Search

New classes of drugs including the proteasome inhibitors (PI) bortezomib and, more recently, carfilzomib and the immunomodulatory agent lenalidomide have shown improved outcomes for multiple myeloma (MM) patients during the past decade. However, most of the studies reporting outcomes for patients receiving these drugs have relied on older data sets derived from large institutions that included patients not receiving their treatment at those facilities and represented only those eligible for clinical trials or were from sites where treatment options were limited. We have analyzed data from 258 MM patients who have received treatment with at least one of three agents: bortezomib, carfilzomib, and lenalidomide in a single clinic specializing in MM with respect to their responses and other outcomes to treatment regimens including these agents. Response rates were similar between these three drugs when used for the first time and again during subsequent treatment regimens. As expected, the clinical benefit rates (CBRs) were better for patients receiving their first treatment when compared to their use in subsequent treatment regimens. The CBRs were similar during their 2nd, 3rd, and 4th treatments containing these agents. Many patients refractory to these agents showed responses to regimens containing these same drugs when used in different combinations. In addition, patients refractory to one PI often responded to the other PI. The results of this study demonstrate that novel agents can be used repeatedly in novel combinations with significant clinical benefit for patients with MM.

Despite recent advances made in its treatment, multiple myeloma (MM) remains an incurable B cell malignancy. Thus, the objective for treating these patients is to prolong overall survival (OS) and preserve patients’ quality of life. We have analyzed data from 264 consecutive MM patients who had their initial visit between July 1, 2004 and December 1, 2014 and have received treatment in a single clinic specializing in MM. We determined their progression-free survival (PFS, OS, and 5-year OS). The PFS for frontline (n = 165 treatments), salvage (n = 980), and all treatments (n = 1145) were 13.9, 4.6, and 5.5 months, respectively. The median OS of all patients was 98 months with a 5-year survival of 74%. The results of this study show a marked improvement in OS for unselected MM patients compared with historical data. There were no significant differences in OS between patients with different International Staging System (ISS) stages. Younger patients (

Enhanced angiogenesis is a hallmark of solid tumors and hematological malignancies. Anti-angiogenic therapeutic approaches have recently been shown to be effective for the treatment of certain cancers. Endothelial cells migrating to tumors provide them with new blood vessels that are critical for their growth and survival. We have developed a novel and rapid method to evaluate the anti-angiogenic activity of new agents consisting of a combined chorioallantoic membrane (CAM) and feather bud (FB) assay. Unlike previous assays, this new assay assesses the effects of drugs on the ability of tissues to attract and develop their own blood supply. The CAM already has a well-developed vascular network that is capable of providing blood vessels to the non-vascularized FB, allowing for this tissue to develop feathers. As a result, the exposure of the FB to drugs for 2 days followed by attachment to the CAM for 4 days allows evaluation of the compound's ability to impact blood vessel and feather formation within the CAM-attached FB tissue. Feather formation is determined as well as expression of endothelial cell genes and proteins analyzed. Using agents with known anti-angiogenic activity including fumagillin, minocycline, zoledronic acid, doxorubicin and agents lacking anti-angiogenic activity such as melphalan, we have shown that the CAM/FB assay can accurately and rapidly assess the ability of agents to prevent blood vessel and feather development within non-vascularized tissues.

Enhanced angiogenesis is a hallmark of cancer. Pleiotrophin (PTN) is an angiogenic factor that is produced by many different human cancers and stimulates tumor blood vessel formation when it is expressed in malignant cancer cells. Recent studies show that monocytes may give rise to vascular endothelium. In these studies, we show that PTN combined with macrophage colony-stimulating factor (M-CSF) induces expression of vascular endothelial cell (VEC) genes and proteins in human monocyte cell lines and monocytes from human peripheral blood (PB). Monocytes induce VEC gene expression and develop tube-like structures when they are exposed to serum or cultured with bone marrow (BM) from patients with multiple myeloma (MM) that express PTN, effects specifically blocked with antiPTN antibodies. When coinjected with human MM cells into severe combined immunodeficient (SCID) mice, green fluorescent protein (GFP)–marked human monocytes were found incorporated into tumor blood vessels and expressed human VEC protein markers and genes that were blocked by anti-PTN antibody. Our results suggest that vasculogenesis in human MM may develop from tumoral production of PTN, which orchestrates the transdifferentiation of monocytes into VECs.

Introduction: The levels of serum monoclonal immunoglobulins (M-Igs) are used to monitor multiple myeloma (MM) patients. However, these assessments do not discriminate between normal polyclonal immunoglobulins (uninvolved) and M-Igs since they cannot determine the type of light chain associated with each immunoglobulin class (i.e. IgGκ, IgGλ, IgAκ, IgAλ, IgMκ, and IgMλ). The HevyLite® +(HLC) assays are able to accomplish this but the usefulness of these results for MM patients needs to be further established. We evaluated the levels of involved and uninvolved HLC levels, their ratios and differences and their relationship to outcomes among MM patients. Materials and Methods: Serum samples (n=189) from MM patients were analyzed using the HLC assays. Manufacturer’s HLC normal reference ranges were used. HLC results were correlated with clinical status as determined at the time of sampling and divided into groups according to clinical status (complete response (CR), ≥ partial response (PR) , < partial response, and progressive disease (PD)). Normality was assessed using the D’Agostino-Pearson omnibus normality test. Statistical comparisons were made using t-student’s or Mann-Whitney tests as appropriate as well as Fisher’s test. Progression-free survival (PFS) was calculated using Kaplan--Meier analysis for specific regimens received during the time the samples were taken. All tests were double-tailed and p-values lower than 0.05 were considered to be statistically significant. Results: All MM serum samples analyzed had IgG (62%) or IgA (38%) isotypes. Results from the involved HLC/uninvolved HLC ratios and their differences demonstrated that samples from patients with PD had significantly both higher ratios and differences (P PR compared with those with < PR so that patients in > PR were more likely to have normal uninvolved HLC levels than among patient with Conclusion: This study shows that involved HLC/uninvolved HLC ratios, differences between the involved and uninvolved HLCs, higher absolute levels of involved HLC, and lower levels of uninvolved HLC correlate with clinical status for MM patients. In addition, MM patients with normal uninvolved HLC levels have a longer PFS whereas those with involved HLC levels above the normal range show a shorter PFS. These results demonstrate the usefulness of the HLC assay for determining outcome for multiple myeloma patients. Disclosures No relevant conflicts of interest to declare.

Introduction:B-cell maturation antigen (BCMA) is a tumor necrosis factor receptor family member that is expressed on normal and malignant B-cells, including those from patients (pts) with multiple myeloma (MM). Our group has recently shown that this protein is present in the serum of MM pts, and preliminary findings from our group suggested that its levels may correlate with their clinical status and overall survival (OS; Sanchez et al. Brit J Haematol 2012). We now have analyzed the relationship between serum BCMA levels and monoclonal (M)-protein levels as well as the relationship of BCMA to response status, progression-free survival (PFS) and OS in a large cohort of MM pts including those with nonsecretory disease (NSD). Methods:Two hundred fifty-two MM pts were evaluated. Enzyme-linked immunosorbent assay (ELISA) was used to determine serum BCMA levels (R&D Systems). The Kruskal-Wallis Test was used to assess the correlation between serum BCMA levels and clinical status, and Dunn’s posttest was used to assess differences between clinical status groups. Kaplan-Meier analysis and multivariate Cox regression models were also used. Kaplan-Meier survival of MM pts was determined from the time of initial serum BCMA measurement to death or the date of last follow-up. PFS of MM pts was evaluated from the time of initial serum BCMA measurement to date of first disease progression. Cox-proportional hazards regression was utilized to determine the predictive influence of serum BCMA and various other factors including age, creatinine, hemoglobin, ISS stage, and bone disease on OS and PFS. P-values less than .05 were considered statistically significant. Changes in serum BCMA levels were correlated with serum M-protein levels for 44 consecutive MM pts during their course of disease. Similarly, BCMA was correlated with bone marrow and PET scan findings for NSD pts. Results: Serum BCMA levels correlated with the patient’s clinical status at the time of its determination (p PR had significantly lower serum BCMA levels (median, 11.69 ng/mL) than those with stable and progressive disease (median, 64.17 ng/mL; p30-140 ng/mL) and Stage 3 (n=55; > 140 ng/mL). Pts in Stage 1 had a longer OS (5-year, 95%) compared to pts in Stage 2 (5-year, 72%; p < 0.0002) while pts in Stage 2 had a longer OS than pts in Stage 3 (5-year, 60%; p < 0.0109). We determined the relationship of OS to serum BCMA level, age, serum creatinine, hemoglobin, ISS stage, and bone disease through Cox proportional-hazards regression. In the multivariate regression analyses, serum BCMA levels significantly correlated with only OS (p Conclusion:The results of this study demonstrate that BCMA is a novel serum marker that can be used to follow the course of disease for MM pts. The level of this serum protein is also correlated with clinical status and predicts their PFS and OS. It also provides MM pts with NSD a new potential way to follow their disease course, which currently requires frequent PET scans and bone marrow exams. Figure 1 Figure 1. Disclosures No relevant conflicts of interest to declare.

Introduction: Despite the advances for treating multiple myeloma (MM) patients (pts), it remains an incurable B-cell malignancy. Thus, the objective for treating these pts is to prolong overall survival (OS) and preserve quality of life. New classes of drugs in the past decade have improved OS for MM pts; however, most of the studies conducted to predict outcome and predict factors that determine OS have relied on older data sets derived from large institutions including pts not receiving treatment there and lacking accurate follow up of pts as well as information from centers in which therapeutic choices are limited. These studies have suggested that depth of response, specifically complete response (CR), and lower International Staging System (ISS) staging at diagnosis predict improved OS. We have now analyzed data on all MM pts who have received treatment in a single clinic specializing in MM. Methods: Data was obtained from all MM pts who received treatment in a single clinic specializing in MM that was established 10 years ago. Kaplan-Meier analysis was used to generate all survival curves and the log-rank test was used to measure difference between curves, with P Results: Two hundred sixty-three MM patients (161 male, 102 female) with a median follow-up of 52 months were analyzed in this study. The median age at diagnosis was 63 years (range, 31 to 88). Thirty-seven pts (14%) had smoldering MM (SMM) while the remainder (n=225 [86%]) were diagnosed with active MM. For pts with active disease, ISS staging at diagnosis (n=156) included 68 (44%), 46 (29%) and 42 (27%) pts with ISS Stages I, II and III. The median OS of all patients was 118 months with a 5-year survival of 77%. The 5-year OS of SMM pts was 88% compared to 76% for those with active disease. There were no significant differences in OS between pts with different ISS stages at the time of diagnosis. Specifically, the median 5-year survival of pts with ISS Stage I, II and III disease at diagnosis were 79, 91 and 84 months, respectively. We also analyzed OS of MM pts according to the depth of response from treatment. There were no significant differences in OS between pts who attained a CR during their first treatment regimen compared to those who achieved their first CR during subsequent regimens or those who never attained a CR. During their first treatment, pts with stable disease (SD; n=28) showed no difference in OS compared to those achieving > minimal response (MR; n=135), > partial response (PR; n=107), PR (n=72), or CR (n=35). The OS of pts who had achieved a CR with at least one regimen (n=83 [38% of pts]) was not different than among pts never achieving CR (n=135 [62% of pts]; P=0.1173). In order to further determine whether depth of response predicts OS during the patient’s course of disease, OS was determined based on the best response ever achieved to any anti-myeloma regimen. There was no significant difference in OS between patients who achieved a CR (n=84) with any treatment regimen compared to those who attained an MR or PR (n=108), PR (n=73), MR (n=35) or those who had achieved only an SD (n=11). However, OS among pts who achieved CR, > PR, ≥ MR, or > SD (SD+MR+PR+CR) was better than among those who had only demonstrated PD during their course of disease (P In order to determine whether the initial treatment regimen predicted OS, we also analyzed survival of pts who received bortezomib-based therapy compared to those who received an IMiD or both drugs together as their initial treatment, and showed there was no significant differences in OS between these three upfront treatment approaches. Conclusion: Results from an analysis of a large cohort of MM pts from a single clinic specializing in MM show that the median survival has greatly improved to nearly 10 years due to the availability of many new treatment options. Although previous studies have suggested that ISS staging at diagnosis and depth of response to anti-MM regimens predict OS for MM pts, results from our study involving analysis of a large cohort of MM pts from a single clinic specializing in MM show that these prognostic factors do not predict OS for pts with this B-cell malignancy. Differences in our results compared to other previous studies may reflect the many treatment options available in the clinical setting used to obtain our results. Disclosures No relevant conflicts of interest to declare.

Introduction: In addition to breast and colorectal cancers, multiple myeloma has also been associated with vitamin D deficiency. Given the role of vitamin D in calcium absorption and bone metabolism, it is crucial to maintain sufficient levels for multiple myeloma patients because of their high risk of bone-related complications. We hypothesized that there was a high prevalence of vitamin D deficiency and insufficiency among multiple myeloma patients. We also hypothesized that there is inadequate screening of vitamin D levels throughout community oncology clinics nationwide. Methods: This study both evaluated multiple myeloma patients from a single medical practice specializing in this B-cell malignancy who had a 25-OH vitamin D level determined, and separately determined the proportion of oncology sites that screen for this vitamin among their patients. Charts were reviewed from the medical practice specializing in multiple myeloma, and only the first vitamin D determination was analyzed in the study. Demographics and the presence of the following complications at the time or within 1 year from when vitamin D levels were assessed: peripheral neuropathy, skeletal-related events and bone disease. We defined skeletal-related events as pathological fractures, spinal cord compression or requirement for radiation or surgery, and bone disease as having one of the following: osteoporosis, osteopenia or lytic bone disease. Patients were categorized as either having sufficient (> 30 ng/ml), insufficient (20 to < 30 ng/ml) or deficient ( Results: One hundred sixty-nine multiple myeloma patients were enrolled in the study. Their median age was 67, the mean was 65.4 (range, 38-85) and the gender breakdown was 62% male and 38% female. 25-OH vitamin D levels were sufficient in less than two-thirds (64%) of patients with 22% and 14% of patents showing insufficient and deficient levels of this vitamin, respectively. The proportions of patients with specific complications in relationship to their vitamin D levels are shown below.Abstract 5769. Table 1ComplicationVitamin D deficientVitamin D insufficientVitamin D deficientPeripheral neuropathy65%65%59%Bone disease85%82%87%Skeletal-related events70%62%58% Chi square analysis showed no significant differences in complications rates as related to vitamin D levels although skeletal-related events were more frequently observed among patients with vitamin D levels below the normal range (insufficient or deficient). Of the 508 sites that were asked on the Site Information Forms to provide information on whether their physicians assess vitamin D levels as part of their standard of care of their patients, 97% responded that they did not assess vitamin D levels as part of their standard of care of these patients. Conclusion: Vitamin D levels are frequently low among multiple myeloma patients and, despite this, screening levels of this vitamin is not thought to be part of the routine work up by the vast majority of oncologists in the United States. Disclosures No relevant conflicts of interest to declare.

Enhanced angiogenesis is a hallmark of solid tumors and hematological malignancies, and anti-angiogenic therapeutic approaches have recently shown significant benefit in the clinic. As a result, many anti-angiogenic agents are currently in early development. Very few methods have been used to evaluate the anti-angiogenic activity of these agents using an ex vivo assay. Unfortunately, currently available methods are both time consuming and costly. We have developed a novel approach to test the anti-angiogenic activity of new agents in a rapid, accurate and inexpensive way. This model consists of using a combined chorioallantoic membrane (CAM) and feather bud (FB) assay. The CAM already has a well developed vascular network and provides an ideal microenvironment and the FB serves as an active biological testing tool for evaluating angiogenesis. FB is a component of epithelial and mesenchymal cells. The method consists of using fertilized chick eggs incubated horizontally at 37.5°C in a humidified incubator and windowed by day 8. Another set of E8 chicken embryonic skins are collected under a dissecting microscope to isolate FB. The FB is treated with drugs or control reagents and implanted onto the CAM. The eggs are sealed with an adhesive tape and incubated for an additional 2–4 days. The endothelial cells of CAM proliferate and migrate into the FB after two days. After 4 days of culture, both blood vessel formation and FB development are determined by microscopy. New blood vessels in FB are analyzed by H&E and immunohistochemical (IHC) staining and expression of endothelial genes and proteins using RT-PCR and Western blot analysis, respectively. First, we establish that the compound being tested should only affect endothelial proliferation or migration and not kill the epithelial and mesenchymal tissues. We have used this new method to investigate several compounds. First, we evaluated the anti-angiogenic agent fumagillin (1μM) and minocycline (100nM). Although neither drug had any cytotoxic effects on the epithelial and mesenchymal tissues when cultured alone, marked inhibition of FB development occurred on the CAM in a dose-dependent fashion with both drugs as determined by microscopy and IHC. In addition, Western blot analysis showed marked inhibition of Tie-2 protein expression in a dose-dependent fashion in the presence of these drugs. Zoledronic acid, a potent bisphosphonate which has recently been shown to harbor anti-angiogenic activity, was found to markedly inhibit FB development in the presence of this drug at a concentration of 10 μM whereas less effect was observed at 2 μM. This drug did not have any direct effect on epithelial and mesenchymal cells when these tissues were cultured alone. We then examined gene and protein expression of the FB cells on CAM that were treated with zoledronic acid. Both FLK-1 and Tie-2 transcript and protein levels were significantly reduced in a dose-dependent fashion following treatment with zoledronic acid as assessed by RT-PCR and Western blot analysis. We are currently testing the potential anti-angiogenic effects of many other novel drugs using this new model. Overall, the present findings demonstrate that the CAM/ FB angiogenesis model is likely to be a reliable, fast, sensitive, and economical system to screen the anti-angiogenic effects of new agents.

Cancer stem cells persist in tumors as a distinct population and cause relapse and metastasis by giving rise to new tumors. Development of specific therapies targeted at cancer stem cells gives hope for improvement in the survival and quality life of cancer patients. Multiple myeloma (MM) is a cancer characterized by clonal expansion of terminally differentiated B cells. In order to characterize whether cancer stem cells can be identified in these patients, fresh bone marrow biopsies with 90% MM cells from MM patients were implanted into the superficial gluteal muscle of C.B-17 severe combined immunodeficient (SCID) mice. The tumors were excised from donor mice two months following implantation, and digested with proteinase-E to produce a single cell suspension. These cells were analyzed using flow cytometry to identify specific cellular phenotypes within the tumor population. Approximately 13% of the tumor cells were CD138+ cells, 1–2% CD20+ cells and 2–3% CD133+ cells. To examine gene expression within these populations, we isolated the tumor cells using immunomagnetic bead selection. Cells (1X108) were incubated with 200ml of anti-CD138 microbeads and either anti-CD133 or CD20 microbeads. The cell suspension was applied to the magnetic column and unbound cells were passed through the column by washing followed by centrifugation, and finally resuspended. Total RNA was purified from the cells and gene expression of each population was examined using RT-PCR analysis of specific previously identified stem cell-related transcription factors. β-catenin plays a critical role in stem cell development; and, furthermore, the Wnt-β-catenin signaling pathway is important for maintaining the balance of proliferation versus differentiation in the stem cell population. The gene expression of KLT-4, Oct-4, SOX2, and C-myc has recently been shown to convert nonterminally differentiated B cells into a pluripotent stem cell state. In our studies, we found that the CD20+/CD138− and CD133+/CD138− subpopulations both expressed high levels of β-catenin, KLT-4, Oct-4, SOX2, and C-myc. These small populations of tumor cells are likely to represent MM cancer stem cells as they express genes consistently identified in cancer stem cells identified in other types of cancers. We unexpectedly found that CD138+ cells also expressed β-catenin, KLT-4, Oct-4, SOX2, and C-myc. This population of cells might be a “premature” tumor cell in MM at a middle stage of tumor cell differentiation which ultimately differentiates into a mature MM cell. Only CD20−/CD138− cells showed no expression of β-catenin, KLT-4 and SOX2 and markedly reduced Oct-4 gene expression whereas the amount of C-myc gene expression was similar to the levels in the other tumor cell subtypes. Only CD133−/CD138− cells lost β-catenin and showed a reduction in Oct-4 gene expression but still expressed the KLT-4, SOX2, and C-myc genes. To further examine these cancer stem cell and mature tumor cell populations in terms of growth in vivo, we have injected subcutaneously CD20+/CD138−, CD133+/CD138−, CD20−/CD138−, and CD133−/CD138− tumor cell subpopulations back into SCID mice. We will assess growth of cells from these subtypes in vivo as determined by changes in tumor volume and Ig protein levels. We also will determine the sensitivity of these subtypes in vivo to treatment with a variety of agents with anti-MM activity including bortezomib, lenalidomide, melphalan, and Doxil. These studies have uncovered specific subpopulations within the tumor clone of MM and identified differences in expression of genes known to be involved in stem cell function. Further work should lead to specific treatments that can effectively treat these different subpopulations within the tumor clone in MM.

We have previously shown that multiple myeloma (MM) patients express pleiotrophin (PTN) and it is found at high levels in MM serum as well as PTN is a key factor in the transdifferentiation of monocytes into endothelial cells. We determined the level of PTN expression in myeloma and breast cancer and determined whether PTN produced by these tumor cells could induce endothelial cell expression in human monocytes. Both myeloma and breast cancer cells produced high levels of PTN and secreted this growth factor into the culture medium whereas normal bone marrow showed no expression of this protein. Next, MM cell lines, human bone marrow (BM) from MM patients or control subjects or breast cancer cells were cultured with CD14+ PBMCs using transwell culture plates coated with collagen I. CD14+ monocytes exposed to cells from MM cell lines or fresh BM or breast cancer cells showed expression of endothelial genes (Flk-1, Tie-2, CD144, and vWF) and lost expression of monocyte genes (c-fms). Induction of endothelial gene expression was blocked with an anti-PTN antibody. In contrast, CD14+ cells exposed to normal bone marrow as well as cell lines lacking PTN expression did not show endothelial gene expression. We determined whether human monocytes could be incorporated in vivo as vascular endothelium within human tumors that express PTN. Human myeloma LAGλ-1 cells which highly express and secrete PTN were mixed with THP1 monocytes transduced with the green fluorescent protein (GFP) gene and injected subcutaneously into SCID mice. Mice were sacrificed 6 weeks later and tumor was fixed and frozen sections. MM cells or THP1 monocytes alone did not demonstrate the presence of GFP+ blood vessels. Notably, GFP+ THP1 cells were found in blood vessels within the PTN-expressing LAGλ-1 tumor in animals injected with both cells together. When GFP+h2Kd- blood vessels were stained for anti-human and anti-mouse CD31, 60% of the endothelial cells stained positive for human CD31 and the remaining cells stained positive for mouse CD31 whereas none of these cells stained positive for both mouse and human markers. These results show that the blood vessels containing GFP+ cells do not result from fused cells. In addition, an anti-PTN antibody but not control IgG antibody blocks the incorporation of GFP+ cells into the vasculature of the LAGλ-1 tumors. Staining of serial sections with anti-Tie-2 and CD31 antibodies showed a similar distribution pattern. We further examined endothelial gene expression in these in vivo-generated samples using RT-PCR. The results showed that the THP1 monocytes or LAGλ-1 tumor cells alone did not express endothelial genes whereas THP1 monocytes mixed with PTN-expressing LAGλ-1 showed endothelial gene expression. This endothelial gene expression was blocked by anti-PTN antibody. These data show that hematologic and solid tumors through expression of PTN support new blood vessel formation by the transdifferentiation of monocytes into endothelial cells and provide a new potential target for inhibiting blood vessel formation in solid and liquid tumors.

Dominant negative inhibition is most commonly seen when a mutant subunit of a multi-subunit protein is co-expressed with the wild-type protein so that assembly of a functional oligomer is impaired. Studies have shown that TRAF6 plays a key role in the regulation of NF-κB through the IL-1R/TLR-TRAF6-TAK1-TAB1-TAB2-IkB-NF-κB pathway. We previously demonstrated that TRAF6 is an important factor for the activation of nuclear factor (NF)-κB signaling in multiple myeloma cell proliferation through the c-Jun N-terminal kinase (JNK) pathway and the pathway can be silenced by TRAF6 siRNA. (H. Chen et al. Oncogene, 2006). We targeted the TRAF6 function domain by designing primers targeting positive 1115 to 1818 (Forward: ggctagcatgtcagaggtccggaatttggag (Nhe1) Reverse: cgaagtactgatgcaggggtatagctcgagc (Xho1)) for hTRAF6dn according to GeneBank (NCBI) nucleotide sequence of human TRAF6 (#U78798). We cloned TRAF6 negative domain cDNA into PCRII-TOPO vector and subsequently re-cloned into the pLenti6.2 expression vector (pLenti6.2-hTRAF6dn). All constructs were confirmed by sequencing. Viral titers for all transfections were determined to be 107 plaque-forming units/ml. Expression levels as determined by flow cytometric analysis were >95% for all lentivirally encoded GFP gene products. The pLenti6.2-hTRAF6dn vector continually expressed the peptide for TRAF6dn during tumor cell proliferation. We found that TRAF6dn began to inhibit MM cell proliferation in the U266 myeloma cell line after 72 hours of culture and most prominently on day 6. However, the inhibition of RPMI8226 cell proliferation by TRAFdn started after 24 hours of culture whereas effects on inducing MM cell apoptosis were most prominent at 72 hours. The decrease in cell proliferation and increase in cell apoptosis occurred in a dose-dependent fashion. We also examined the effects of TRAF6dn on the NF-κB and JNK pathway since this signaling pathway is associated with cell cycle effects in myeloma. Phosphorylated NF-κB protein levels were reduced using the TRAF6dn expression vector. We also determined the phosphorylation of JUN kinase kinase (JNKK), which activates the MAP kinase homologues SAPK and JNK in response to IL-1 receptor stimulation. The results showed that the phosphorylation of JNKK is clearly reduced following blocking the TRAF6 function domain with the TRAF6dn. Furthermore, we examined c-Jun, a component of the transcription factor complex AP-1, which binds and activates transcription at TRE/AP-1 elements. The transcriptional activity of c-Jun is regulated by SAPK/JNK binding to c-Jun and phosphorylation of c-Jun at Ser63/73. We found that total endogenous c-Jun is reduced after blocking the TRAF6 function domain with TRAF6dn in the RPMI8226 and U266 MM cell lines. Comparing TRAF6dn with TRAF6 siRNA, only the TRAF6dn inhibited the TRAF6 function domain. These studies suggest that the TRAF6dn peptide may impede myeloma cell signaling pathways resulting in inhibition of tumor cell growth and may represent a new approach to treating patients with MM.

Bone resorption leading to osteolytic bone disease is characteristic of multiple myeloma (MM). Recent studies show the presence of bone-resorbing osteoclasts and bone-forming osteoclasts in the circulation, and these cells may correlate with bone disease and change with anti-bone resorptive therapies. We have investigated whether there is an imbalance in the expression of osteoblast and osteoclast genes in the peripheral blood mononuclear cells (PBMCs) from MM patients relative to normal age-matched controls and the effect of bisphosphonate treatment on the expression of these genes. We analyzed the expression of a panel of osteoblast-related (bone alkaline phosphatase [bone AP], bone morphogenic protein 2 [BMP2], collagen I and osteocalcin) and osteoclast-related (b3 integrin, calcitonin, receptor for activation of nuclear factor kappa B [RANK] and tartrate-resistant alkaline phosphatase [TRAP]) genes by semi-quantitative RT-PCR on total RNA isolated from PBMCs obtained following density gradient separation. We demonstrated that the expression of the osteoblast-related gene BMP2 was reduced in eight of nine MM patients when compared with normal donors. In marked contrast, three osteoclast-related genes, b3 integrin, RANK and TRAP, were more highly expressed in all nine MM patients compared to the normal donors; only calcitonin expression was similar to the control subjects. Interestingly, patients receiving bisphosphonate treatment appeared to show increased osteoblast gene expression with higher amounts of bone AP, BMP2 and osteocalcin RNA compared to the patients not receiving anti-bone resorptive therapy. However, there was no alteration in the level of the RNA in any of the four osteoclast genes compared to patients not receiving anti-bone resorptive therapy. We are extending our analysis to a larger panel of MM patients in order to determine the relationship between these circulating cells and bone disease, overall clinical status and change in their levels with anti-bone resorptive therapy. In addition, we are also investigating whether there exist larger and smaller numbers of circulating osteoclasts and osteoblasts, respectively, in MM patients, or whether these circulating cells show alteration of their expression of these genes. Our semi-quantitative RT-PCR results are being correlated with immunohistochemical staining results from osteoblast and osteoclast markers obtained on PBMCs from MM and normal subjects. These studies provide evidence that the number of circulating osteoblasts and osteoclasts is altered in patients with MM, and also may suggest that bisphosphonate therapy may also be associated with changes in these cell populations.