancies is gastric cancer (GC) with a high mortality globally. In this way, beside the environmental factors, genetic parameter has a remarkable effective fluctuation in GC. Correspondingly, telomeres are nucleoprotein structures measuring the length of telomeres and they have special potential in diagnosis of various types of cancers. Defect protection of the telomeric length initiates the instability of the genome during cancer, including gastric cancer. The most common way of maintaining telomere length is the function of the telomerase enzyme that replicates the TTAGGG to the end of the 3′ chromosome. In this review, we want to discuss the alterations of hTERT repression on the modification of TERRA gene expression in conjunction with the importance of telomere and telomerase in GC. The telomerase enzyme contains two essential components called telomerase reverse transcriptase (hTERT) and RNA telomerase (hTR, hTERC). Deregulation of hTERT plays a key role in the multistage process of tumorigenicity and anticancer drug resistance. The direct relationship between telomerase activity and hTERT has led to hTERT to be considered a key target for cancer treatment. Recent results show that telomeres are transcribed into telomeric repeat-containing RNA (TERRA) in mammalian cells and are long noncoding RNAs (lncRNAs) identified in different tissues. In addition, most chemotherapy methods have a lot of side effects on normal cells. Telomere and telomerase are useful therapeutic goal. According to the main roles of hTERT in tumorigenesis, growth, migration, and cancer invasion, hTERT and regulatory mechanisms that control the expression of hTERT are attractive therapeutic targets for cancer treatment.

Ebola virus disease is a complex zoonosis that is highly virulent in humans. Despite its sorely pathogenic and lethal nature, survivors of this infection and even asymptomatic cases are able to develop both humoral and cellular immunity against several Ebola virus (EBOV) proteins. We aimed at determining immunoglobulin G (IgG) antibodies level against two Ebola viral antigens, the glycoprotein and the nucleoprotein in Ebola survivors and their relatives. Anti-EBOV glycoprotein (GP) and nucleoprotein (NP) IgG antibodies were quantified using ELISA. We enrolled 199 participants in two different sites as follow: 91 survivors at the Loreto clinic and 70 survivors with 38 relatives of Sierra Leone Association of Ebola Survivors Bombali Branch (SLAESB) tested for anti-EBOV NP and anti-EBOV GP IgG antibodies. Our findings revealed that the median anti-EBOV IgG level among survivors was 5.7128 U/ml [IQR: 2.793 - 7.783] for anti-EBOV GP IgG and 4.431 U/ml [IQR: 2.083 - 7.696] for anti-EBOV NP IgG. Survivors relatives had a median anti-EBOV GP IgG level of ?0.7128 U/ml [IQR: -0.903 to -0.04327] and -2.711 U/ml [IQR: -4.01 to -1.918] for anti-EBOV NP IgG. We observed that IgG levels in survivors were higher than in relatives with a significant difference of about 0.0001. The median value of anti-EBOV IgG level among seropositive relatives was 0.7043 U/ml [IQR: 0.5686 to 3.716] for anti-EBOV GP IgG and 4.05 U/ml [IQR: 0.2765 to 7.759] for anti-EBOV NP IgG respectively. Interestingly, we observed that 3.30% of Loreto clinic survivors did not developed anti-EBOV NP IgG antibodies; also about 10% survivors of the SLAESB were not reactive to anti-EBOV NP IgG and 1.43% of these survivors did not express antibodies against the Ebola viral glycoprotein. Our work is consistent with previous published studies showing heterogeneity in both survivors and asymptomatic cases of Ebola infection developing adaptive immunity against EBOV proteins.

A simple fluorescence-based lateral flow test platform for rapid influenza B virus screening as a model target molecule was successfully developed. In this work, Cy5-loaded silica nanoparticles were directly conjugated to monoclonal antibodies, specific to the influenza B nucleoprotein, via a direct physisorption method and used as detector probes. Using this approach, the signal response to the detection was further determined using a fluorescent signal intensity measurement method via a portable reader, in combination with fluorescence imaging analysis. The degree to which the fluorescence signal response is detected is proportional to the amount of the target virus protein present in the system, reflected by the accumulation of the formed particle-antibody conjugates within the test system. Under optimized conditions, the system is capable of detecting the influenza B virus protein at a level of 0.55 μg per test within 30 min, using small sample volumes as low as 100 μL (R2 = 0.9544). In addition to its simplicity, further application of the system in detecting the influenza B virus protein was demonstrated using the viral transport media as specimen matrices. It was also shown that the system can perform the detection without cross-reactivity to other closely related respiratory viruses.

The novel coronavirus (CoV), earlier named 2019-nCoV, and later as severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) has now created havoc and panic across the globe by its severe ongoing pandemic This virus has to date as of 23rd November 2020, killed nearly 1 4 million persons out of more than 59 million confirmed positive cases, while spreading rapidly in more than 215 countries and territories Taxonomically, SARS-CoV-2 has been characterized in genus Betacoronavirus, which contains non-segmented positive-sense, single-stranded (ss) RNA genome of ~30 kb The first two open reading frames (ORFs), ORF1a and ORF1b, of SARS-CoV-2, encode 16 non-structural proteins (nsp1-nsp16), whereas other ORFs encodes four main structural proteins (sp) [spike (s) by ORF2, envelope (E) by ORF4, membrane (M) by ORF5, nucleoprotein (N) by ORF9], and accessory proteins essential for the virus fitness, pathogenesis and host immunity evasion Sequence alignments of SARS-CoV-2 with genomes of various coronaviruses showed 58% identity in the non-structural protein (nsp)-coding region, 43% with the structural protein (sp)-coding region and 54% with the whole genome The full-length genome sequence of the 2019-nCoV sample showed only up to 79 60% similarity with SARS CoV, but up to 96% similarity with bat coronavirus (bat coronavirus RaTG13) This gives strong evidence that 2019-nCoV has originated from the bat The genomic and evolutionary evidence of another coronavirus species from pangolins also show higher similarity to SARS-CoV at the whole-genome level Apart from RaTG13, Pangolin-CoV is the most closely related CoV to SARS-CoV-2 During infection, the viral S protein interacts with the receptor protein of the human cell membrane, known as angiotensin-converting enzyme II (ACE2) Presently, SARS-CoV-2 vaccines and drugs are not available, for which researchers are trying hard to develop to tackle rising tide of COVID-19-pandemic Early diagnosis, contact tracing, strict prevention and control measures, biosecurity, personal biosafety, disinfection and sanitization practices, social distancing are aiding in prevention with SARS-CoV-2 infection Boosting immunity by intaking the balanced and nutritious food, nutraceuticals, herbs, and following physical exercises along with avoiding stress conditions enhance the fighting power of the body against SARS-CoV-2 infection and limiting the severity of COVID-19 The present article describes salient knowledge on SARS-CoV-2 structure, genomic organization, pathogenesis, pathobiology, and advances and progress being made to treat COVID-19 patients © 2020, Editorial board of Journal of Experimental Biology and Agricultural Sciences All rights reserved