Search

Gamma-aminobutyric acid (GABA), an important bioactive compound, is synthesized through the decarboxylation of L-glutamate (L-Glu) by glutamate decarboxylase (GAD). The use of lactic acid bacteria (LAB) as catalysts opens interesting avenues for the biosynthesis of food-grade GABA. However, a key obstacle involved in the improvement of GABA production is how to resolve the discrepancy of optimal pH between the intracellular GAD activity and cell growth. In this work, a potential GAD candidate (LpGadB) from Lactobacillus plantarum was heterologously expressed in Escherichia coli. Recombinant LpGadB existed as a homodimer under the native conditions with a molecular mass of 109.6 kDa and exhibited maximal activity at 40°C and pH 5.0. The Km value and catalytic efficiency (kcat/Km) of LpGadB for L-Glu was 21.33 mM and 1.19 mM-1s-1, respectively, with the specific activity of 26.67 μM/min/mg protein. Subsequently, four C-terminally truncated LpGadB mutants (GadBΔC10, GadBΔC11, GadBΔC12, GadBΔC13) were constructed based on homology modeling. Among them, the mutant GadBΔC11 with highest catalytic activity at near-neutral pH values was selected. In further, the GadBΔC11 and Glu/GABA antiporter (GadC) of Lactococcus lactis were co-overexpressed in the host L. lactis NZ3900. Finally, after 48 h of batch fermentation, the engineered strain L. lactis NZ3900/pNZ8149-gadBΔC11C yielded GABA concentration up to 33.52 g/L by applying a two-stage pH control strategy. Remarkably, this is the highest yield obtained to date for GABA from fermentation with L. lactis as a microbial cell factory.Key points• The GadB from L. plantarum was heterologously expressed in E. coli and biochemically characterized.• Deletion of the C-plug in GadB shifted its pH-dependent activity toward a higher pH.• Reconstructing the GAD system of L. lactis is an effective approach for improving its GABA production.

Due to deadly toxicity and high environmental stability of the nerve agent VX, an efficient decontamination approach is desperately needed in tackling its severe threat to human security. The enzymatic destruction of nerve agents has been generally considered as one of the most effective ways, and here the hydrolysis of VX by phosphotriesterase (PTE) was investigated by extensive QM/MM and MM MD simulations. The hydrolytic cleavage of P-S by PTE is a two-step process with the free energy spans of 15.8 and 26.0 kcal mol

Gamma-aminobutyric acid (GABA), an important bioactive compound, is synthesized through the decarboxylation of L-glutamate (L-Glu) by glutamate decarboxylase (GAD). The use of lactic acid bacteria (LAB) as catalysts opens interesting avenues for the biosynthesis of food-grade GABA. However, a key obstacle involved in the improvement of GABA production is how to resolve the discrepancy of optimal pH between the intracellular GAD activity and cell growth. In this work, a potential GAD candidate (LpGadB) from Lactobacillus plantarum was heterologously expressed in Escherichia coli. Recombinant LpGadB existed as a homodimer under the native conditions with a molecular mass of 109.6 kDa and exhibited maximal activity at 40°C and pH 5.0. The K

Motivated by Cao et al. (2015) , we utilize China’s one-child policy reform as a unique and exogenous setting to examine the economic impact of a potential rise in bequest motives among family firms, which is driven by the prospect of family and clanship expansion after the reform. A bequest motive is the economic incentive to accumulate wealth presently for inheritance by heirs in the future. It causes short-term present economic decisions to be influenced by long-term future utility expectations. On the one hand, the reform may strengthen stewardship as a means to maximize firm value for present family wealth enhancement and future inter-generational succession. On the other hand, the reform may weaken innovation and competitiveness by inducing reluctance against takeovers or outsider succession. Consistent with a positive economic impact, we observe that family firms experience (i) favorable ex-ante market reactions to the news of the reform and (ii) ex-post decline in managerial expropriation through tunneling after the reform. These findings of ex-ante investor anticipation and ex-post real effect are both stronger among less transparent family firms where Type-II agency problems are likely to be more pronounced. Further analyses also provide supportive evidence of a post-reform rise in the long-term value, measured by Tobin’s Q, and a decline in stock-selling by controlling shareholders among family firms. Our combined findings imply that this reform could induce positive externality on family firm governance.

We apply the discontinuity methodology from the accounting literature to a political economy setting of GDP reporting and examine whether Chinese local governments manage regional GDP numbers. We find strong evidence of discontinuities around zero in the distribution of actual minus target GDP growth rates. The frequencies of just meeting or beating GDP growth targets are about five (four) times the frequencies of just missing targets at the prefecture (province) level. The results are stronger for governors with longer tenures and those without political connections to higher-level officials as well as for local governments with more resources under their control.

Purpose The performance of the first batch of listed companies since the restart of new initial public offerings (IPOs) in January 2014 and their accounting information face repeated and volatile questioning from different sides. This paper aims to take Guirenniao (China) Co. Ltd. (GRN for short), one of the first batch of listed companies in 2014 that suffered performance decline, as an example to analyze how it managed earnings before IPO. Design/methodology/approach This paper examines earnings management signs that exist in GRN through analysis of its financial statements compared to those of its industry peers. This paper then uses the modified Jones model to detect its accrual earnings management and build three models, which are abnormal levels of cash flows from operations, abnormal production costs and abnormal discretionary expenses, to detect real earnings management. Findings This paper finds that GRN managed earnings through accrual and real activities in 2012 and 2013. Finally, this paper provides evidence on the specific methods of earnings management, which are easing credit policy to recognize revenue in advance, abnormal expansion, decreasing costs and connected transactions. Originality/value This paper examines earnings management signs exist in GRN through analysis of its financial statements comparing to those of its industry peers. This paper then uses the modified Jones Model to detect its accrual earnings management and build three models which are abnormal levels of cash flows from operations, abnormal production costs and abnormal discretionary expenses to detect real earnings management.

We examine whether accounting academics on the board of directors affect their firm's financial reporting quality. While regulations mandate firms to include financial experts as outside directors to enhance transparency, there is also a shortage of suitable individuals with both the relevant expertise and the appropriate management and communication skills. Although increasing evidence suggests that academics as outside directors improve firm performance, previous studies do not focus on the role of accounting professors per se on accounting quality. The prevalence of hiring academics as outside directors renders China a suitable research setting. We observe greater value relevance of reported earnings when accounting academics serve as financial experts in the board, especially in firms where their influence is expected to be more pronounced. Our evidence implies that accounting scholarship contributes to the efficiency of the capital market, and can potentially supply the boardroom demand for financial experts.

Additional file 6. Table S2. Primers used for key GAD system genes amplification.

Additional file 2. Figure S2. (A), Transcription of gadR is independent from the gadCB operon. PCR results using gad-F1 and gad-R1 as primers. The expected band (~ 573 bp) was only visible in the lane C. M: DNA marker; A: cDNA as the template. B: mRNA as the template. C: genome DNA as the template. gad-F1: GTCAAACAACAATTGGCATC, gad-R1: CAGCCGATAATGAAATACATC. (B), The gadB is co-transcribed in tandem with the upstream gadC gene. PCR results using gad-F2 and gad-R2 as primers. The expected band (~ 571 bp) was visible only in the lane A. M: DNA marker; A: cDNA as the template B: mRNA as the template. gad-F2: TATCTTGTACCGTTTCCACG, gad-R2: ATACATCCTTCAGAAGAACC.

Lactic acid bacteria (LAB) are generally sensitive to H2O2, a compound which can paradoxically produce themselves and lead to the growth arrest and cell death. To counteract the potentially toxic effects of this compound, the gene katE encoding a heme-dependent catalase (CAT) belonging to the family of monofunctional CATs was cloned from Lactobacillus brevis CGMCC1306. The enhanced homologous CAT expression was achieved using the NICE system. L. brevis cells with overexpressed CAT showed 685-fold and 823-fold higher survival when exposed to 30mmol/L of H2O2 and long-term aerated stress (after 72h), respectively, than that of the wild type cells. Furtherly, the effects of activated CAT on GABA production in L. brevis were investigated. A GABA production level of 66.4g/L was achieved using two-step biotransformation that successively employed the growing and resting cells derived from engineering L. brevis CAT. These results demonstrated clearly that overexpression of the KatE gene in L. brevis led to a marked increased survival in oxidizing environment, and shed light on a novel feasible approach to enhance the GABA production level by improving the antioxidative properties.

This study examines whether the compensation regulation designed to deal with “excessive” executive compensation works as expected to solve social problems and hence create value for shareholders. ...