Search

Background: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Methods: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Results: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α3.7/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. Conclusion: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel [ABSTRACT FROM AUTHOR]

Introduction: Interactions of different hemoglobin variants with thalassemia alleles can result in various clinical phenotypes. HbE-beta-thalassemia generally manifests with severe anemia where individuals exhibit beta-thalassemia major with regular blood transfusions or beta-thalassemia intermedia with periodic blood transfusions. This study presents a unique Malay family with three beta-globin gene defects-HbE, Hb South Florida, and IVS1-1 (G-->A).Materials and Methods: HbE activates a cryptic splice site that produces non-functional mRNAs. Hb South Florida is a rare beta-hemoglobin variant, and its interactions with other beta-thalassemia alleles have not been reported. IVS1-1 is a Mediterranean mutation that affects mRNA processing giving rise to beta(o)-thalassemia.Results and Discussion: Fifteen mutations along the beta-globin gene complex were analyzed using the amplification refractory mutation system. Hb South Florida was identified by direct sequencing using genomic DNA.Conclusion: The affected child with HbE/IVS1-1 produced a beta-thalassemia major phenotype. Compound heterozygosity for Hb South Florida/IVS1-1 produced a beta-thalassemia carrier phenotype in the mother. [ABSTRACT FROM AUTHOR]

Molecular characterization of the compound heterozygous condition--[supG]γ([supA]γδΒ)[supo]/Β-thalassemia--in four families showing mild Β-thalassemia intermedia was carried out using DNA amplification techniques. Using the Amplification Refractory Mutation System (ARMS) to confirm the Β-mutations and DNA amplification to detect the 100-kb Chinese-specific [supG]γ([supA]γδΒ)[supo]-deletion, two families were confirmed to possess [supG]γ([supA]γδΒ)[supo]/&Beta-thalassemia with the IVSII No. 654 Β[sup+]-allele. In the third family, the [supG]γ([supA]γδΒ)[supo]-deletion was confirmed in the father and the mother was a Β-thalassemia carrier with the cd 41-42 Β[supo]-allele. Their affected child with [supG]γ([supA]γδΒ)[supo]/Β-thalassemia was found to be transfusion dependent. The same [supG]γ([supA]γδΒ)[supo]-deletion and Β-thalassemia (cd 41-42) was also confirmed in a fourth family. In addition, the mother was also diagnosed with Hb H disease (genotype-α[sup3.7]/[sup-SEA]). Both the children were found to possess [supG]γ([supA]γδΒ)[supo]/Β-thalassemia but they were not transfusion dependent and this could be due to co-inheritance of α-thalassemia-2 (genotype-α[sup3.7]/αα) in the children together with their compound heterozygous condition. [ABSTRACT FROM AUTHOR]

Background: Thalassaemia is a common public health problem in Malaysia and about 4.5 to 6% of the Malays and Chinese are carriers of this genetic disorder. The major forms of thalassaemia result in death in utero of affected foetuses (a-thalassaemia) or life-long blood transfusions for survival in β-thalassaemia. This study, the first nationwide population based survey of thalassaemia in Malaysia, aimed to determine differences in public awareness, perceptions and attitudes toward thalassaemia in the multi-racial population in Malaysia. Methods: A cross-sectional computer-assisted telephone interview survey of a representative sample of multi-racial Malaysians aged 18 years and above was conducted between July and December 2009. Results: Of a total of 3723 responding households, 2846 (76.4%) have heard of thalassaemia. Mean knowledge score was 11.85 (SD ± 4.03), out of a maximum of 21, with higher scores indicating better knowledge. Statistically significant differences (P < 0.05) in total knowledge score by age groups, education attainment, employment status, and average household income were observed. Although the majority expressed very positive attitudes toward screening for thalassaemia, only 13.6% of married participants interviewed have been screened for thalassaemia. The majority (63.4%) were unsupportive of selective termination of foetuses diagnosed with thalassaemia major. Conclusion: Study shows that carrier and premarital screening programs for thalassaemia may be more effective and culturally acceptable in the reduction of pregnancies with thalassaemia major. The findings provide insights into culturally congruent educational interventions to reach out diverse socio-demographic and ethnic communities to increase knowledge and cultivate positive attitudes toward prevention of thalassaemia. [ABSTRACT FROM AUTHOR]

Beta-thalassemia is one of the most prevalent inherited diseases and a public health problem in Malaysia. Malaysia is geographically divided into West and East Malaysia. In Sabah, a state in East Malaysia, there are over 1000 estimated cases of β-thalassemia major patients. Accurate population frequency data of the molecular basis of β-thalassemia major are needed for planning its control in the high-risk population of Sabah. Characterization of β-globin gene defects was done in 252 transfusion dependent β-thalassemia patients incorporating few PCR techniques. The study demonstrates that β-thalassemia mutations inherited are ethnically dependent. It is important to note that 86.9% of transfusion-dependent β-thalassemia major patients in Sabah were of the indigenous population and homozygous for a single mutation. The Filipino β0-deletion was a unique mutation found in the indigenous population of Sabah. Mutations common in West Malaysia were found in 11 (4.3%) patients. Four rare mutations (Hb Monroe, CD 8/9, CD 123/124/125 and IVS I-2) were also found. This study is informative on the population genetics of β-thalassemia major in Sabah. [ABSTRACT FROM AUTHOR]

β-Thalassemia is a public health problem where 4.5% of Malaysians are β-thalassemia carriers. The genetic disorder is caused by defects in the β-globin gene complex which lead to reduced or complete absence of β-globin chain synthesis. Five TaqMan genotyping assays were designed and developed to detect the common β-thalassemia mutations in Malaysian Malays. The assays were evaluated with 219 "blinded" DNA samples and the results showed 100% sensitivity and specificity. The in-house designed TaqMan genotyping assays were found to be cost- and time-effective for characterization of β-thalassemia mutations in the Malaysian population. [ABSTRACT FROM AUTHOR]

Aim: Interactions between different determinants of α-thalassemia raises considerable problems, particularly during pregnancies where antenatal diagnosis is necessary. This study aims to determine the different types of deletional α-thalassemia and Hemoglobin Constant Spring (HbCS), and their frequency in Malays, Chinese and Indians in Malaysia. Methods: DNA from 650 pregnant women from the Antenatal Clinic of the University of Malaya Medical Center in Kuala Lumpur, Malaysia who showed mean cell volume ≤89 fL and/or mean cell hemoglobin ≤28 pg were analyzed for the double α-globin gene South-East Asian deletion (--SEA), the -α3.7 and -α4.2 single α-globin gene deletions and HbCS. Results: One hundred and three (15.8%) of the pregnant women were confirmed as α-thalassemia carriers: 25 (3.8%) were α-thalassemia-1 carriers with the --SEA/αα genotype, 64 (9.8%) were heterozygous for the -α3.7 rightward deletion (-α3.7/αα), four (0.6%) were heterozygous for the -α4.2 leftward deletion (-α4.2/αα), nine (1.4%) were heterozygous for HbCS (αCSα/αα) and one (0.2%) was compound heterozygous with the -α3.7/αCSα genotype. The double α-globin gene --SEA deletion was significantly higher in the Chinese (15%) compared to the Malays (2.5%) and not detected in the Indians studied. The -α3.7 deletion was distributed equally in the three races. HbCS and -α4.2 was observed only in the Malays. Conclusion: The data obtained gives a better understanding of the interactions of the different α-thalassemia determinants in the different ethnic groups, thus enabling more rapid and specific confirmation of α-thalassemia in affected pregnancies where antenatal diagnosis is necessary. [ABSTRACT FROM AUTHOR]