Search

We report a crystal structure at atomic resolution (0.9 Å) of a ruthenium complex bound to a consecutive DNA double mismatch, which results in a TA basepair with flipped out thymine, together with the formation of an adenine bulge. The structure shows a form of metalloinsertion interaction of the Λ-[Ru(phen) 2 phi] 2+ (phi = 9,10-phenanthrenediimine) complex at the bulge site. The metal complex interacts with the DNA via the major groove, where specific interactions between the adenines of the DNA and the phen ligands of the complex are formed. One Δ-[Ru(phen) 2 phi] 2+ complex interacts via the minor groove, which shows sandwiching of its phi ligand between the phi ligands of the other two ruthenium complexes, and no interaction of its phen ligands with DNA. To our knowledge, this binding model represents a new form of metalloinsertion in showing major rather than minor groove insertion., Competing Interests: There are no conflicts to declare., (This journal is © The Royal Society of Chemistry.)

The grooves of DNA provide recognition sites for many nucleic acid binding proteins and anticancer drugs such as the covalently binding cisplatin. Here we report a crystal structure showing, for the first time, groove selectivity by an intercalating ruthenium complex. The complex Λ-[Ru(phen) 2 phi] 2+ , where phi=9,10-phenanthrenediimine, is bound to the DNA decamer duplex d(CCGGTACCGG) 2 . The structure shows that the metal complex is symmetrically bound in the major groove at the central TA/TA step, and asymmetrically bound in the minor groove at the adjacent GG/CC steps. A third type of binding links the strands, in which each terminal cytosine base stacks with one phen ligand. The overall binding stoichiometry is four Ru complexes per duplex. Complementary biophysical measurements confirm the binding preference for the Λ-enantiomer and show a high affinity for TA/TA steps and, more generally, TA-rich sequences. A striking enantiospecific elevation of melting temperatures is found for oligonucleotides which include the TATA box sequence., (© 2024 The Authors. Angewandte Chemie International Edition published by Wiley-VCH GmbH.)

Lack of selectivity is one of the main issues with currently used chemotherapies, causing damage not only to altered cells but also to healthy cells. Over the last decades, photodynamic therapy (PDT) has increased as a promising therapeutic tool due to its potential to treat diseases like cancer or bacterial infections with a high spatiotemporal control. Ruthenium(II) polypyridyl compounds are gaining attention for their application as photosensitizers (PSs) since they are generally nontoxic in dark conditions, while they show remarkable toxicity after light irradiation. In this work, four Ru(II) polypyridyl compounds with sterically expansive ligands were studied as PDT agents. The Ru(II) complexes were synthesized using an alternative route to those described in the literature, which resulted in an improvement of the synthesis yields. Solid-state structures of compounds [Ru(DIP) 2 phen]Cl 2 and [Ru(dppz) 2 phen](PF 6 ) 2 have also been obtained. It is well-known that compound [Ru(dppz)(phen) 2 ]Cl 2 binds to DNA by intercalation. Therefore, we used [Ru(dppz) 2 phen]Cl 2 as a model for DNA interaction studies, showing that it stabilized two different sequences of duplex DNA. Most of the synthesized Ru(II) derivatives showed very promising singlet oxygen quantum yields, together with noteworthy photocytotoxic properties against two different cancer cell lines, with IC 50 in the micro- or even nanomolar range (0.06-7 μM). Confocal microscopy studies showed that [Ru(DIP) 2 phen]Cl 2 and [Ru(DIP) 2 TAP]Cl 2 accumulate preferentially in mitochondria, while no mitochondrial internalization was observed for the other compounds. Although [Ru(dppn) 2 phen](PF 6 ) 2 did not accumulate in mitochondria, it interestingly triggered an impairment in mitochondrial respiration after light irradiation. Among others, [Ru(dppn) 2 phen](PF 6 ) 2 stands out for its very good IC 50 values, correlated with a very high singlet oxygen quantum yield and mitochondrial respiration disruption.

The four natural DNA bases (A, T, G and C) associate in base pairs (A=T and G≡C), allowing the attached DNA strands to assemble into the canonical double helix of DNA (or duplex-DNA, also known as B-DNA). The intrinsic supramolecular properties of nucleobases make other associations possible (such as base triplets or quartets), which thus translates into a diversity of DNA structures beyond B-DNA. To date, the alphabet of DNA structures is ripe with approximately 20 letters (from A- to Z-DNA); however, only a few of them are being considered as key players in cell biology and, by extension, valuable targets for chemical biology intervention. In the present review, we summarise what is known about alternative DNA structures (what are they? When, where and how do they fold?) and proceed to discuss further about those considered nowadays as valuable therapeutic targets. We discuss in more detail the molecular tools (ligands) that have been recently developed to target these structures, particularly the three- and four-way DNA junctions, in order to intervene in the biological processes where they are involved. This new and stimulating chemical biology playground allows for devising innovative strategies to fight against genetic diseases., (© The Author(s) 2022. Published by Oxford University Press on behalf of Nucleic Acids Research.)

Cationic porphyrins based on the 5,10,15,20- meso -(tetrakis-4- N -methylpyridyl) core (TMPyP4) have been studied extensively over many years due to their strong interactions with a variety of nucleic acid structures, and their potential use as photodynamic therapeutic agents and telomerase inhibitors. In this paper, the interactions of metal-free TMPyP4 and Pt(II)TMPyP4 with guanine-containing nucleic acids are studied for the first time using time-resolved infrared spectroscopy (TRIR). In D 2 O solution (where the metal-free form exists as D 2 TMPyP4) both compounds yielded similar TRIR spectra (between 1450-1750 cm -1 ) following pulsed laser excitation in their Soret B-absorption bands. Density functional theory calculations reveal that vibrations centred on the methylpyridinium groups are responsible for the dominant feature at ca. 1640 cm -1 . TRIR spectra of D 2 TMPyP4 or PtTMPyP4 in the presence of guanosine 5'-monophosphate (GMP), double-stranded {d(GC) 5 } 2 or {d(CGCAAATTTGCG)} 2 contain negative-going signals, 'bleaches', indicative of binding close to guanine. TRIR signals for D 2 TMPyP4 or PtTMPyP bound to the quadruplex-forming cMYC sequence {d(TAGGGAGGG)} 2 T indicate that binding occurs on the stacked guanines. For D 2 TMPyP4 bound to guanine-containing systems, the TRIR signal at ca. 1640 cm -1 decays on the picosecond timescale, consistent with electron transfer from guanine to the singlet excited state of D 2 TMPyP4, although IR marker bands for the reduced porphyrin/oxidised guanine were not observed. When PtTMPyP is incorporated into HeLa tumour cells, TRIR studies show protein binding with time-dependent ps/ns changes in the amide absorptions demonstrating TRIR's potential for studying light-activated molecular processes not only with nucleic acids in solution but also in biological cells.

DNA is a strikingly flexible molecule and can form a variety of secondary structures, including the triple helix, which is the subject of this review. The DNA triplex may be formed naturally, during homologous recombination, or can be formed by the introduction of a synthetic triplex forming oligonucleotide (TFO) to a DNA duplex. As the TFO will bind to the duplex with sequence specificity, there is significant interest in developing TFOs with potential therapeutic applications, including using TFOs as a delivery mechanism for compounds able to modify or damage DNA. However, to combine triplexes with functionalised compounds, a full understanding of triplex structure and chemical modification strategies, which may increase triplex stability or in vivo degradation, is essential - these areas will be discussed in this review. Ruthenium polypyridyl complexes, which are able to photooxidise DNA and act as luminescent DNA probes, may serve as a suitable photophysical payload for a TFO system and the developments in this area in the context of DNA triplexes will also be reviewed., Competing Interests: There are no conflicts to declare., (This journal is © The Royal Society of Chemistry.)

The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, consistent with its transient formation in live cells. The stabilization of a particular topology by a small molecule is of great importance for therapeutic applications. Here, we show that the ruthenium complex Λ-[Ru(phen) 2 (qdppz)] 2+ displays enantiospecific G-quadruplex binding. It crystallized in 1:1 stoichiometry with a modified human telomeric G-quadruplex sequence, GGGTTAGGGTTAGGGTTTGGG ( htel21 T 18 ), in an antiparallel chair topology, the first structurally characterized example of ligand binding to this topology. The lambda complex is bound in an intercalation cavity created by a terminal G-quartet and the central narrow lateral loop formed by T 10 -T 11 -A 12 . The two remaining wide lateral loops are linked through a third K + ion at the other end of the G-quartet stack, which also coordinates three thymine residues. In a comparative ligand-binding study, we showed, using a Klenow fragment assay, that this complex is the strongest observed inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work.

Ultrafast time-resolved infrared (TRIR) is used to report on the binding site of the [Ru(phen) 2 (dppz)] 2+ "light-switch" complex with both bimolecular (Oxytricha nova telomere) and intramolecular (human telomere) guanine-quadruplex structures in both K + and Na + containing solutions. TRIR permits the simultaneous monitoring both of the "dark" and "bright" states of the complex and of the quadruplex nucleobase bases, the latter via a Stark effect induced by the excited state of the complex. These data are used to establish the contribution of guanine base stacking and loop interactions to the binding site of this biologically relevant DNA structure in solution. A particularly striking observation is the strong thymine signal observed for the Na + form of the human telomere sequence, which is expected to be in the anti-parallel conformation., (© 2020 Wiley-VCH GmbH.)

Ultrafast time resolved infrared (TRIR) is used to report on the binding site of the "light-switch" complex [Ru(phen) 2 (dppz)] 2+ 1 to i-motif structures in solution. Detailed information is provided due to perturbation of the local base vibrations by a 'Stark-like' effect which is used to establish the contribution of thymine base loop interactions to the binding site of 1 in this increasingly relevant DNA structure.

Ruthenium polypyridyl complexes which can sensitise the photo-oxidation of nucleic acids and other biological molecules show potential for photo-therapeutic applications. In this article a combination of transient visible absorption (TrA) and time-resolved infra-red (TRIR) spectroscopy are used to compare the photo-oxidation of guanine by the enantiomers of [Ru(TAP) 2 (dppz)] 2+ in both polymeric {poly(dG-dC), poly(dA-dT) and natural DNA} and small mixed-sequence duplex-forming oligodeoxynucleotides. The products of electron transfer are readily monitored by the appearance of a characteristic TRIR band centred at ca. 1700 cm -1 for the guanine radical cation and a band centered at ca. 515 nm in the TrA for the reduced ruthenium complex. It is found that efficient electron transfer requires that the complex be intercalated at a G-C base-pair containing site. Significantly, changes in the nucleobase vibrations of the TRIR spectra induced by the bound excited state before electron transfer takes place are used to identify preferred intercalation sites in mixed-sequence oligodeoxynucleotides and natural DNA. Interestingly, with natural DNA, while it is found that quenching is inefficient in the picosecond range, a slower electron transfer process occurs, which is not found with the mixed-sequence duplex-forming oligodeoxynucleotides studied., Competing Interests: There are no conflicts to declare., (This journal is © The Royal Society of Chemistry.)

A spectroscopic study of the interactions of Λ- and Δ-[Ru(phen) 2 (dppz)] 2+ with i-motif DNA containing thymine loops of various lengths. In the presence of i-motifs, the luminescence of the Λ enantiomer was enhanced much more than the Δ. Despite this, the effect of each enantiomer on i-motif thermal stability was comparable. The sequences most affected by [Ru(phen) 2 (dppz)] 2+ were those with long thymine loops; this suggests that long-looped i-motifs are attractive targets for potential transition metal complex drugs and should be explored further in drug design., (Copyright © 2019 Pages, Gurung, McQuaid, Hall, Cardin and Brazier.)

Λ-[Ru(TAP)2(dppz)]2+ was crystallised with the G-quadruplex-forming heptamer d(TAGGGTT). Surprisingly, even though there are four unique binding sites, the complex is not in contact with any G-quartet surface. Two complexes stabilise cavities formed from terminal T·A and T·T mismatched pairs. A third shows kinking by a TAP ligand between T·T linkages, while the fourth shows sandwiching of a dppz ligand between a T·A/T·A quadruplex and a T·T mismatch, stabilised by an additional T·A base pair stacking interaction on a TAP surface. Overall, the structure shows an unexpected affinity for thymine, and suggests models for G-quadruplex loop binding.

By using X-ray crystallography, we show that the complexes Λ/Δ-[Ru(TAP) 2 (11-CN-dppz)] 2+ (TAP=1,4,5,8-tetraazaphenanthrene, dppz=dipyridophenazine) bind DNA G-quadruplex in an enantiospecific manner that parallels the specificity of these complexes with duplex DNA. The Λ complex crystallises with the normally parallel stranded d(TAGGGTTA) tetraplex to give the first such antiparallel strand assembly in which syn-guanosine is adjacent to the complex at the 5' end of the quadruplex core. SRCD measurements confirm that the same conformational switch occurs in solution. The Δ enantiomer, by contrast, is present in the structure but stacked at the ends of the assembly. In addition, we report the structure of Λ-[Ru(phen) 2 (11-CN-dppz)] 2+ bound to d(TCGGCGCCGA), a duplex-forming sequence, and use both structural models to provide insight into the motif-specific luminescence response of the isostructural phen analogue enantiomers., (© 2019 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.)

[Ru(TAP) 2 (dppz)] 2+ (TAP = 1,4,5,8-tetraazaphenanthrene; dppz = dipyrido[3,2- a:2',3'- c]phenazine) is known to photo-oxidize guanine in DNA. Whether this oxidation proceeds by direct photoelectron transfer or by proton-coupled electron transfer is still unknown. To help distinguish between these mechanisms, spectro-electrochemical experiments have been carried out with [Ru(TAP) 2 (dppz)] 2+ in acetonitrile. The UV-vis and mid-IR spectra obtained for the one-electron reduced product were compared to those obtained by picosecond transient absorption and time-resolved infrared experiments of [Ru(TAP) 2 (dppz)] 2+ bound to guanine-containing DNA. An interesting feature of the singly reduced species is an electronic transition in the near-IR region (with λ max at 1970 and 2820 nm). Density functional and time-dependent density functional theory simulations of the vibrational and electronic spectra of [Ru(TAP) 2 (dppz)] 2+ , the reduced complex [Ru(TAP) 2 (dppz)] + , and four isomers of [Ru(TAP)(TAPH)(dppz)] 2+ (a possible product of proton-coupled electron transfer) were performed. Significantly, these predict absorption bands at λ > 1900 nm (attributed to a ligand-to-metal charge-transfer transition) for [Ru(TAP) 2 (dppz)] + but not for [Ru(TAP)(TAPH)(dppz)] 2+ . Both the UV-vis and mid-IR difference absorption spectra of the electrochemically generated singly reduced species [Ru(TAP) 2 (dppz)] + agree well with the transient absorption and time-resolved infrared spectra previously determined for the transient species formed by photoexcitation of [Ru(TAP) 2 (dppz)] 2+ intercalated in guanine-containing DNA. This suggests that the photochemical process in DNA proceeds by photoelectron transfer and not by a proton-coupled electron transfer process involving formation of [Ru(TAP)(TAPH)(dppz)] 2+ , as is proposed for the reaction with 5'-guanosine monophosphate. Additional infrared spectro-electrochemical measurements and density functional calculations have also been carried out on the free TAP ligand. These show that the TAP radical anion in acetonitrile also exhibits strong broad near-IR electronic absorption (λ max at 1750 and 2360 nm).

The new complexes [Ru(TAP) 2 (11-CN-dppz)] 2+ , [Ru(TAP) 2 (11-Br-dppz)] 2+ and [Ru(TAP) 2 (11,12-diCN-dppz)] 2+ are reported. The addition of nitrile substituents to the dppz ligand of the DNA photo-oxidising complex [Ru(TAP) 2 (dppz)] 2+ promote π-stacking interactions and ordered binding to DNA, as shown by X-ray crystallography. The structure of Λ-[Ru(TAP) 2 (11-CN-dppz)] 2+ with the DNA duplex d(TCGGCGCCGA) 2 shows, for the first time with this class of complex, a closed intercalation cavity with an AT base pair at the terminus. The structure obtained is compared to that formed with the 11-Br and 11,12-dinitrile derivatives, highlighting the stabilization of syn guanine by this enantiomer when the terminal base pair is GC. In contrast the AT base pair has the normal Watson-Crick orientation, highlighting the difference in charge distribution between the two purine bases and the complementarity of the dppz-purine interaction. The asymmetry of the cavity highlights the importance of the purine-dppz-purine stacking interaction., (© 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.)

Sequence-selective intercalation of pyrene into the chain-folds of a random, binary copolyimide under fast-exchange conditions results in the development of self-similar structure in the diimide region of the 1 H NMR spectrum. The resulting spectrum can be described by the mathematics of fractals, an approach that is rationalised in terms of a dynamic summation of ring-current shielding effects produced by pyrene molecules intercalating into the chain at progressively greater distances from each "observed" diimide residue. The underlying set of all such summations is found to be a defined mathematical fractal namely the fourth-quarter Cantor set, within which the observed spectrum is embedded. The pattern of resonances predicted by a geometric construction of the fourth-quarter Cantor set agrees well with the observed spectrum.

Key to the development of DNA-targeting phototherapeutic drugs is determining the interplay between the photoactivity of the drug and its binding preference for a target sequence. For the photo-oxidising lambda-[Ru(TAP) 2 (dppz)] 2+ (Λ-1) (dppz=dipyridophenazine) complex bound to either d{T 1 C 2 G 3 G 4 C 5 G 6 C 7 C 8 G 9 A 10 } 2 (G9) or d{TCGGCGCCIA} 2 (I9), the X-ray crystal structures show the dppz intercalated at the terminal T 1 C 2 ;G 9 A 10 step or T 1 C 2 ;I 9 A 10 step. Thus substitution of the G 9 nucleobase by inosine does not affect intercalation in the solid state although with I9 the dppz is more deeply inserted. In solution it is found that the extent of guanine photo-oxidation, and the rate of back electron-transfer, as determined by pico- and nanosecond time-resolved infrared and transient visible absorption spectroscopy, is enhanced in I9, despite it containing the less oxidisable inosine. This is attributed to the nature of the binding in the minor groove due to the absence of an NH 2 group. Similar behaviour and the same binding site in the crystal are found for d{TTGGCGCCAA} 2 (A9). In solution, we propose that intercalation occurs at the C 2 G 3 ;C 8 I 9 or T 2 G 3 ;C 8 A 9 steps, respectively, with G 3 the likely target for photo-oxidation. This demonstrates how changes in the minor groove (in this case removal of an NH 2 group) can facilitate binding of Ru II dppz complexes and hence influence any sensitised reactions occurring at these sites. No similar enhancement of photooxidation on binding to I9 is found for the delta enantiomer., (© 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.)

Recent research on the study of the interaction of ruthenium polypyridyl compounds and defined sequence nucleic acids is reviewed. Particular emphasis is paid to complexes [Ru(LL) 2 (Int)] 2+ containing potentially intercalating ligands (Int) such as dipyridophenazine (dppz), which are known to display light-switching or photo-oxidising behaviour, depending on the nature of the ancillary ligands. X-ray crystallography has made a key contribution to our understanding, and the first complete survey of structural results is presented. These include sequence, enantiomeric, substituent and structural specificities. The use of ultrafast transient spectroscopic methods to probe the ultrafast processes for complexes such as [Ru(TAP) 2 (dppz)] 2+ and [Ru(phen) 2 (dppz)] 2+ when bound to mixed sequence oligonucleotides are reviewed with particular attention being paid to the complementary advantages of transient (visible) absorption and time-resolved (mid) infra-red techniques to probe spectral changes in the metal complex and in the nucleic acid. The observed photophysical properties are considered in light of the structural information obtained from X-ray crystallography. In solution, metal complexes can be expected to bind at more than one DNA step, so that a perfect correlation of the photophysical properties and factors such as the orientation or penetration of the ligand into the intercalation pocket should not be expected. This difficulty can be obviated by carrying out TRIR studies in the crystals. Dppz complexes also undergo insertion, especially with mismatched sequences. Future areas for study such as those involving non-canonical forms of DNA, such as G-quadruplexes or i-motifs are also briefly considered.

X-ray crystal structures of three Λ-[Ru(L) 2 dppz] 2+ complexes (dppz=dipyridophenazine; L=1,10-phenanthroline (phen), 2,2'-bipyridine (bpy)) bound to d((5BrC)GGC/GCCG) showed the compounds intercalated at a 5'-CG-3' step. The compounds bind through canted intercalation, with the binding angle determined by the guanine NH 2 group, in contrast to symmetrical intercalation previously observed at 5'-TA-3' sites. This result suggests that canted intercalation is preferred at 5'-CG-3' sites even though the site itself is symmetrical, and we hypothesise that symmetrical intercalation in a 5'-CG-3' step could give rise to a longer luminescence lifetime than canted intercalation., (© 2017 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.)

[Ru(phen) 2 (dppz)] 2+ has been studied since the 1990s due to its 'light-switch' properties. It can be used as a luminescent DNA probe, with emission switched on through DNA binding. The luminescence observed is dependent on the solvent accessibility of the pyrazine nitrogen atoms, and therefore is sensitive to changes in both binding site of the cation and chromophore orientation. The compound is also chiral, and there are distinct differences between the enantiomers in terms of the emission behaviour when bound to a variety of DNA sequences. Whilst a number of binary DNA-complex X-ray crystal structures are available, most include the Λ enantiomer and there is very little structural information about binding of the Δ enantiomer. Here, we present the first X-ray crystal structure of a Δ enantiomer bound to well-matched DNA, in the absence of the other, Λ enantiomer. We show how the binding site observed here can be related to a more general pattern of motifs in the crystallographic literature and propose that the Δ enantiomer can bind with five different binding modes, offering a new hypothesis for the interpretation of solution data., (© The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.)

UV-generated excited states of cytosine (C) nucleobases are precursors to mutagenic photoproduct formation. The i-motif formed from C-rich sequences is known to exhibit high yields of long-lived excited states following UV absorption. Here the excited states of several i-motif structures have been characterized following 267 nm laser excitation using time-resolved infrared spectroscopy (TRIR). All structures possess a long-lived excited state of ∼300 ps and notably in some cases decays greater than 1 ns are observed. These unusually long-lived lifetimes are attributed to the interdigitated DNA structure which prevents direct base stacking overlap., (© 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.)

The [Ru(phen) 2 (dppz)] 2+ complex ( 1 ) is non-emissive in water but is highly luminescent in organic solvents or when bound to DNA, making it a useful probe for DNA binding. To date, a complete mechanistic explanation for this "light-switch" effect is still lacking. With this in mind we have undertaken an ultrafast time resolved infrared (TRIR) study of 1 and directly observe marker bands between 1280-1450 cm -1 , which characterise both the emissive "bright" and the non-emissive "dark" excited states of the complex, in CD 3 CN and D 2 O respectively. These characteristic spectral features are present in the [Ru(dppz) 3 ] 2+ solvent light-switch complex but absent in [Ru(phen) 3 ] 2+ , which is luminescent in both solvents. DFT calculations show that the vibrational modes responsible for these characteristic bands are predominantly localised on the dppz ligand. Moreover, they reveal that certain vibrational modes of the "dark" excited state couple with vibrational modes of two coordinating water molecules, and through these to the bulk solvent, thus providing a new insight into the mechanism of the light-switch effect. We also demonstrate that the marker bands for the "bright" state are observed for both Λ- and Δ-enantiomers of 1 when bound to DNA and that photo-excitation of the complex induces perturbation of the guanine and cytosine carbonyl bands. This perturbation is shown to be stronger for the Λ-enantiomer, demonstrating the different binding site properties of the two enantiomers and the ability of this technique to determine the identity and nature of the binding site of such intercalators.

To understand the molecular origins of diseases caused by ultraviolet and visible light, and also to develop photodynamic therapy, it is important to resolve the mechanism of photoinduced DNA damage. Damage to DNA bound to a photosensitizer molecule frequently proceeds by one-electron photo-oxidation of guanine, but the precise dynamics of this process are sensitive to the location and the orientation of the photosensitizer, which are very difficult to define in solution. To overcome this, ultrafast time-resolved infrared (TRIR) spectroscopy was performed on photoexcited ruthenium polypyridyl-DNA crystals, the atomic structure of which was determined by X-ray crystallography. By combining the X-ray and TRIR data we are able to define both the geometry of the reaction site and the rates of individual steps in a reversible photoinduced electron-transfer process. This allows us to propose an individual guanine as the reaction site and, intriguingly, reveals that the dynamics in the crystal state are quite similar to those observed in the solvent medium.

Small changes in DNA sequence can often have major biological effects. Here the rates and yields of guanine photo-oxidation by Λ-[Ru(TAP)2(dppz)](2+) have been compared in 5'-{CCGGATCCGG}2 and 5'-{CCGGTACCGG}2 using pico/nanosecond transient visible and time-resolved IR (TRIR) spectroscopy. The inefficiency of electron transfer in the TA sequence is consistent with the 5'-TA-3' versus 5'-AT-3' binding preference predicted by X-ray crystallography. The TRIR spectra also reveal the differences in binding sites in the two oligonucleotides., (© 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.)

Using UV and srCD spectroscopy it is found that loop length within the i-motif structure is important for both thermal and pH stability, but in contrast to previous statements, it is the shorter loops that exhibit the highest stability.

The intercalating [Ru(TAP)2(dppz)](2+) complex can photo-oxidise guanine in DNA, although in mixed-sequence DNA it can be difficult to understand the precise mechanism due to uncertainties in where and how the complex is bound. Replacement of guanine with the less oxidisable inosine (I) base can be used to understand the mechanism of electron transfer (ET). Here the ET has been compared for both Λ- and Δ-enantiomers of [Ru(TAP)2(dppz)](2+) in a set of sequences where guanines in the readily oxidisable GG step in {TCGGCGCCGA}2 have been replaced with I. The ET has been monitored using picosecond and nanosecond transient absorption and picosecond time-resolved IR spectroscopy. In both cases inosine replacement leads to a diminished yield, but the trends are strikingly different for Λ- and Δ-complexes.

Picosecond transient absorption (TA) and time-resolved infrared (TRIR) measurements of rac-[Cr(phen)2(dppz)](3+) () intercalated into double-stranded guanine-containing DNA reveal that the excited state is very rapidly quenched. As no evidence was found for the transient electron transfer products, it is proposed that the back electron transfer reaction must be even faster (<3 ps).

Hydration-dependent DNA deformation has been known since Rosalind Franklin recognized that the relative humidity of the sample had to be maintained to observe a single conformation in DNA fiber diffraction. We now report for the first time the crystal structure, at the atomic level, of a dehydrated form of a DNA duplex and demonstrate the reversible interconversion to the hydrated form at room temperature. This system, containing d(TCGGCGCCGA) in the presence of Λ-[Ru(TAP)2(dppz)](2+) (TAP = 1,4,5,8-tetraazaphenanthrene, dppz = dipyrido[3,2-a:2',3'-c]phenazine), undergoes a partial transition from an A/B hybrid to the A-DNA conformation, at 84-79% relative humidity. This is accompanied by an increase in kink at the central step from 22° to 51°, with a large movement of the terminal bases forming the intercalation site. This transition is reversible on rehydration. Seven data sets, collected from one crystal at room temperature, show the consequences of dehydration at near-atomic resolution. This result highlights that crystals, traditionally thought of as static systems, are still dynamic and therefore can be the subject of further experimentation.

The o-palladated, chloro-bridged dimers [Pd{2-phenylpyridine(-H)}-μ-Cl]2 and [Pd{N,N-dimethylbenzylamine(-H)}-μ-Cl]2 react with cyanuric acid in the presence of base to afford closed, chiral cage-molecules in which 12 organo-Pd(II) centers, located in pairs at the vertices of an octahedron, are linked by four tetrahedrally arranged cyanurato(3-) ligands. Incomplete (Pd10) cages, having structures derived from the corresponding Pd12 cages by replacing one pair of organopalladium centers with two protons, have also been isolated. Reaction of [Pd{2-phenylpyridine(-H)}-μ-Cl]2 with trithiocyanuric acid gives an entirely different and more open type of cage-complex, comprising only nine organopalladium centers and three thiocyanurato(3-) ligands: cage-closure in this latter system appears to be inhibited by steric crowding of the thiocarbonyl groups.

We report an atomic resolution X-ray crystal structure containing both enantiomers of rac-[Ru(phen)2dppz](2+) with the d(ATGCAT)2 DNA duplex (phen = phenanthroline; dppz = dipyridophenazine). The first example of any enantiomeric pair crystallized with a DNA duplex shows different orientations of the Λ and Δ binding sites, separated by a clearly defined structured water monolayer. Job plots show that the same species is present in solution. Each enantiomer is bound at a TG/CA step and shows intercalation from the minor groove. One water molecule is directly located on one phenazine N atom in the Δ-enantiomer only.

The crystal structure of the ruthenium DNA 'light-switch' complex Λ-[Ru(TAP)2(11-Cl-dppz)](2+) (TAP=tetraazaphenanthrene, dppz=dipyrido[3,2-a':2',3'-c]phenazine) bound to the oligonucleotide duplex d(TCGGCGCCGA)2 is reported. The synthesis of the racemic ruthenium complex is described for the first time, and the racemate was used in this study. The crystal structure, at atomic resolution (1.0 Å), shows one ligand as a wedge in the minor groove, resulting in the 51(°) kinking of the double helix, as with the parent Λ-[Ru(TAP)2(dppz)](2+). Each complex binds to one duplex by intercalation of the dppz ligand and also by semi-intercalation of one of the orthogonal TAP ligands into a second symmetrically equivalent duplex. The 11-chloro substituent binds with the major component (66%) oriented with the 11-chloro substituent on the purine side of the terminal step of the duplex.

Self-complementary tweezer-molecules based on a naphthalenediimide core self-assemble into supramolecular dimers through mutual π-π-stacking and hydrogen bonding. The resulting motif is extremely stable in solution (K(a) = 10(5) M(-1)), and its attachment to one terminal position of a poly(ethylene glycol) chain leads to a doubling of the polymer's apparent molecular weight.

The ruthenium complex [Ru(phen)(2)(dppz)](2+) (where phen is phenanthroline and dppz dipyridophenazine is known as a 'light switch' complex because its luminescence in solution is significantly enhanced in the presence of DNA. This property is poised to serve in diagnostic and therapeutic applications, but its binding mode with DNA needs to be elucidated further. Here, we describe the crystal structures of the Λ enantiomer bound to two oligonucleotide duplexes. The dppz ligand intercalates symmetrically and perpendicularly from the minor groove of the d(CCGGTACCGG)(2) duplex at the central TA/TA step, but not at the central AT/AT step of d(CCGGATCCGG)(2). In both structures, however, a second ruthenium complex links the duplexes through the combination of a shallower angled intercalation into the C(1)C(2)/G(9)G(10) step at the end of the duplex, and semi-intercalation into the G(3)G(4) step of an adjacent duplex. The TA/TA specificity of the perpendicular intercalation arises from the packing of phenanthroline ligands against the adenosine residue.

A focused library of potential hydrogelators each containing two substituted aromatic residues separated by a urea or thiourea linkage have been synthesised and characterized. Six of these novel compounds are highly efficient hydrogelators, forming gels in aqueous solution at low concentrations (0.03-0.60 wt%). Gels were formed through a pH switching methodology, by acidification of a basic solution (pH 14 to ≈ 4) either by addition of HCl or via the slow hydrolysis of glucono-δ-lactone. Frequently, gelation was accompanied by a dramatic switch in the absorption spectra of the gelators, resulting in a significant change in colour, typically from a vibrant orange to pale yellow. Each of the gels was capable of sequestering significant quantities of the aromatic cationic dye, methylene blue, from aqueous solution (up to 1.02 g of dye per gram of dry gelator). Cryo-transmission electron microscopy of two of the gels revealed an extensive network of high aspect ratio fibers. The structure of the fibers altered dramatically upon addition of 20 wt% of the dye, resulting in aggregation and significant shortening of the fibrils. This study demonstrates the feasibility for these novel gels finding application as inexpensive and effective water purification platforms., (Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.)

The different triplet sequences in high molecular weight aromatic copolyimides comprising pyromellitimide units ("I") flanked by either ether-ketone ("K") or ether-sulfone residues ("S") show different binding strengths for pyrene-based tweezer-molecules. Such molecules bind primarily to the diimide unit through complementary π-π-stacking and hydrogen bonding. However, as shown by the magnitudes of (1)H NMR complexation shifts and tweezer-polymer binding constants, the triplet "SIS" binds tweezer-molecules more strongly than "KIS" which in turn binds such molecules more strongly than "KIK". Computational models for tweezer-polymer binding, together with single-crystal X-ray analyses of tweezer-complexes with macrocyclic ether-imides, reveal that the variations in binding strength between the different triplet sequences arise from the different conformational preferences of aromatic rings at diarylketone and diarylsulfone linkages. These preferences determine whether or not chain-folding and secondary π-π-stacking occurs between the arms of the tweezer-molecule and the 4,4'-biphenylene units which flank the central diimide residue., (© 2011 American Chemical Society)

We describe a crystal structure, at atomic resolution (1.1 Å, 100 K), of a ruthenium polypyridyl complex bound to duplex DNA, in which one ligand acts as a wedge in the minor groove, resulting in the 51° kinking of the double helix. The complex cation Λ-[Ru(1,4,5,8-tetraazaphenanthrene)(2)(dipyridophenazine)](2+) crystallizes in a 11 ratio with the oligonucleotide d(TCGGCGCCGA) in the presence of barium ions. Each complex binds to one duplex by intercalation of the dipyridophenazine ligand and also by semiintercalation of one of the orthogonal tetraazaphenanthrene ligands into a second symmetrically equivalent duplex. The result is noncovalent cross-linking and marked kinking of DNA.

The synthesis of a dithiol-functionalized pyrene derivative is reported, together with studies of interactions between this receptor (and other related pyrenes) and nitroaromatic compounds (NACs), in both solution and in the solid state. Spectroscopic analysis in solution and X-ray crystallographic analysis of cocrystals of pyrene and NACs in the solid state indicate that supramolecular interactions lead to the formation of defined π-π stacked complexes. The dithiol-functionalized pyrene derivative can be used to modify the surface of a gold quartz crystal microbalance (QCM) to create a unique π-electron rich surface, which is able to interact with electron poor aromatic compounds. For example, exposure of the modified QCM surface to the nitroaromatic compound 2,4-dinitrotoluene (DNT) in solution results in a reduction in the resonant frequency of the QCM as a result of supramolecular interactions between the electron-rich pyrenyl surface layer and the electron-poor DNT molecules. These results suggest the potential use of such modified QCM surfaces for the detection of explosive NACs.

A structurally simple low molecular weight hydrogelator derived from isophthalic acid forms robust pH-responsive hydrogels capable of highly efficient and selective dye adsorption.

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)(2), showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Pseudoacid chlorides of 2,5-bis(4-fluorobenzoyl) terephthalic acid and 4,6-bis(4-fluorobenzoyl) isophthalic acid condense with primary amines to afford diastereomeric bis(hydroxyindolinone)s in good isolated yields and with diamines to give high molecular weight poly(hydroxyindolinone)s. Bis-N-pyrenemethyl bis(hydroxyindolinone)s assemble, even in dipolar solvents such as DMSO, with macrocyclic diimide-sulfones to give [3]pseudorotaxanes stabilized by electronically complementary aromatic pi-pi-stacking and shape-complementary van der Waals interactions.

Information storage and processing is carried out at the level of individual macromolecules in biological systems, but there is no reason, in principle, why synthetic copolymers should not be used for the same purpose. Previous work has suggested that monomer sequence information in chain-folding synthetic copolyimides can be recognized by tweezer-type molecules binding to adjacent triplet sequences, and we show here that different tweezer molecules can show different sequence selectivities. This work, based on (1)H NMR spectroscopy in solution and on single-crystal X-ray analysis of tweezer-oligomer complexes in the solid state, provides the first clear-cut demonstration of polyimide chain-folding and adjacent-tweezer binding. It also reveals a new and entirely unexpected mechanism for sequence recognition, which, by analogy with a related process in biomolecular information processing, may be termed 'frameshift-reading'. The ability of one particular tweezer molecule to detect, with exceptionally high sensitivity, long-range sequence information in chain-folding aromatic copolyimides is readily explained by this novel process.

Novel macrocyclic receptors that bind electron-donor aromatic substrates through pi-stacking donor-acceptor interactions are obtained by cycloimidisation of an amine-functionalised aryl ether sulfone with pyromellitic and 1,4,5,8-naphthalenetetracarboxylic dianhydrides. These macrocycles can form complexes with a wide variety of pi-donor substrates, including tetrathiafulvalene, naphthalene, anthracene, pyrene, perylene and functional derivatives of these polycyclic hydrocarbons. The resulting supramolecular assemblies range from simple 1:1 complexes to [2]- and [3]pseudorotaxanes and even (as a result of crystallographic disorder) an apparent polyrotaxane. Direct five-component self-assembly of a metal-centred [3]pseudorotaxane is also observed on complexation of a macrocyclic ether imide with 8-hydroxyquinoline in the presence of palladium(II) ions. Binding studies in solution were carried out by using (1)H NMR and UV/Vis spectroscopy, and the stoichiometries of binding were confirmed by Job plots based on the charge-transfer absorption bands. The highest association constants were found for strong pi-donor guests with large surface areas, notably perylene and 1-hydroxypyrene, for which K(a) values of 1.4x10(3) and 2.3x10(3) M(-1), respectively, were found. Single-crystal X-ray analyses of the receptors and their derived complexes reveal large induced-fit distortions of the macrocyclic frameworks as a result of complexation. These structures provide compelling evidence for the existence of strong attractive forces between the electronically complementary aromatic pi systems of host and guest.

Cyclocondensations of aromatic diamines with 1,1'-bis(2,4-dinitrophenyl)-4,4'-bipyridinium salts afford doubly or quadruply charged, macrocyclic, N,N'-diarylbipyridinium cations. These are tolerant of a wide range of acids, bases, and nucleophiles, although they appear to undergo reversible, one-electron reduction by tertiary amines. Single-crystal X-ray analysis demonstrates the presence of a macrocycle conformation in which the 4,4'-bipyridinium and 4,4'-biphenylenedisulfonyl residues are suitably spaced and aligned for complexation with pi-donor arenes, and NMR studies in solution indeed confirm binding to 1,5-bis[hydroxy(ethoxy)ethoxy]naphthalene.

A novel type of tweezer molecule containing electron-rich 2-pyrenyloxy arms has been designed to exploit intramolecular hydrogen bonding in stabilising a preferred conformation for supramolecular complexation to complementary sequences in aromatic copolyimides. This tweezer-conformation is demonstrated by single-crystal X-ray analyses of the tweezer molecule itself and of its complex with an aromatic diimide model-compound. In terms of its ability to bind selectively to polyimide chains, the new tweezer molecule shows very high sensitivity to sequence effects. Thus, even low concentrations of tweezer relative to diimide units (< 2.5 mol %) are sufficient to produce dramatic, sequence-related splittings of the pyromellitimide proton NMR resonances. These induced resonance-shifts arise from ring-current shielding of pyromellitimide protons by the pyrenyloxy arms of the tweezer-molecule, and the magnitude of such shielding is a function of the tweezer-binding constant for any particular monomer sequence. Recognition of both short-range and long-range sequences is observed, the latter arising from cumulative ring-current shielding of diimide protons by tweezer molecules binding at multiple adjacent sites on the copolymer chain.

Various conflicting data on the rearrangement and absolute stereochemistry of hydroxylignano-9,7'-lactones are resolved using 18O labeled compounds, also confirmed by an X-ray analysis of a pure lignano-9,7'-lactone enantiomer, obtained for the first time. Under NaH/DMF rearrangement conditions a silyl protected hydroxylignano-9,9'-lactone underwent an unexpected silyl migration.

Sequence-specific binding is demonstrated between pyrene-based tweezer molecules and soluble, high molar mass copolyimides. The binding involves complementary pi-pi stacking interactions, polymer chain-folding, and hydrogen bonding and is extremely sensitive to the steric environment around the pyromellitimide binding-site. A detailed picture of the intermolecular interactions involved has been obtained through single-crystal X-ray studies of tweezer complexes with model diimides. Ring-current magnetic shielding of polyimide protons by the pyrene "arms" of the tweezer molecule induces large complexation shifts of the corresponding 1H NMR resonances, enabling specific triplet sequences to be identified by their complexation shifts. Extended comonomer sequences (triplets of triplets in which the monomer residues differ only by the presence or absence of a methyl group) can be "read" by a mechanism which involves multiple binding of tweezer molecules to adjacent diimide residues within the copolymer chain. The adjacent-binding model for sequence recognition has been validated by two conceptually different sets of tweezer binding experiments. One approach compares sequence-recognition events for copolyimides having either restricted or unrestricted triple-triplet sequences, and the other makes use of copolymers containing both strongly binding and completely nonbinding diimide residues. In all cases the nature and relative proportions of triple-triplet sequences predicted by the adjacent-binding model are fully consistent with the observed 1H NMR data.

Cyclo-condensation of aroyl hydrazides with the cationic tungsten-dichlorodiazomethane complex [BrW(dppe)2(N2CCl2)]+ affords neutral oxadiazolyldiazenido(1-) complexes which react readily with a wide range of transition and non-transition metal species to afford a novel series of crystallographically-characterised heteropolynuclear complexes containing bridging oxadiazolyldiazenido(1-) ligands.