Search

mRNA measurement is dominated by RT-PCR, which requires expensive laboratory equipment and personnel with advanced degrees. Loop-mediated isothermal amplification (LAMP) is a versatile technique for detecting target DNA and RNA. The sensitivity of LAMP in early reports has been below that of the standard RT-PCR tests. Here, we report the use of a fluorescence-based RT-LAMP protocol to measure CDX2 expression patterns, which match extremely well to the standards of sophisticated RT-PCR techniques (r = 0.99, p

Polygalacturonases (PG) are the enzymes that cause depolymerization of pectin. In current study, bacterial strain was isolated from rotten sample and then purified. It was screened for endo-polygalacturonase activity using PSAM media. It had shown positive response for endo-PG activity. Bacterial DNA was isolated and 16 S rRNA gene amplification was done using universal primer pair of 8 F and 1492 R. Bacterial strain was also amplified by 16 S rRNA gene for sequencing. BLAST of gene sequence on NCBI database had shown that bacterial isolate was identified as Bacillus pumilus. Endo-polygalacturonase enzyme was produced by submerged fermentation to optimize culture conditions by RSM in JMP-12 software. The optimized parameters had shown maximum endo-polygalacturonase activity of 153.2 U/mL/min after using 3 g of orange peels as substrate, 3 mL of inoculum size, 6.5 pH buffer, 40°C temperature and 3 days of incubation. After optimizing fermentation conditions, endo-polygalacturonase was precipitated using 70 % concentration of ammonium sulfate. This partially precipitated sample was dialyzed with dialysis tube and used to find activity of endo-polygalacturonase (1620.6 U/mL/min). This sample was applied to gel filtration chromatography for further purification. Endo-polygalacturonase activity increased many times 2231.44 U/mL/min after gel filtration. The Molecular weight of endo-polygalacturonase was 46 kDa after SDS PAGE characterization. High Vmax value and alkaliphilic nature of endo-polygalacturonase will make it good candidate for food and feed industry near future. [Display omitted] • A bacterial strain was isolated from rotten sample. • Bacillus pumilus was identified through 16 S rRNA gene sequencing. • Maximum enzyme activity of 153.2 U/mL/min was achieved under optimized conditions. • The characterized endo-polygalacturonase has great potential in industrial applications. • Polygalacturonase had shown maximum activity after column chromatography. [ABSTRACT FROM AUTHOR]

Hysterothylacium aduncum is one of six pathogens responsible for human anisakiasis. Infection with H. aduncum can cause acute abdominal symptoms and allergic reactions and is prone to misdiagnosis in clinical practice. This study aims to enhance the efficiency and accuracy of detecting H. aduncum in food ingredients. We targeted the internal transcribed spacer 1 (ITS 1) regions of Anisakis to develop a visual screening method for detecting H. aduncum using recombinase polymerase amplification (RPA) combined with the CRISPR/Cas12a system. By comparing the ITS 1 region sequences of eight nematode species, we designed specific primers and CRISPR RNA (crRNA). The specificity of RPA primers was screened and evaluated, and the CRISPR system was optimized. We assessed its specificity and sensitivity and performed testing on commercial samples. The results indicated that the alternative primer ADU 1 was the most effective. The final optimized concentrations were 250 nM for Cas12a, 500 nM for crRNA, and 500 nM for ssDNA. The complete test procedure was achievable within 45 min at 37 °C, with a limit of detection (LOD) of 1.27 pg/μL. The amplified product could be directly observed using a fluorescence microscope or ultraviolet lamp. Detection results for 15 Anisakis samples were entirely consistent with those obtained via Sanger sequencing, demonstrating the higher efficacy of this method for detecting and identifying H. aduncum. This visual detection method, characterized by simple operation, visual results, high sensitivity, and specificity, meets the requirements for food safety testing and enhances monitoring efficiency. [ABSTRACT FROM AUTHOR]

Glaesserella parasuis (GPS) is an important bacterial pathogen of swine. Serotype identification has presented a bottleneck in GPS research since it was first identified as the pathogen causing Glässer's disease in pigs in 1910. This paper presents a systematic review of the history of the development and application of gel immunodiffusion (GID), indirect hemagglutination assay (IHA), and polymerase chain reaction (PCR) typing methods for GPS, and the discovery of their shared antigenic basis. It provides a systematic theoretical overview of the immunology and principles underlying the three typing methods and offers new ideas for research into the prevention and control of Glässer's disease. In 1992, GPS was first classified into serotypes 1–15 using GID based on GPS heat-stable antigens, but about 25% of the strains were found to be non-typeable, and the composition of their antigens for serotyping was unclear. In 2003, the IHA method was established based on saline-extracted antigens of GPS, whose sensitivity and typing rate were higher than for GID, although about 15% of strains were still found to be non-typeable. The results of IHA and GID typing are roughly consistent, since they share the same GPS surface polysaccharide serotyping antigens, although whether these are capsular polysaccharides, lipopolysaccharides, or other polysaccharides, remains to be determined. In 2013, the Capsular polysaccharide (CPS) synthetic gene clusters from GPS serotypes 1–15 were successfully analyzed, confirming that CPS is essential for the formation of antigens for serotyping. In 2015, primers were designed based on the specific target genes of GPS capsules to establish a PCR typing method (H-PCR) for GPS, which, however, could not identify serotypes 5 and 12. In 2017, a new PCR typing method (J-PCR) was established based on the specific target genes of GPS capsules, which could identify serotypes 5 and 12. A combination of the two PCR typing methods enables the typing of almost all GPS strains, and the consistency with GID and IHA was verified using molecular biological methods. The antigenic basis of the three typing methods was shown to involve the GPS capsule. PCR typing methods are characterized by simple operation, fast speed, and low cost, and can successfully solve many problems in GID and IHA serotyping, and so have become widely adopted. [ABSTRACT FROM AUTHOR]

Loop-Mediated Isothermal Amplification (LAMP) represents a valuable technique for DNA/RNA detection, known for its exceptional sensitivity, specificity, speed, accuracy, and affordability. This study focused on optimizing a LAMP-based method to detect early signs of Plasmopara halstedii, the casual pathogen of sunflower downy mildew, a severe threat to sunflower crops. Specifically, a set of six LAMP primers (two outer, two inner, and two loop) were designed from P. halstedii genomic DNA, targeting the ribosomal Large Subunit (LSU). These primers were verified by in silico analysis and experimental validation using both target and non-target species' DNAs. Optimizations encompassing reaction conditions (temperature, time) and component concentrations (magnesium, Bst DNA polymerase, primers, and dNTP) were determined. Validation of these optimizations was performed by agarose gel electrophoresis. Furthermore, various colorimetric chemicals (Neutral Red, Hydroxynaphthol Blue, SYBR Safe, Thiazole Green) were evaluated to facilitate method analysis, and the real-time analysis has been optimized, presenting multiple approaches for detecting sunflower downy mildew using the LAMP technique. The analytical sensitivity of the method was confirmed by detecting P. halstedii DNA concentrations as low as 0.5 pg/μl. This pioneering study, establishing P. halstedii detection through the LAMP method, stands as unique in its field. The precision, robustness, and practicality of the LAMP protocol make it an ideal choice for studies focusing on sunflower mildew, emphasizing its recommended use due to its operational ease and reliability. [ABSTRACT FROM AUTHOR]

A general approach is presented for synthesizing alkyne-modified nucleoside triphosphates via the Sonogashira cross-coupling reaction of unprotected halogenated 2ʹ-deoxynucleoside, followed by monophosphorylation and the reaction of the corresponding phosphoromorpholidate with tributylammonium pyrophosphate. A highly efficient approach for the milligram-scale synthesis of base-modified nucleoside triphosphates with an amino acid-like side chain was developed. The present chemical method outweighs the other reported methods of a base-modified nucleoside triphosphates synthesis in terms of it being a protection-free strategy, the shortening of reaction steps, and increased yields (about 70%). The resulting 8-alkynylated dATP was tested as a substrate for DNA polymerases in a primer extension reaction. [ABSTRACT FROM AUTHOR]

The human primase-polymerase PrimPol is a key participant of the mechanism of DNA synthesis restart during replication fork stalling at sites of DNA damage. PrimPol has DNA primase activity and synthesizes DNA primers that are used by processive DNA polymerases to continue replication. Recruitment of PrimPol to the sites of DNA damage, as well as stimulation of catalytic activity, depends on interaction with the replicative protein RPA, which binds single-stranded DNA. The C-terminal domain of PrimPol contains a negatively charged RPA-binding motif (RBM), mutations in which disrupt the interaction between two proteins. The RBM motif also plays a role in the negative regulation of PrimPol interaction with DNA. Deletion of the RBM dramatically increases PrimPol affinity to DNA and stimulates PrimPol activity. The mechanism of RBM-mediated regulation of PrimPol activity is unclear. The relatively strong negative charge of RBM potentially may contribute to the interaction of PrimPol with RPA and DNA. RBM contains two negatively charged regions RBM-A and RBM-B. In this work, we additionally added (substitution V546E) or decreased (substitution D547H) a negative charge in RBM-B PrimPol and characterized these mutant variants biochemically. It was shown that the local change in the RBM-B charge has no effect on the interaction of PrimPol with DNA and RPA, or of the catalytic activity of the enzyme. [ABSTRACT FROM AUTHOR]

Using food ingredients and/or processed food products contaminated with pork, whether unintentionally or intentionally, has become a growing concern and issue. This condition encourages the development of an accurate method for specifically detecting the presence or absence of pork contamination. The research was carried out on two different samples: (1) fresh pork to provide an in-house positive control and (2) samples of pork-based processed meat products (floss, meatballs, corned beef, and sausages), tested using DNA markers. The use of samples originating from processed pork food is to determine the effect of the processing process on DNA fragments and the robustness of the extraction method for the detection process used. The research aimed to detect pork DNA fragments using the quantitative polymerase chain reaction (qPCR) method. The study stages were extracting fresh pork and processed products using an RNA extraction kit, DNA extraction kit, and salt extraction, as well as measuring the purity and concentration of DNA/RNA using a spectrophotometer. The RNA extract was converted into complementary DNA (cDNA), and the DNA extract was analyzed using qPCR with specific primers for pork DNA (Sus scrofa). The results showed that the concentration of RNA and DNA extracts was 71.1–296.025 ng/uL and of various purity. All processed meat product samples and in-house positive controls were amplified in the Ct range of 23–28 ng/uL. In this case, the meat processing had no effect on the DNA of the processed meat products analyzed, so DNA fragments could be detected. DNA qPCR was more time efficient than cDNA qPCR because it did not require an RNA reverse transcription step. [ABSTRACT FROM AUTHOR]

Carbapenem resistance in Acinetobacter baumannii is a critical global health threat attributed to transferrable carbapenemase genes. Carbapenemase genotyping using polymerase chain reaction (PCR) presents a challenge in resource-limited settings because of its technical requirements. This study designed new loop-mediated isothermal amplification (LAMP) primers using multiple sequence alignment-based workflows, validated the primer performance against multiple target variants in silico, and developed novel LAMP assays (LAntRN-OXA23 and LAntRN-ISAba1) to detect the transferable blaOXA-23-like carbapenemase genes and ISAba1 elements in pure cultures and A. baumannii-spiked serum samples. The designed LAMP primers bind to the conserved regions of their highly polymorphic targets, with their in silico performance comparable with other published primers. The in vitro LAMP assays (using 30 PCR-profiled A. baumannii and 10 standard multidrug-resistant gram-negative isolates) have 100% concordance with the PCR-positive clinical samples, limits of detection as low as 1 pg/µL (200 copies/µL), and specificities of 57.89–100%. Both assays produced positive results when testing DNA samples (extracted using a commercial kit) from blaOXA-23-like and ISAba1-blaOXA-51-like PCR-positive A. baumannii-spiked normal human sera (five set-ups per target). In summary, the LAMP assays accurately detected the target genes and have applications in infection management, control, and point-of-care testing in resource-limited healthcare settings. [ABSTRACT FROM AUTHOR]

Copyright of Acta Edulis Fungi is the property of Acta Edulis Fungi and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Amplifying small subunit (SSU) rRNA genes with universal primers in assessing microbial populations diversity, but target microorganisms are sometimes omitted due to inadequate primer coverage. Adding degenerate bases to primers can help, but existing methods are complex and time-consuming. This study introduces a user-friendly tool called "Degenerate primer 111" for adding degenerate bases to existing universal primers. By aligning one universal primer with one uncovered target microorganism's SSU rRNA gene, this tool iteratively generates a new primer, maximizing coverage for the target microorganisms. The tool was used to modify eight pairs of universal primers (515F Parada-806R Apprill, S-D-Bact-0341-b-S-17/S-D-Bact-0785-a-A-21, OP_F114-KP_R013, 27F-1492R, 341F-806R, OP_F066-KP_R013, 515F Parada-926R Quince, 616*F-1132R), and generated 29 new universal primers with increased coverage of specific target microorganisms without increasing coverage of non-target microorganisms. To verify the effectiveness of the improved primers, one set of original and improved primers (BA-515F-806R and BA-515F-806R-M1) was used to amplify DNA from the same sample, and high-throughput sequencing of the amplicons confirmed that the improved primers detected more microbial species compared to the original primers. Future researchers can use this tool to develop more personalized primers to meet their diverse microorganism detection needs. [ABSTRACT FROM AUTHOR]

Mantidis Ootheca (sangpiaoxiao), the egg case of the mantis, is a type of insect-derived traditional medicine widely used in East Asia. However, species identification based on egg morphology is challenging, leading to the distribution of counterfeit and adulterated products. The use of inauthentic ingredients can pose serious health risks to consumers. This study aimed to develop PCR markers that can rapidly and accurately differentiate between authentic and counterfeit Mantidis Ootheca. The mitochondrial cytochrome c oxidase I (COI) region was sequenced in thirteen samples from four mantis species: Tenodera angustipennis, Statilia maculata, Hierodula patellifera, and T. sinensis. Four sets of SCAR primers were designed based on species-specific nucleotide polymorphisms, and a multiplex SCAR assay was developed by combining all sets of the primers. The sequence-characterized amplified region (SCAR) primers successfully produced amplicons for each target species, even with low-DNA templates or templates containing DNA from multiple samples. No amplification was observed for nontarget species. This study presents a novel approach for identifying authentic Mantidis Ootheca species using DNA-based diagnostic marker assays, which enable rapid and precise species identification. The SCAR assays developed in this study will aid in maintaining quality control and promoting the standardization of commercial Mantidis Ootheca products. [ABSTRACT FROM AUTHOR]

Sex identification in avian species is essential for biodiversity conservation and ecological studies. However, the sex of nearly half of the birds could not be identified based on their external appearance. It is difficult to visually identify sex to monitor the ecology and conservation of wild populations. In this study, we designed primer pairs for large white pelican using recombinase-based isothermal amplification combined with a lateral flow dipstick (RAA-LFD) assay for chromo-helicase-DNA binding protein (CHD) genes mapped to W chromosomes and an ultra-conserved element (UCE) located on chromosome 6, respectively. Our result showed that the raaW4-RAA-LFD can detect up to 0.1 ng of genomic DNA (gDNA) templates of female pelicans in 30 min at 39 ℃ and accurately distinguish female from male without any cross reactivity. RaaUCE2-RAA-LFD can amplify both male and female pelicans with a detection limit of 25 pg. To further evaluate the assay, 15 white pelicans of unknown sex were tested using the RAA-LFD assay and conventional polymerase chain reaction (PCR). The results of the raaW4-RAA-LFD assay were consistent with those of the conventional PCR. The developed RAA-LFD assay is equipped with field-deployable instruments and offers a field platform for rapid and reliable sex identification in pelicans. [ABSTRACT FROM AUTHOR]

This article presents the genome sequence of a strain of Methylomonas sp. AM2-LC, a methanotrophic bacterial species found in a Finnish lake. Methanotrophic bacteria are important for reducing methane emissions and have potential for biotechnological applications. The genome sequence can be used for comparative analysis and understanding the metabolic capabilities of methanotrophs. The article also discusses the isolation and DNA extraction process, as well as bioinformatic services provided by a sequencing facility. The document is a list of references related to methanotrophic bacteria, providing a comprehensive overview of current research in the field. It includes references to three scientific articles that cover microbial variant detection, methane-dependent mineral reduction, and the discovery of a new type of methanotroph. These articles are valuable resources for library patrons conducting research in microbiology. [Extracted from the article]

Background: Consumer awareness of food adulteration is increasing nowadays. Motivated by economic gain, unethical meat producers try to blend halal meat such as beef with non-halal meat like rat meat (RM). Aim: This study aims to develop a real-time polymerase chain reaction (RT-PCR) analysis method to analyze the presence of RM in beef meatballs. Methods: This research was carried out in the following stages: primer design, DNA isolation, analysis of DNA isolates, the optimization of primer annealing temperature, primer specificity test, sensitivity, and repeatability. The validated RT-PCR method was then used to analyze the marketed meatball samples. Results: The result showed that the designed primer targeting on ND2 gene set rat mt-DNA (forward: ACTCCATATCTCTCACCATATTTCC; reverse: GGGTTAGGGTACTTAGGATTGTTAG), had good specificity at an optimal annealing temperature of 56.3oC over the other eight species. The developed RT-PCR method produces a limit detection value of 195.31 pg, coefficient of determination (R2) for linearity of 0.983, amplification efficiency (E) of 100%, and CV value for amplification response of 1.8%. The result showed that the developed RT-PCR method did not detect the presence of RM DNA in eight marketed beef meatball samples. Conclusion: The developed method meets the acceptance criteria for RT-PCR and can be used as a halal authentication method to identify the presence of RM in beef meatballs. [ABSTRACT FROM AUTHOR]

Congenital bilateral absence of vas deferens (CBAVD) is a urological syndrome of Wolffian ducts and is responsible for male infertility and obstructive azoospermia. This study is designed to explore the integrity of exon 10 of CFTR and its role in male infertility in a cohort of CBVAD patients in Pakistan. Genomic DNA was extracted from 17 male patients with CBAVD having clinical symptoms, and 10 healthy controls via phenol-chloroform method. Exon 10 of the CFTR gene was amplified, using PCR with specific primers and DNA screening was done by Sanger sequencing. Sequencing results were analyzed using freeware Serial Cloner, SnapGene, BioEdit and FinchTV. Furthermore, bioinformatics tools were used to analyze the mutations and their impact on the protein function and stability. We have identified 4 mutations on exon 10 of CFTR in 6 out of 17 patients. Two of the mutations were missense variants V456A, K464E, and the other two were silent mutations G437G, S431S. The identified variant V456A was present in 4 of the studied patients. Whereas, the presence of K464E in our patients further weighs on the crucial importance for its strategic location to influence the gene function at post-transcriptional and protein level. Furthermore, Polyphen-2 and SIFT analyze the mutations as harmful and deleterious. The recurrence of V456A and tactically conserved locality of K464E are evidence of their potential role in CBAVD patients and in male infertility. The data can contribute in developing genetic testing and treatment of CBAVD. [ABSTRACT FROM AUTHOR]

Fish substitution in fish products is an important issue in fish markets, as it is a widespread practice. An authentication protocol for Rohu, Thaila and Tilapia was developed by multiplex PCR. Three species-specific and one degenerate common forward primer were designed using the Cytb gene of the mitochondrial genome. These primers for Labeo rohita, Labeo catla and Oreochromis niloticus showed the fragment size of 235 bp, 186 bp and 506 bp on the agarose gel, respectively. The primers for L. rohita and L. catla were sensitive to 0.1 ng of DNA template, while for O. niloticus this value was 1 ng of DNA template. A total of 230 commercial samples (160 fried and 70 processed fish products) were screened, where 60% mislabeling in fried and 30% mislabeling in processed fish were found. This multiplex PCR protocol could give useful insights for food inspection and enforcement of regulatory food control. [ABSTRACT FROM AUTHOR]

Background: The Neotropics harbors the largest species richness of the planet; however, even in well-studied groups, there are potentially hundreds of species that lack a formal description, and likewise, many already described taxa are difficult to identify using morphology. Specifically in small mammals, complex morphological diagnoses have been facilitated by the use of molecular data, particularly from mitochondrial sequences, to obtain accurate species identifications. Obtaining mitochondrial markers implies the use of PCR and specific primers, which are largely absent for non-model organisms. Oxford Nanopore Technologies (ONT) is a new alternative for sequencing the entire mitochondrial genome without the need for specific primers. Only a limited number of studies have employed exclusively ONT long-reads to assemble mitochondrial genomes, and few studies have yet evaluated the usefulness of such reads in multiple non-model organisms. Methods: We implemented fieldwork to collect small mammals, including rodents, bats, and marsupials, in five localities in the northern extreme of the Cordillera Central of Colombia. DNA samples were sequenced using the MinION device and Flongle flow cells. Shotgun-sequenced data was used to reconstruct the mitochondrial genome of all the samples. In parallel, using a customized computational pipeline, species-level identifications were obtained based on sequencing raw reads (Whole Genome Sequencing). ONT-based identifications were corroborated using traditional morphological characters and phylogenetic analyses. Results: A total of 24 individuals from 18 species were collected, morphologically identified, and deposited in the biological collection of Universidad EAFIT. Our different computational pipelines were able to reconstruct mitochondrial genomes from exclusively ONT reads. We obtained three new mitochondrial genomes and eight new molecular mitochondrial sequences for six species. Our species identification pipeline was able to obtain accurate species identifications for up to 75% of the individuals in as little as 5 s. Finally, our phylogenetic analyses corroborated the identifications from our automated species identification pipeline and revealed important contributions to the knowledge of the diversity of Neotropical small mammals. Discussion: This study was able to evaluate different pipelines to reconstruct mitochondrial genomes from non-model organisms, using exclusively ONT reads, benchmarking these protocols on a multi-species dataset. The proposed methodology can be applied by non-expert taxonomists and has the potential to be implemented in real-time, without the need to euthanize the organisms and under field conditions. Therefore, it stands as a relevant tool to help increase the available data for non-model organisms, and the rate at which researchers can characterize life specially in highly biodiverse places as the Neotropics. [ABSTRACT FROM AUTHOR]

Copyright of Journal of Northwest A & F University - Natural Science Edition is the property of Editorial Department of Journal of Northwest A&F University (Natural Science Edition) and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

BACKGROUND: Multiplex PCR amplifies numerous targets in a single tube reaction and is essential in molecular biology and clinical diagnostics. One of its most important applications is in the targeted sequencing of pathogens. Despite this importance, few tools are available for designing multiplex primers. RESULTS: We developed primerJinn, a tool that designs a set of multiplex primers and allows for the in silico PCR evaluation of primer sets against numerous input genomes. We used primerJinn to create a multiplex PCR for the sequencing of drug resistance-conferring gene regions from Mycobacterium tuberculosis, which were then successfully sequenced. CONCLUSIONS: primerJinn provides a user-friendly, efficient, and accurate method for designing multiplex PCR primers for targeted sequencing and performing in silico PCR. It can be used for various applications in molecular biology and bioinformatics research, including the design of assays for amplifying and sequencing drug-resistance-conferring regions in important pathogens.

Ichthyoplankton monitoring is crucial for stock assessments, offering insights into spawning grounds, stock size, seasons, recruitment, and changes in regional ichthyofauna. This study evaluates the efficiency of multi-marker DNA metabarcoding using mitochondrial cytochrome c oxidase subunit I (COI), 12S rRNA and 16S rRNA gene markers, in comparison to morphology-based methods for fish species identification in ichthyoplankton samples. Two transects with four coastal distance categories were sampled along the southern coast of Portugal, being each sample divided for molecular and morphological analyses. A total of 76 fish species were identified by both approaches, with DNA metabarcoding overperforming morphology—75 versus 11 species-level identifications. Linking species-level DNA identifications with higher taxonomic morphological identifications resolved several uncertainties associated with traditional methods. Multi-marker DNA metabarcoding improved fish species detection by 20–36% compared to using a single marker/amplicon, and identified 38 species in common, reinforcing the validity of our results. PERMANOVA analysis revealed significant differences in species communities based on the primer set employed, transect location, and distance from the coast. Our findings underscore the potential of DNA metabarcoding to assess ichthyoplankton diversity and suggest that its integration into routine surveys could enhance the accuracy and comprehensiveness of fish stock assessments. [ABSTRACT FROM AUTHOR]

Bovine leukemia virus (BLV) is the etiological agent of enzootic bovine leukosis and causes a persistent infection that can leave cattle with no symptoms. Many countries have been able to successfully eradicate BLV through improved detection and management methods. However, with the increasing novel molecular detection methods there have been few efforts to standardize these results at global scale. This study aimed to determine the interlaboratory accuracy and agreement of 11 molecular tests in detecting BLV. Each qPCR/ddPCR method varied by target gene, primer design, DNA input and chemistries. DNA samples were extracted from blood of BLV-seropositive cattle and lyophilized to grant a better preservation during shipping to all participants around the globe. Twenty nine out of 44 samples were correctly identified by the 11 labs and all methods exhibited a diagnostic sensitivity between 74 and 100%. Agreement amongst different assays was linked to BLV copy numbers present in samples and the characteristics of each assay (i.e., BLV target sequence). Finally, the mean correlation value for all assays was within the range of strong correlation. This study highlights the importance of continuous need for standardization and harmonization amongst assays and the different participants. The results underscore the need of an international calibrator to estimate the efficiency (standard curve) of the different assays and improve quantitation accuracy. Additionally, this will inform future participants about the variability associated with emerging chemistries, methods, and technologies used to study BLV. Altogether, by improving tests performance worldwide it will positively aid in the eradication efforts. [ABSTRACT FROM AUTHOR]

The Pinna nobilis, a Mediterranean mollusc, has suffered population declines due to a massive mortality event associated with various factors including the parasite Haplosporidium pinnae. Some populations show resilience, possibly due to local environmental conditions. In this study, a molecular multiplex PCR method was developed using species‐specific primers targeting Internal Transcribed Spacer (ITS) regions of P. nobilis and P. rudis, allowing accurate species identification and hybrid detection. Samples from Mediterranean areas were analysed, including putative hybrids and individuals from five other bivalve species. DNA was isolated, ITS regions were amplified and sequenced, and phylogenetic analyses confirmed species differentiation and primer specificity. The multiplex‐PCR successfully identified P. nobilis, P. rudis, and their hybrids based on distinct amplicon patterns. This study highlights the value of molecular tools in species conservation, especially for monitoring and managing hybridization, supporting effective biodiversity conservation strategies. [ABSTRACT FROM AUTHOR]

This document serves as a diagnostic protocol for Aromia bungii, commonly known as the red necked longhorn beetle. The beetle is originally from East Asia but has been introduced to Japan and Europe. It primarily infests Prunus species and is identified through signs such as larval frass accumulation, exit holes, and the presence of adults. Molecular tests are recommended for identification, especially when morphological examination is not possible. The document also provides a description and identification guide for Aromia bungii, including information on other similar species and details on larvae differentiation. It emphasizes the use of molecular methods for confirmation, particularly in new outbreaks, and offers guidelines for reporting and documentation. The document acknowledges the contributions of various individuals and organizations in its development and provides reference material and sequences for further research. [Extracted from the article]

This document is a diagnostic protocol for Anisogramma anomala, a pathogen that causes eastern filbert blight on European hazelnut trees. It provides information on identifying and detecting the pathogen, including its symptoms and characteristics. The document includes molecular tests for confirmation in critical cases and emphasizes the importance of early detection. It also provides guidance on reporting and documentation, as well as contact information for further information. The appendices provide instructions for isolating the organism and describe the media used for its growth. The document also includes instructions for conducting a real-time PCR test to detect A. anomala, with information on controls, interpretation of results, and performance characteristics. The test has been validated and shown to have high sensitivity and specificity. [Extracted from the article]

The effect of invasive species on existing biological systems has become a major concern in recent years. Countermeasures for invasive species were among the goals of the United Nations Biodiversity Conference (COP15). Cymbella janischii is an alien diatom that recently invaded Japan. Its algal blooms not only spoil the scenery of the river but also raise concerns about its impact on the ecosystem, including damage to fish populations. To monitor the invasion of this species and employ river management, we developed the specific detection assays for this species from environmental DNA, using a polymerase that distinguishes a single base difference at the 3' end of the primer. Three assays for amplifying nuclear-encoded large-subunit rRNA genes (P1, P2, and P3) successfully detected C. janischii without false positives in benthic samples from 12 rivers in Japan. There were no significant differences among the results obtained using the three assays. The three assays showed significant positive correlations with the microscopic observation results, having the advantage of detecting species with low population density. These assays can be performed using inexpensive equipment because they do not necessarily require real-time PCR. However, it can enhance specificity by adding a fluorescent probe to the internal sequence, if necessary. These detection assays can apply to a wide range of environmental samples and are expected to help elucidate the invasive characteristics and ecology of this species. [ABSTRACT FROM AUTHOR]

The spatial pattern of many pathogens that are transmitted by mosquitoes (Diptera: Culicidae) is changing due to globalization and climate change. Thus, surveillance of mosquito vectors is becoming increasingly widespread as basis for risk assessment and control. Species identification by loop‐mediated isothermal amplification (LAMP) assays is simple, fast and reliable. Specific primers for several mosquito species are available (Aedes aegypti, Aedes albopictus, Aedes geniculatus, Aedes japonicus, Aedes koreicus, species of the Anopheles funestus group and An. gambiae complex). In the present work, LAMP assays targeting the rDNA internal transcribed spacer region were developed for Ae. cretinus, a minor sister taxon of Ae. albopictus, and for Culex pipiens/Culex quinquefasciatus and Culex torrentium. The specificities of the primers designed in silico were confirmed by in vitro tests with DNA form non‐target species. Further, the release of DNA from mosquito stages (eggs, larvae, pupae, adults) was investigated, revealing that an incubation for 5 min at 80°C in water is suitable for LAMP. With this method, one specimen (egg, larva, pupa, adult) of a target species could be detected among 49 non‐targets. Thus, the assays are suitable for fast and reliable identification of mosquito species of all life stages by colour change visible to the naked eye, and they are operable under field conditions. [ABSTRACT FROM AUTHOR]

When the polymerase chain reaction (PCR) is used to amplify complex templates such as metagenomic DNA using single or degenerate primers, preferential amplification of templates (PCR bias) leads to a distorted representation of the original templates in the final amplicon pool. This bias can be influenced by mismatches between primers and templates, the locations of mismatches, and the nucleotide pairing of mismatches. Many studies have examined primer-template interactions through interrogation of the final products of PCR amplification with controlled input templates. Direct measurement of primer-template interactions, however, has not been possible, leading to uncertainty when optimizing PCR reactions and degenerate primer pools. In this study, we employed a method developed to reduce PCR bias (i.e., Deconstructed PCR, or DePCR) that also provides empirical data regarding primer-template interactions during the first two cycles of PCR amplification. We systematically examined interactions between primers and templates using synthetic DNA templates and varying primer pools, amplified using standard PCR and DePCR protocols. We observed that in simple primer-template systems, perfect match primer-template interactions are favored, particularly when mismatches are close to the 3′ end of the primer. In more complex primer-template systems that better represent natural samples, mismatch amplifications can dominate, and heavily degenerate primer pools can improve representation of input templates. When employing the DePCR methodology, mismatched primer-template annealing led to amplification of source templates with significantly lower distortion relative to standard PCR. We establish here a quantitative experimental system for interrogating primer-template interactions and demonstrate the efficacy of DePCR for amplification of complex template mixtures with complex primer pools. [ABSTRACT FROM AUTHOR]

Background: The tcdA gene codes for an important toxin produced by Clostridioides difficile (C. difficile), but there is currently no simple and cost-effective method of detecting it. This article establishes and validates a rapid and visual loop-mediated isothermal amplification (LAMP) assay for the detection of the tcdA gene. Methods: Three sets of primers were designed and optimized to amplify the tcdA gene in C. difficile using a LAMP assay. To evaluate the specificity of the LAMP assay, C. difficile VPI10463 was used as a positive control, while 26 pathogenic bacterial strains lacking the tcdA gene and distilled water were utilized as negative controls. For sensitivity analysis, the LAMP assay was compared to PCR using ten-fold serial dilutions of DNA from C. difficile VPI10463, ranging from 207 ng/µl to 0.000207 pg/µl. The tcdA gene of C.difficile was detected in 164 stool specimens using both LAMP and polymerase chain reaction (PCR). Positive and negative results were distinguished using real-time monitoring of turbidity and chromogenic reaction. Results: At a temperature of 66 °C, the target DNA was successfully amplified with a set of primers designated, and visualized within 60 min. Under the same conditions, the target DNA was not amplified with the tcdA12 primers for 26 pathogenic bacterial strains that do not carry the tcdA gene. The detection limit of LAMP was 20.700 pg/µl, which was 10 times more sensitive than that of conventional PCR. The detection rate of tcdA in 164 stool specimens using the LAMP method was 17% (28/164), significantly higher than the 10% (16/164) detection rate of the PCR method (X2 = 47, p < 0.01). Conclusion: LAMP method is an effective technique for the rapid and visual detection of the tcdA gene of C. difficile, and shows potential advantages over PCR in terms of speed, simplicity, and sensitivity. The tcdA-LAMP assay is particularly suitable for medical diagnostic environments with limited resources and is a promising diagnostic strategy for the screening and detection of C. difficile infection in populations at high risk. [ABSTRACT FROM AUTHOR]

Developing the sensitive point‐of‐care testing (POCT) of oncogenic nucleic acids from human papillomavirus (HPV) infection is essential in preventing cervical cancer, especially in resource‐limited settings. Rolling circle amplification (RCA) is attractive in achieving POCT via nucleic acid‐based aggregation under isothermal conditions. However, the influence of RCA product structure on the aggregation remains unexplored resulting in limited sensitivity. Here, a minimum secondary structured RCA technique (MSS‐RCA) is developed by designing a unique circular template, demonstrating significantly enhanced detection sensitivity with only one amplification step and one primer under isothermal conditions. The amplification efficiency of MSS‐RCA could be kinetically manipulated by controlling the secondary structure of the circular template. Introducing the invertase probe to MSS‐RCA, HPV16 E6/E7 nucleic acid target was detected with a personal glucose meter (PGM) with a sensitivity of 5 fm (50 zmol in 10 µL). This integrated MSS‐RCA‐PGM detection system was successfully applied to detect HPV16 E6/E7 mRNA extracted from 54 cervical swab samples reaching a positive predictive value of 100.00% and negative predictive values of 96.00% (77.77% to 99.40%, 95% CI). MSS‐RCA‐PGM provides a sensitive POCT platform for the detection of nucleic acid biomarkers for screening of cervical cancer or other diseases. [ABSTRACT FROM AUTHOR]

The bovine leukemia virus (BLV) is an important infectious agent transmitted from cattle to humans. It is considered one of the oncogenic viruses in breast cancer, so an accurate detection of this virus is important. The study aimed to design a specific and sensitive method based on TaqMan® real-time polymerase chain reaction (RT-PCR) for BLV detection. Probes and primers were designed using bioinformatics software for a 108 pairs region of the BLV tax gene. Criteria employed for determining analytical sensitivity were prepared using in-vitro RNA transcriptions. The National Center for Biotechnology Information (NCBI), basic local alignment search tool (BLAST) databases various viral panels and genomic samples from healthy individuals (Qom Province, Iran in 2023) were used to verify analytical specificity and clinical specificity, respectively. This method can measure a minimum of 10 copies of DNA and RNA mL-1. Moreover, the assay is linear in the range of 100 - 109 copies mL-1. By testing negative specimens, the method specificity was 100%. The reproducibility results of the reaction were examined at the intra- and inter-assay comparison. In fact, 10 technical replicates of each concentration of the control sample were analyzed in each working reaction. Due to the locally made kit, exact sensitivity and specificity, rapid analysis, and relatively low cost, as compared to commercial kits of other countries, the method introduced in the present study could be suitable for accurate detection of the BLV. Also, the TaqMan® real-time PCR method could be detected in cattle and human and before malignant changes of breast cancer which could reduce infection and breast cancer. [ABSTRACT FROM AUTHOR]

Fluorescence dye-based loop-mediated isothermal amplification (LAMP) is a sensitive nucleic acid detection method, but is limited to single-plex detection and may yield non-specific signals. In this study, we propose a bifunctional probe-based real-time LAMP amplification method for single-plexed or multiplexed detection. The bifunctional probe is derived by modifying the 5′ end of the fluorophore and an internal quencher on one of the LAMP primers; therefore, it can simultaneously be involved in the LAMP process and signal amplification. The fluorescence intensity undergoes a cumulative exponential increase during the incorporation of the bifunctional probe into double-stranded DNA amplicons. The bifunctional probe-based LAMP method is simplified and cost-effective, as the primer design and experimental operations align entirely with the ordinary LAMP. Different from other current probe-based methods, this method does not require additional enzymes, sequences, or special probe structures. Also, it is 10 min faster than several other probe-based LAMP methods. The bifunctional probe-based LAMP method allows the simultaneous detection of the target Vibrio parahaemolyticus DNA and the internal amplification control in a one-pot reaction, demonstrating its potential for multiplexed detection. [ABSTRACT FROM AUTHOR]

Objective: Environmental DNA (eDNA) detection is a transformative tool for ecological surveys which in many cases offers greater accuracy and cost-effectiveness for tracking low-density, cryptic species compared to conventional methods. For the use of targeted quantitative PCR (qPCR)-based eDNA detection, protocols typically require freshly prepared reagents for each sample, necessitating systematic evaluation of reagent stability within the functional context of eDNA standard curve preparation and environmental sample evaluation. Herein, we assessed the effects of long-term storage and freeze–thaw cycles on qPCR reagents for eDNA analysis across six assays. Results: Results demonstrate qPCR plates (containing pre-made PCR mix, primer-probe, and DNA template) remain stable at 4 °C for three days before thermocycling without fidelity loss irrespective of qPCR assay used. Primer-probe mixes remain stable for five months of − 20 °C storage with monthly freeze-thaw cycles also irrespective of qPCR assay used. Synthetic DNA stocks maintain consistency in standard curves and sensitivity for three months under the same conditions. These findings enhance our comprehension of qPCR reagent stability, facilitating streamlined eDNA workflows by minimizing repetitive reagent preparations. [ABSTRACT FROM AUTHOR]

The bacterium Klebsiella pneumoniae (Kp) was the primary pathogen of hospitalacquired infection, but the current detection method could not rapidly and conveniently identify Kp. Recombinase polymerase amplification (RPA) was a fast and convenient isothermal amplification technology, and the clustered regularly interspaced short palindromic repeats (CRISPR) system could rapidly amplify the signal of RPA and improve its limit of detection (LOD). In this study, we designed three pairs of RPA primers for the rcsA gene of Kp, amplified the RPA signal through single-strand DNA reporter cleavage by CRISPR/Cas12a, and finally analyzed the cleavage signal using fluorescence detection (FD) and lateral flow test strips (LFTS). Our results indicated that the RPA-CRISPR/Cas12a platform could specifically identify Kp from eleven common clinical pathogens. The LOD of FD and LFTS were 1 fg/µL and 10 fg/µL, respectively. In clinical sample testing, the RPA-CRISPR/Cas12a platform was consistent with the culture method and qPCR method, and its sensitivity and specificity were 100% (16/16) and 100% (9/9), respectively. With the advantages of detection speed, simplicity, and accuracy, the RPA-CRISPR/Cas12a platform was expected to be a convenient tool for the early clinical detection of Kp. [ABSTRACT FROM AUTHOR]

Hb H disease is the most severe form of α-thalassemia compatible with post-natal life. Compound heterozygous α0-thalassemia− SEA deletion/α+-thalassemia− 3.7kb deletion is the commonest cause of Hb H disease in Thailand. Preimplantation genetics testing for monogenic disorders (PGT-M) is an alternative for couples at risk of the disorder to begin a pregnancy with a healthy baby. This study aims to develop a novel PCR protocol for PGT-M of Hb H disease− SEA/−3.7kb using multiplex fluorescent PCR. A novel set of primers for α+-thalassemia− 3.7kb deletion was developed and tested. The PCR protocol for α0-thalassemia− SEA deletion was combined for Hb H disease− SEA/−3.7kb genotyping. The PCR protocols were applied to genomic DNA extracted from subjects with different thalassemia genotypes and on whole genome amplification (WGA) products from clinical PGT-M cycles of the families at risk of Hb Bart's. The results were compared and discussed. The results showed three PCR products from α+-thalassemia− 3.7kb primer set, and three from α0thalassemiaSEA primer set. The results were consistent with the known thalassemia genotypes. The novel -α3.7 primers protocol was also tested on 37 WGA products from clinical PGT-M cycles giving accurate genotyping results and a satisfying amplification efficiency with the ADO rates of 2.7%, 0%, and 0% for HBA2, HBA1, and internal control fragments, respectively. This novel PCR protocol can precisely distinguish Hb H disease− SEA/−3.7kb from other genotypes. Additionally, this is the first PCR protocol for Hb H disease− SEA/−3.7kb which is optimal for PGT-M. [ABSTRACT FROM AUTHOR]

Schizophrenia poses a considerable disease burden, notwithstanding its relatively low incidence rate. The escalation in population size and mean age has led to a substantial rise in the incidence of illness linked to schizophrenia, particularly in countries with moderate levels of prosperity. Therefore, it is necessary to find a way to detect and recognize the illness as fast as possible to stop the consequences from occurring and stop symptoms from appearing before they even start. Within this study’s scope, fifteen distinct primers were selected randomly to determine whether or not they could recognize schizophrenia. To accomplish this, a Randomly Amplified Polymorphic DNA-polymerase chain reaction (RAPD-PCR) was conducted utilizing DNA samples obtained from individuals afflicted with the condition and those in good health. The outcomes of the gel electrophoresis and subsequent analysis revealed that solely three primers including C12, E02 and E03 exhibited monomorphic characteristics. However, it was observed that 80% of the primers, precisely eleven out of fifteen, exhibited polymorphism. The results indicated that among the 15 primers tested, the primer labeled as H01 failed to generate any detectable bands. Subsequent examination of the polymorphic primers revealed that the primer efficiency varied between 0 and 0.0755, while the discrimination power ranged from 0 to 20 percent. The study observed variations in the frequency of disease occurrence between patients and healthy individuals. H05 primer utilization yielded three distinct polymorphic bands exhibiting diverse lengths. The band exhibiting the greatest length measured 1190 bp, whereas the other two bands had 480 and 430 bp lengths respectively. The two polymorphic bands exhibited 100% prevalence in the patient population while being completely absent in the healthy control group. Based on the available data, it appears that utilizing this primer to identify schizophrenia is a valid and valuable claim. Overall, DNA-based diagnostics may overlook a number of difficulties as laboratories have the ability to extract DNA from various sources easily. In this scenario, molecular and genetic techniques may be crucial for diagnosing some diseases. [ABSTRACT FROM AUTHOR]

DNA markers and Multiplex-PCR have emerged as methods for species detection in processed meat products. The primary objective of this study is to design multiplex primer sequences for pork, rat, beef, and chicken, generating distinguishable amplicons through agarose gel electrophoresis for halal detection in processed meat products. Primer design involved utilizing mitochondrial genomic data and the NCBI-Primer BLAST site to obtain specific pork and beef primer sequences. In silico simulations, including single and multiplex-PCR, were conducted using Primer Pooler. In vitro validation encompassed Single-PCR and Multiplex-PCR annealing temperature optimization, using samples of chicken, beef, pork, and rat as well as processed meat products like meatballs, sausages, and nuggets. In vitro validation demonstrated that the halal marker gene's multiplex primer efficiently amplified the target sequence, specifically at the optimal annealing temperature of 58°C. Amplicons from beef (1,217 bp), pork (860 bp), rat (622 bp), and chicken (272 bp) primers could be distinguished on a 1.5% agarose gel. The study's results can aid in cost-effective and rapid halal testing and authentication of processed meat products, offering advantages over PCR with a single primer. [ABSTRACT FROM AUTHOR]

Mosquitoes are prime examples of vectors for various diseases such as malaria, the West Nile virus, elephantiasis, dengue fever, and yellow fever. The repeated use of chemical pesticides has created numerous obstacles and environmental risks including mosquito resistance to insecticides. This work aimed at assessing the larvicidal effect of chlorophyllin (a water-soluble substance obtained after removing the phytol tail from chlorophyll) and coumarin as photosensitizers, compared to the microbial insecticide Bacillus thuringiensis israelensis (Bti) and permethrin, a chemical insecticide, against the third larval instar of Culex pipiens larvae monitoring its mode of action and its genotoxic effect. Photosensitizers exposed to sunlight generate reactive oxygen species (ROS), with singlet oxygen (¹O2) capable of killing parasitic organisms primarily in aquatic systems. Our experiments demonstrated a high potential activity of Na-Cu chlorophyllin against mosquito larvae after at least 8 hours of incubation in the dark. The LC50 values were 0.22x10-3, 0.96x10-2, 13.7x10-2, and 4.59x10-1 mg/ l after 24 hours of exposure to chlorophyllin, Bti, permethrin, and coumarin, respectively. The molecular changes after treatment with chlorophyllin were tracked using RAPD-PCR with six arbitrary DNA primers. Results confirmed no significant changes or genetic damage after treatment with chlorophyll derivatives. [ABSTRACT FROM AUTHOR]

To prevent threats from pathogens such as Phytophthora species from international plant trade, molecular identification techniques are needed for rapid, accurate quarantine inspection. Here, for quarantine control in Japan, we developed a simple DNA extraction for plants and a practical detection method that combines multiplexed PCR using primers specific for Phytophthora species, for P. nicotianae, which is the only non-quarantine Phytophthora species, and as internal controls, for plants. For the new genus-level primer set, we modified previously reported genus-specific primers to improve detectability. The new primers were able to detect mycelial DNA of 155 taxa among Phytophthora clades 1–10, with a sensitivity of 100 fg/µL for three representative species, P. ramorum, P. kernoviae and P. nicotianae. In the PCRs using DNA from non-target species, amplification was observed for only three taxa, and for some strains, four taxa in a closely related genus. Duplex and triplex PCR of the genus-specific primers combined with previously reported plant primers verified the success of DNA extraction and PCR detection from diseased plant samples, and in the triplex PCR, whether the pathogen was diagnosed as P. nicotianae or not by the species-specific primer. The new method detected the pathogen in naturally infected and inoculated plants. The amplicons using the genus-specific primer have enough variation to be sequenced to identify the species. This new method can be used immediately for detecting Phytophthora species and for quarantine control in Japan. [ABSTRACT FROM AUTHOR]

Short‐Patch Double Illegitimate Recombination (SPDIR) has been recently identified as a rare mutation mechanism. During SPDIR, ectopic DNA single‐strands anneal with genomic DNA at microhomologies and get integrated during DNA replication, presumably acting as primers for Okazaki fragments. The resulting microindel mutations are highly variable in size and sequence. In the soil bacterium Acinetobacter baylyi, SPDIR is tightly controlled by genome maintenance functions including RecA. It is thought that RecA scavenges DNA single‐strands and renders them unable to anneal. To further elucidate the role of RecA in this process, we investigate the roles of the upstream functions DprA, RecFOR, and RecBCD, all of which load DNA single‐strands with RecA. Here we show that all three functions suppress SPDIR mutations in the wildtype to levels below the detection limit. While SPDIR mutations are slightly elevated in the absence of DprA, they are strongly increased in the absence of both DprA and RecA. This SPDIR‐avoiding function of DprA is not related to its role in natural transformation. These results suggest a function for DprA in combination with RecA to avoid potentially harmful microindel mutations, and offer an explanation for the ubiquity of dprA in the genomes of naturally non‐transformable bacteria. [ABSTRACT FROM AUTHOR]

DNA barcodes can provide accurate identification of plants. We used previously reported DNA primers targeting the internal transcribed spacer (ITS1) region of the nuclear ribosomal cistron, internal transcribed spacer (ITS2), and chloroplast trnL (UAA) intron to identify four trees at Bergen Community College. Two of the four trees were identified as Acer rubrum and Fagus sylvatica. However, Quercus was only identified at the genus level, and the fourth tree did not show similar identification between barcodes. Next-generation sequencing of 16S rRNA genes showed that the predominant bacterial communities in the rhizosphere mainly consisted of the Pseudomonadota, Actinomycetota, Bacteroidota, and Acidobacteriota. A. rubrum showed the most diverse bacterial community while F. sylvatica was less diverse. The genus Rhodoplanes showed the highest relative bacterial abundance in all trees. Fungal ITS sequence analysis demonstrated that the communities predominantly consisted of the Ascomycota and Basidiomycota. Quercus showed the highest fungi diversity while F. sylvatica showed the lowest. Russula showed the highest abundance of fungi genera. Average similarity values in the rhizosphere for fungi communities at the phylum level were higher than for bacteria. However, at the genus level, bacterial communities showed higher similarities than fungi. Similarity values decreased at lower taxonomical levels for both bacteria and fungi, indicating each tree has selected for specific bacterial and fungal communities. This study confirmed the distinctiveness of the microbial communities in the rhizosphere of each tree and their importance in sustaining and supporting viability and growth but also demonstrating the limitations of DNA barcoding with the primers used in this study to identify genus and species for some of the trees. The optimization of DNA barcoding will require additional DNA sequences to enhance the resolution and identification of trees at the study site. [ABSTRACT FROM AUTHOR]

Recently, extracellular vesicles (EVs) have been developed as therapeutic targets for various diseases. Biodistribution is crucial for EVs intended for therapeutic purposes because it can determine the degree of on‐ and off‐target effects. This study aimed to explore techniques to evaluate the biodistribution of unmodified EVs. We devised a novel quantitative polymerase chain reaction (qPCR)‐based assay to detect unmodified EVs by targeting mitochondrial deoxyribonucleic acid (mtDNA), a constituent of EVs. We focused on specific mtDNA regions that exhibited homologous variations distinct from their rodent mtDNA counterparts to establish this analytical approach. Herein, we successfully designed primers and probes targeting human and rodent mtDNA sequences and developed a highly specific and sensitive qPCR method. Furthermore, the quantification range of EVs isolated from various cells differed based on the manufacturer and cell source. IRDye 800CW‐labelled Expi293F EV mimetics were administered to the animals via the tail vein to compare the imaging test and mtDNA‐qPCR results. The results obtained from imaging tests and mtDNA‐qPCR to investigate EV biodistribution patterns revealed differences. The results revealed that our newly developed method effectively determined the biodistribution of unmodified EVs with high sensitivity and reproducibility. [ABSTRACT FROM AUTHOR]

[Objective] The traditional morphological classification combined with the DNA barcode method was used to classify the important natural enemies of the genus Anteris, to identify the resources of the genus (Anteris) in the wild fruit forests of the Xitianshan Mountains in the Ili River Valley of Xinjiang, and to amplify its molecular data in NCBI, so as to facilitate the rapid and accurate identification of subsequent studies, and to lay the foundation for the studies on the biology, molecular biology and ecology of the genus Anteris. [Method] Specimens of the family Scelionidae obtained by net sweeping and yellow disetrapping in the wild fruit forests of Xitianshan Mountain, Ili River Valley, Xinjiang, China, in 2021-2023 were collated, and morphological characteristics were observed under a digital stereomicroscope, and species of the genus Anteris were selected. On the basis of traditional morphometrics identification, the genomic DNA of the species was extracted by using a non-destructive extraction method, and the genes were amplified using universal primers. COI and 28S rDNA sequences were amplified with universal primers, which were used as DNA barcodes of the species, and compared with the COI sequences of other species in the family of Scelionidae on the NCBI website, to analyze the base composition and calculate the genetic distances; A phylogenetic tree based on the maximum likelihood method was constructed, and preliminary phylogenetic analyses were carried out. [Result] We found one new Chinesegenus Anteris, and two new Chinesespecies-Anteris simulans and Anteris szelényii, and provided morphological descriptions of the new genera and species, as well as morphological character pictures We obtained COI and 28S rDNA sequences of the two new species. It could be seen that the intraspecific genetic distances of A. simulans were in the range of 0.000 0.003, and the interspecific genetic distances between A. simulans and A. szelényii with A. bilineata were 0.095 and 0.019, respectively, which were both smaller than the maximum intraspecific genetic distances of A. simulans, which was more closely related to A. bilineata. [Conclusion] The newly discovered A. simulans and A. szelényi in the study further enrich the resource data of Seelionidae in China and the world, and are of great significance for the conservation and utilisation of the taxa of the family Scelionidae. [ABSTRACT FROM AUTHOR]

Simple Summary: In this study, 82 fecal samples of suspected FPV infection were collected from different areas of Henan Province from 2020 to 2022 (small sample in 2023), viral DNA was extracted, and FPV identification primers were used to identify 25 FPV-positive cases. VP2 and NS1 primers were further used to amplify the above positive samples, and the whole gene sequences of 11 VP2 and 21 NS1 strains were obtained and analyzed. Homology analysis showed that the amino acid homology of the VP2/NS1 gene of the isolates was 96.1–100% and 97.6–100%, respectively, with that of domestic and foreign endemic strains. The phylogenetic tree results showed that VP2 and NS1 of the local strains were mainly concentrated in the G1 subgroup, while the vaccine strains were distributed in the G3 subgroup, and the two strains were far-related. F81 cells were inoculated with local endemic strain SNF-01 (FPV-LY strain for short) from the FPV G1 subgroup for virus amplification, purification, and titer determination, and the pathogenesis of SNF-01 was detected. After five generations of blind transmission of F81 cells, the cells of the FPV-LY strain were rounded, wire-drawn, and crumpled. After sucrose density gradient centrifugation, the virus titer was determined by the Reed–Muench method to be 1.5 × 106 TCID50/mL. Animal regression tests showed that the strain PFV-LY was highly pathogenic, and the cats showed typical clinical symptoms and pathological changes, and eventually died. Carnivore protoparvovirus-1, feline parvovirus (FPV), and canine parvovirus (CPV) continue to spread in companion animals all over the world. As a result, FPV and CPV underwent host-to-host transfer in carnivorous wild-animal hosts. Here, a total of 82 fecal samples of suspected cat FPV infections were collected from Henan Province from 2020 to 2022. The previously published full-length sequence primers of VP2 and NS1 genes were used to amplify the targeted genes of these samples, and the complete gene sequences of 11 VP2 and 21 NS1 samples were obtained and analyzed. Analysis showed that the amino acid homology of the VP2 and NS1 genes of these isolates was 96.1–100% and 97.6–100%, respectively. The phylogenetic results showed that the VP2 and NS1 genes of the local isolates were mainly concentrated in the G1 subgroup, while the vaccine strains were distributed in the G3 subgroup. Finally, F81 cells were inoculated with the local endemic isolate Luoyang-01 (FPV-LY strain for short) for virus amplification, purification, and titer determination, and the pathogenesis of FPV-LY was detected. After five generations of blind transmission in F81 cells, cells infected with FPV-LY displayed characteristic morphological changes, including a round, threadlike, and wrinkled appearance, indicative of viral infection. The virus titer associated with this cytopathic effect (CPE) was measured at 1.5 × 106 TCID50/mL. Subsequent animal regression tests confirmed that the virus titer of the PFV-LY isolate remained at 1.5 × 106 TCID50/mL, indicating its highly pathogenic nature. Cats exposed to the virus exhibited typical clinical symptoms and pathological changes, ultimately succumbing to the infection. These results suggest that the gene mutation rate of FPV is increasing, resulting in a complex pattern of gene evolution in terms of host preference, geographical selection, and novel genetic variants. The data also indicate that continuous molecular epidemiological surveillance is required to understand the genetic diversity of FPV isolates. [ABSTRACT FROM AUTHOR]

Bovine meat and milk factors (BMMF) having structural similarity to plasmids of Acinetobacter baumanni and some single stranded (ss) DNA viruses are free circulating replication-competent circular ssDNA molecules which were first isolated from serum of Bos taurus animals. Isolation of BMMF from tissues of multiple sclerosis as well as some cancers led researchers to conclude that the consumption of these agents through milk and meat have a positive correlation with these diseases and that the absence of such molecules in B. indicus animals could account to the low occurrence of cancer in those areas consuming products of indigenous animals. Hence, the present study was designed to investigate its presence in Deoni, one of the indigenous cattle breeds of India. The DNA isolated from milk samples were subjected to rolling circle amplification (RCA) using exo-resistant random primers. The products of RCA were then used as template for PCR for amplification of circular DNA. The amplicons obtained of size around 2000bp were cloned in E. coli and sequenced. The BLASTn, multiple sequence alignment and phylogenetic analysis of the obtained sequences were carried out to identify the similarities of these isolates. The sequence showed maximum homology with either BMMF2 or plasmids of Acinetobactor spp. Replication initiation protein (Rep) which showed similarity to bacterial plasmids was present in the sequence. This is the pioneer report on the presence of BMMF in milk of indigenous cattle of India. [ABSTRACT FROM AUTHOR]

Legionella pneumophila is the waterborne pathogen primarily responsible for causing both Pontiac Fever and Legionnaire's Disease in humans. L. pneumophila is transmitted via aerosolized water droplets. The purpose of this study was to design and test primers to allow for rapid polymerase chain reaction (PCR) melt detection and identification of this infectious agent in cases of clinical or emergency response detection. New PCR primers were designed for this species of bacteria; the primer set was purchased from IDT and the target bacterial DNA was purchased from ATCC. The L. pneumophila primers targeted the macrophage infectivity potentiator gene (mip), which inhibits macrophage phagocytosis. The primers were tested for specificity, repeatability, and sensitivity using PCR–high-resolution melt (HRM) assays. The primer set was found to be specific to the designated bacteria and did not amplify the other twenty-one species from the panel. The L. pneumophila assay was able to be multiplexed. The duplex assay consists of primers for L. pneumophila and Vibrio parahaemolyticus, which are both waterborne pathogens. The triplex assay consists of primers for L. pneumophila, V. parahaemolyticus, and Campylobacter jejuni. The unique melting temperature for the L. pneumophila primer assay is 82.84 ± 0.19 °C, the C. jejuni assay is 78.10 ± 0.58 °C, and the V. parahaemolyticus assay is 86.74 ± 0.65 °C. [ABSTRACT FROM AUTHOR]

Introduction: Arctic marine ecosystems are changing rapidly, largely due to the observed accelerated warming that is associated with ongoing climate change. Environmental DNA (eDNA) combined with metabarcoding has great potential for large-scale biomonitoring of Arctic marine communities. However, important limitations remain, such as understanding the complexity and drivers of spatiotemporal variation in eDNA distribution. Methods: In this study, we investigated the effect of tidal dynamics on aquatic metazoan (vertebrates and invertebrates) on eDNA metabarcoding results from nearshore estuarine and marine Arctic ports of Churchill (Manitoba) and Milne Inlet (Nunavut), respectively. We collected and sequenced 54 water samples per port at low, middle and high tide across three days, as well as two depths (surface, bottom), using four universal primer pairs (two primers in the COI gene and two in the 18S rRNA gene). Results: We observed a significant transition in the estuarine community structure from low to high tide, whereas the marine community structure was more stable across tides. The eDNA community structure differed between the surface and bottom waters in both the estuarine and marine ecosystems. However, the biodiversity pattern within the water column was significantly different between estuarine and marine ecosystems. Finally, we observed short-term temporal variation of the communities in both systems. Discussion: Altogether, our results highlight the short-term temporal dynamic nature of eDNA derived from coastal communities. This variability should be accounted for in eDNA sampling design to ensure robust characterization of coastal communities and long-term time series, particularly for estuarine environments where the effects of tide and depth are more important. [ABSTRACT FROM AUTHOR]

The human gut microbiota refers to a diverse community of microorganisms that symbiotically exist in the human intestinal system. Altered microbial communities have been linked to many human pathologies. However, there is a lack of rapid and efficient methods to assess gut microbiota signatures in practice. To address this, we established an appraisal system containing 45 quantitative real-time polymerase chain reaction (qPCR) assays targeting gut core microbes with high prevalence and/or abundance in the population. Through comparative genomic analysis, we selected novel species-specific genetic markers and primers for 31 of the 45 core microbes with no previously reported specific primers or whose primers needed improvement in specificity. We comprehensively evaluated the performance of the qPCR assays and demonstrated that they showed good sensitivity, selectivity, and quantitative linearity for each target. The limit of detection ranged from 0.1 to 1.0 pg/µL for the genomic DNA of these targets. We also demonstrated the high consistency (Pearson's r = 0.8688, P < 0.0001) between the qPCR method and metagenomics next-generation sequencing (mNGS) method in analyzing the abundance of selected bacteria in 22 human fecal samples. Moreover, we quantified the dynamic changes (over 8 weeks) of these core microbes in 14 individuals using qPCR, and considerable stability was demonstrated in most participants, albeit with significant individual differences. Overall, this study enables the simple and rapid quantification of 45 core microbes in the human gut, providing a promising tool to understand the role of gut core microbiota in human health and disease. Key points: • A panel of original qPCR assays was developed to quantify human gut core microbes. • The qPCR assays were evaluated and compared with mNGS using real fecal samples. • This method was used to dynamically profile the gut core microbiota in individuals. [ABSTRACT FROM AUTHOR]

Mpox virus (MPXV) can cause mpox in humans. Due to its quick and wide spread in the past two years, mpox has turned into a significant public health concern. Helicase E5 is a multi-domain protein; its primer synthesis and DNA unwinding activity are required for genome uncoating and DNA replication of MPXV. However, the in vitro DNA unwinding activity has never been demonstrated. Here, we report the structural and biochemical studies of MPXV E5, showing that the full-length protein adopts an auto-inhibited conformation. Truncation of the N-terminus can recover the in vitro unwinding activity of E5 towards the forked DNA. Further structural analysis reveals that MPXV E5 shares a conserved mechanism in DNA unwinding and primer synthesis with the homologous proteins. These findings not only advance our understanding on the function of MPXV E5, but also provide a solid basis for the development of anti-poxvirus drugs. [ABSTRACT FROM AUTHOR]

Background: The Anopheles dirus complex plays a significant role as a malaria vector in the Greater Mekong Subregion (GMS), with varying degrees of vector competence among species. Accurate identification of sibling species in this complex is essential for understanding malaria transmission dynamics and deploying effective vector control measures. However, the original molecular identification assay, Dirus allele-specific polymerase chain reaction (AS-PCR), targeting the ITS2 region, has pronounced nonspecific amplifications leading to ambiguous results and misidentification of the sibling species. This study investigates the underlying causes of these inconsistencies and develops new primers to accurately identify species within the Anopheles dirus complex. Methods: The AS-PCR reaction and thermal cycling conditions were modified to improve specificity for An. dirus member species identification. In silico analyses with Benchling and Primer-BLAST were conducted to identify problematic primers and design a new set for Dirus complex species identification PCR (DiCSIP). DiCSIP was then validated with laboratory and field samples of the An. dirus complex. Results: Despite several optimizations by reducing primer concentration, decreasing thermal cycling time, and increasing annealing temperature, the Dirus AS-PCR continued to produce inaccurate identifications for Anopheles dirus, Anopheles scanloni, and Anopheles nemophilous. Subsequently, in silico analyses pinpointed problematic primers with high Guanine-Cytosine (GC) content and multiple off-target binding sites. Through a series of in silico analyses and laboratory validation, a new set of primers for Dirus complex species identification PCR (DiCSIP) has been developed. DiCSIP primers improve specificity, operational range, and sensitivity to identify five complex member species in the GMS accurately. Validation with laboratory and field An. dirus complex specimens demonstrated that DiCSIP could correctly identify all samples while the original Dirus AS-PCR misidentified An. dirus as other species when used with different thermocyclers. Conclusions: The DiCSIP assay offers a significant improvement in An. dirus complex identification, addressing challenges in specificity and efficiency of the previous ITS2-based assay. This new primer set provides a valuable tool for accurate entomological surveys, supporting effective vector control strategies to reduce transmission and prevent malaria re-introducing in the GMS. [ABSTRACT FROM AUTHOR]