Search

Peripheral T-cell lymphomas (PTCLs) are a heterogeneous group of lymphoid malignancies associated with poor prognosis due to ineffective treatment options and high rates of relapse. The success of chimeric antigen receptor T-cell (CART) therapy for certain hematologic malignancies makes it an attractive treatment option for PTCLs. However, shared expression of potential target antigens by both malignant and healthy T cells poses a challenge. Current prospective CART approaches cause a high degree of on-target, off-tumor activity, resulting in fratricide during CART expansion, depletion of healthy T cells in vivo, and immune compromise in the patient. To limit off-tumor targeting, we sought to develop a CART platform specific for a given T-cell receptor vβ (TCRvβ) family that would endow CAR-modified T cells with the ability to mediate lysis of the clonal malignant population while preserving the majority of healthy T cells. Here, CAR constructs specific for multiple TCRvβ family members were designed and validated. Our results demonstrate that TCRvβ-family–specific CARTs (TCRvβ-CARTs) recognize and kill TCRvβ-expressing target cells. This includes specific self-depletion of the targeted cell subpopulation in the CART product and lysis of cell lines engineered to express a target TCRvβ family. Furthermore, TCRvβ-CARTs eliminated the dominant malignant TCRvβ clone in 2 patient samples. Finally, in immunodeficient mice, TCRvβ-CARTs eradicated malignant cells in a TCRvβ-dependent manner. Importantly, the nontargeted TCRvβ families were spared in all cases. Thus, TCRvβ-CART therapy provides a potential option for high-precision treatment of PTCL with limited healthy T-cell depletion.

Over the past two decades researchers have documented the extent of natural hybridization between closely related species using genomic tools. Many species across the tree of life show evidence of past hybridization with their evolutionary relatives. In some cases, this hybridization is complex – involving gene flow between more than two species. While hybridization is common over evolutionary timescales, some researchers have proposed that it may be even more common in contemporary populations where anthropogenic disturbance has modified myriad aspects of the environments in which organisms live and reproduce. Here, we develop a flexible tool for local ancestry inference in hybrids derived from three source populations and describe a complex, recent hybridization event between distantly related swordtail fish lineages (Xiphophorus) and its potential links to anthropogenic disturbance.Impact SummaryAs sequencing tools have advanced, we have found that barriers between animal species are more porous than once thought. Researchers have found evidence for hybridization between species throughout many branches of the tree of life. In some cases, these hybridization events can involve more than two species. Here, we develop a flexible and user-friendly tool that can be used to identify three-way hybrids and report the discovery of hybrids with ancestry from three swordtail (Xiphophorus) species from an anthropogenically impacted site on the Río Calnali in Hidalgo, Mexico. Researchers have studied hybrids between twoXiphophorusspecies along this river for decades, but this is the first documented case of hybridization involving three species. We explore hypotheses for what drove this hybridization event, including anthropogenic pollutants and reduced water quality.

Meibomian glands (MG) are now easily imaged via clinical meibography machines. The purpose of this work was to explore the utility of the known MG morphology metrics for predicting dry eye disease (DED) in contact lens (CL) wearers.Successful and previous CL wearers were recruited. DED was diagnosed if the participant's worst eye had a reduced tear meniscus height (TMH) of0.2 mm or non-invasive tear break-up time (NITBUT) of10 s and a Standardized Patient Evaluation of Eye Dryness (SPEED) score5.0. Meibography was performed and images were subjectively graded by two examiners for the following MG characteristics: distorted, tortuous, hooked, abnormal gap, overlapping, fluffy areas, tadpoling, thinned, thickened, ghost, no extension to lid margin, shortened and dropout (atrophy). DED diagnostic ability of each metric was determined with receiver operating characteristic (ROC) analysis.A total of 112 participants were recruited, with 18.8% having DED and 60.7% being female. The only MG morphology metrics that were marginally predictive of DED were thickened upper eyelid MGs (p = 0.046), thickened mean upper plus lower eyelid MGs (p = 0.007), and atrophy of upper eyelid MGs (p = 0.043); however, none of these metrics reached a meaningful area under the curve in ROC analysis (all0.70).While abnormal MG morphology is likely suggestive of DED in CL wearers, none of the MG morphology metrics evaluated alone in this study had clinically meaningful predictive value for detecting DED in this group of current and previous CL wearers.

Background: Medically ill youth are at increased suicide risk, necessitating early detection. This study aimed to assess the feasibility of administering the Death Implicit Association Test (Death IAT) to pediatric medical inpatients. Methods: Participants completed measures including the Ask Suicide-Screening Questions (ASQ) and the Death IAT. Results: Over 90% of participants found the Death IAT to be acceptable and more than 75% of participants were comfortable completing the task. There was a small, but statistically significant, improvement from pre-survey to post-survey reports of mood (t(174) = 3.02, p = 0.003, d = 0.15). Participants who endorsed a past suicide attempt on the ASQ had significantly higher “suicide” trial D-scores than those without a past suicide attempt (Wilcoxon W = 1312; p = 0.048; d = 0.61). Conclusions: Implementing an IAT measure among pediatric medical inpatients was feasible and acceptable. In exploratory analyses, “suicide” trial IAT D-scores were associated with past suicide attempts, suggesting future studies should examine whether implicit measures may be useful in hospital settings to augment detection of youth suicide risk.

STAT4 plays a critical role in the generation of both innate and adaptive immune responses. In the absence of STAT4, Th1 responses, critical for resistance to fungal disease, do not occur. Infection with the dimorphic fungus, Coccidioides, is a major cause of community-acquired pneumonia in the endemic regions of Arizona and California. In some people and often for unknown reasons, coccidioidal infection results in hematogenous dissemination and progressive disease rather than the typical self-limited pneumonia. Members of three generations in a family developed disseminated coccidioidomycosis, prompting genetic investigation. All affected family members had a single heterozygous base change in STAT4, c.1877A>G, causing substitution of glycine for glutamate at AA626 (STAT4E626G/+). A knockin mouse, heterozygous for the substitution, developed more severe experimental coccidioidomycosis than did wild-type mice. Stat4E626G/+ T cells were deficient in production of IFN-γ after anti-CD3/CD28 stimulation. Spleen cells from Stat4E626G mice showed defective responses to IL-12/IL-18 stimulation in vitro. In vivo, early postinfection, mutant Stat4E626G/+ mice failed to produce IFN-γ and related cytokines in the lung and to accumulate activated adaptive immune cells in mediastinal lymph nodes. Therefore, defective early induction of IFN-γ and adaptive responses by STAT4 prevents normal control of coccidioidomycosis in both mice and humans.

PDF file - 159K

Aberrant blood vessels enable tumor growth, provide a barrier to immune infiltration, and serve as a source of protumorigenic signals. Targeting tumor blood vessels for destruction, or tumor vascular disruption therapy, can therefore provide significant therapeutic benefit. Here, we describe the ability of chimeric antigen receptor (CAR)–bearing T cells to recognize human prostate–specific membrane antigen (hPSMA) on endothelial targets in vitro as well as in vivo. CAR T cells were generated using the anti-PSMA scFv, J591, and the intracellular signaling domains: CD3ζ, CD28, and/or CD137/4-1BB. We found that all anti-hPSMA CAR T cells recognized and eliminated PSMA+ endothelial targets in vitro, regardless of the signaling domain. T cells bearing the third-generation anti-hPSMA CAR, P28BBζ, were able to recognize and kill primary human endothelial cells isolated from gynecologic cancers. In addition, the P28BBζ CAR T cells mediated regression of hPSMA-expressing vascular neoplasms in mice. Finally, in murine models of ovarian cancers populated by murine vessels expressing hPSMA, the P28BBζ CAR T cells were able to ablate PSMA+ vessels, cause secondary depletion of tumor cells, and reduce tumor burden. Taken together, these results provide a strong rationale for the use of CAR T cells as agents of tumor vascular disruption, specifically those targeting PSMA. Cancer Immunol Res; 3(1); 68–84. ©2014 AACR.

PDF file - 1301K, Figure S2. Absence of degranulation by CD19-28z CART cells in response to tumor cells expressing mesothelin or FRa or both. CD19-28z CART cells were cultured with the indicated antigen-negative tumor cells or tumor cells expressing FRa or mesothelin, or both antigens for 5 h while being stained by an anti-CD107a,b antibody conjugated with FITC. After incubation, T cells were stained for CD8 and CD69 and analyzed by flow cytometry.

Adoptive transfer of T cells engineered to express chimeric immunoreceptors is an effective strategy to treat hematologic cancers; however, the use of this type of therapy for solid cancers, such as ovarian cancer, remains challenging because a safe and effective immunotherapeutic target has not yet been identified. Here, we constructed and evaluated a novel redirected T-cell–based immunotherapy targeting human follicle-stimulating hormone receptor (FSHR), a highly conserved molecule in vertebrate animals with expression limited to gonadal tissues, ovarian cancer, and cancer-associated vasculature. Receptor ligand–based anti-FSHR immunoreceptors were constructed that contained small binding fragments from the ligand for FSHR, FSH, fused to T-cell transmembrane and T-cell signaling domains. Human T cells transduced to express anti-FSHR immunoreceptors were specifically immunoreactive against FSHR-expressing human and mouse ovarian cancer cell lines in an MHC-nonrestricted manner and mediated effective lysis of FHSR-expressing tumor cells, but not FSHR-deficient targets, in vitro. Similarly, the outgrowth of human ovarian cancer xenografts in immunodeficient mice was significantly inhibited by the adoptive transfer of FSHR-redirected T cells. Our experimental observations show that FSHR is a promising immunotherapeutic target for ovarian cancer and support further exploration of FSHR-targeted immune therapy approaches for patients with cancer. Cancer Immunol Res; 3(10); 1130–7. ©2015 AACR.

Vaccination strategies incorporating the immunodominant HLA-A2–restricted HER2/neu-derived peptide 369–377 (HER2369–377) are increasingly utilized in HER2/neu-expressing cancer patients. The failure of postvaccination HER2369–377-specific CD8+ T cells to recognize HLA-A2posHER2/neu-expressing cells in vitro, however, has been attributed to impaired MHC class I/HLA-A2 presentation observed in HER2/neu-overexpressing tumors. We reconcile this controversy by demonstrating that HER2369–377 is directly recognized by high functional-avidity HER2369–377-specific CD8+ T cells—either genetically modified to express a novel HER2369–377 TCR or sensitized using HER2369–377-pulsed type 1–polarized dendritic cells (DC1)—on class I–abundant HER2low, but not class I–deficient HER2high, cancer cells. Importantly, a critical cooperation between CD4+ T-helper type-1 (Th1) cytokines IFNγ/TNFα and HER2/neu-targeted antibody trastuzumab is necessary to restore class I expression in HER2high cancers, thereby facilitating recognition and lysis of these cells by HER2369–377-specific CD8+ T cells. Concomitant induction of PD-L1 on HER2/neu-expressing cells by IFNγ/TNF and trastuzumab, however, has minimal impact on DC1-sensitized HER2369–377-CD8+ T-cell–mediated cytotoxicity. Although activation of EGFR and HER3 signaling significantly abrogates IFNγ/TNFα and trastuzumab-induced class I restoration, EGFR/HER3 receptor blockade rescues class I expression and ensuing HER2369–377-CD8+ cytotoxicity of HER2/neu-expressing cells. Thus, combinations of CD4+ Th1 immune interventions and multivalent targeting of HER family members may be required for optimal anti-HER2/neu CD8+ T-cell–directed immunotherapy. Cancer Immunol Res; 3(5); 455–63. ©2015 AACR.

The expression of 18S used as a internal control (housekeeper). cDNA was constructed from total RNA isolated from 10e5 cells (cultured at 60-70% confluence). PCR performed using intron-spanning primers. Validation criteria included water blanks, and NO RT samples. For human 18SrRNA 5’CAGCCACCCGAGATTGAGCA3’ and Rev: 5’TAGTAGCGACGGGCGGTGTG3’ (amplicon 253bp) (Genbank:: NR_003286.2). For mouse ID8 cell line Ribosomal RNA for mouse Eukaryotic small ribosomal subunit [Genbank: NR_003278] primers Fw: 5’AGGGGAGAGCGGGTAAGAGA-3’ and Rev: 5’GGACAGGACTAGGCGGAACA3’ were used (amplicon size of 249bp).

Supplemental Figure Legends

Figure S1: CAR surface expression tightly correlates with eGFP reporter expression. Figure S2: Bcl-xL induction in response to CAR T-cell activation. Figure S3: PSMA is expressed heterogeneously on tumor blood vessels. Figure S4: P28BBζ T cell-mediated regression of large PSMA+ hemangiomas. Figure S5: P28BBζ T cells eliminate PSMA+ tumor blood vessels and elicit tumor regression in MS1PSMA/ID8 tumors. Figure S6: Comparison of single vs. multiple injections of P28BBζ T cells.

PDF file - 514K, Figure S4. A1847 (M+/F+) and A1847 (M+/F-) cells exhibit similar in vitro growth rate. 1 x 106 A1847 (M+/F+) and A1847 (M+/F-) cells were seeded on day 0 and their in vitro growth kinetics were monitored by determining viable cells using the trypan blue exclusion method.

PDF file - 1125K, Figure S1. Correlated scFv and GFP transgene expression following F-28 CAR transduction. T cells were lentivirally transduced to express the costimulatory F-28 CAR and 5 days later were stained for surface scFv using biotinylated protein-L followed by SA-APC. Transduction efficiency was also monitored using GFP transgene expression. Transduction efficiencies are indicated with the percentage of CAR expression of the transduced populations. Coordinate expression of surface scFv and GFP was observed in all experiments.

Supplementary Figure Legend from Follicle-Stimulating Hormone Receptor as a Target in the Redirected T-cell Therapy for Cancer

PDF file - 583K, Figure S6. Trans-, but not cis-, signaling CART cells exhibit more limited in vitro activity against cells bearing single antigen. IFN-γ secretion by trans M-z/F-28 CART cells was significantly reduced in response to A1847M+/F- cells compared with parental A1847M+/F+. M-z, M-z/F-28, or M-28z transduced T cells (1 x 105 T cells) were cultured alone (none) or stimulated overnight with an equal number of C30, A1847M+/F+ or A1847M+/F- cells. Cell-free supernatant was harvested after ~20 hours of incubation and the IFN- γ levels were measure with ELISA. Mean IFN- γ concentration plus-minus SEM (pg/ml) from triplicate cultures is shown. *P < 0.05 comparing the IFN- γ secretion produced by M-z/F-28 CART cells against A1847M+/F+ versus A1847M+/F- cells.

PDF file - 854K, Figure S5. F-28z CART cells produce dramatically less IFN-γ in response to stimulation with A1847 (M+/F-) cells compared to A1847 (M+/F+) cells. A. F-28z CAR expression on human CD3+ T cells upon transduction with lentivirus compared to untransduced T cells. F-28z CART transduced T cells were detected using biotinylated-protein L followed by SA-PE. B. Transduced T cells (1 x 105 T cells) were cultured alone (none) or stimulated overnight with an equal number of either FRa-negative PEO-1 cells or A1847 (M+/F-) cells, or FRa-positive A1847 (M+/F+) cancer cells. Cell-free supernatant was harvested after ~20 hours of incubation and the IFN-γ levels were measured with ELISA. Mean IFN-γ concentration plus-minus SEM (pg/ml) from triplicate cultures is shown. ***P < 0.001 comparing the IFN-γ secretion produced by M-z/F-28 CART cells against A1847M+/F+ versus A1847M+/F- or PEO cells.

PDF file - 1935K, Figure S3. shRNA based silencing of FRa in A1847 ovarian cancer cells. The parental human ovarian cancer cell line A1847 which expresses surface mesothelin and FRa protein was transduced with lentiviral particles encoding for an shRNA specific for silencing FRa gene expression (A1847 sh4 M+/F-). To determine surface antigen expression, cells were stained with an anti-mesothelin biobody reagent (P4 Bb) and anti-FRa antibody or proper isotype antibody controls. FRa expression was unaltered after engineering cells with control shRNA (A1847 csh M+/F+).

Figure S1: HER2high cells are susceptible to NK-mediated ADCC, but not HER2369-377-sensitized CD8+ T-cell-mediated cytotoxicity. Figure S2: Cell line-specific IFN-γ receptor expression and impact of IFN-γ dose titration on MHC class I expression. Figure S3: Comparative effects of trastuzumab or lapatinib in conjunction with Th1 cytokines on class I and HER2 expression. Table S1: Demographic, tumor, and HLA-A typing characteristics of HER2pos-DCIS patients utilized for in vitro sensitization, recognition, and cytotoxicity assays.

CCR Translation for This Article from CD137 Accurately Identifies and Enriches for Naturally Occurring Tumor-Reactive T Cells in Tumor

Supplementary Figures S1-S4 from Expression of a Functional CCR2 Receptor Enhances Tumor Localization and Tumor Eradication by Retargeted Human T cells Expressing a Mesothelin-Specific Chimeric Antibody Receptor

Supplementary Materials, Methods, Figures and Table legends - PDF file 87K, Supplementary file giving details of supplementary materials and methods, figure legends and table legends

Supplementary Figure S2 - PDF file 84K, Phenotype of DCs following lysate-pulsing (i.e. HOCl-L, UVB-L or FTL), and activation with LPS and IFN-gamma. Unpulsed, mature (mDC) or immature DCs (iDC) served as controls. Data was presented as mean plus-minus SEM

Supplementary Table S1 - PDF file 191K, Cytokine and chemokine productions from DCs of ovarian cancer subjects that were loaded with HOCl-oxidized autologous whole tumor lysate and matured with LPS and IFN-gamma

Purpose: Chemokines are implicated in T-cell trafficking. We mapped the chemokine landscape in advanced stage ovarian cancer and characterized the expression of cognate receptors in autologous dendritic cell (DC)–vaccine primed T cells in the context of cell-based immunotherapy.Experimental Design: The expression of all known human chemokines in patients with primary ovarian cancer was analyzed on two independent microarray datasets and validated on tissue microarray. Peripheral blood T cells from five HLA-A2 patients with recurrent ovarian cancer, who previously received autologous tumor DC vaccine, underwent CD3/CD28 costimulation and expansion ex vivo. Tumor-specific T cells were identified by HER2/neu pentamer staining and were evaluated for the expression and functionality of chemokine receptors important for homing to ovarian cancer.Results: The chemokine landscape of ovarian cancer is heterogeneous with high expression of known lymphocyte-recruiting chemokines (CCL2, CCL4, and CCL5) in tumors with intraepithelial T cells, whereas CXCL10, CXCL12, and CXCL16 are expressed quasi-universally, including in tumors lacking tumor-infiltrating T cells. DC-vaccine primed T cells were found to express the cognate receptors for the above chemokines. Ex vivo CD3/CD28 costimulation and expansion of vaccine-primed Tcells upregulated CXCR3 and CXCR4, and enhanced their migration toward universally expressed chemokines in ovarian cancer.Conclusions: DC-primed tumor-specific T cells are armed with the appropriate receptors to migrate toward universal ovarian cancer chemokines, and these receptors are further upregulated by ex vivo CD3/CD28 costimulation, which render T cells more fit for migrating toward these chemokines. Clin Cancer Res; 21(12); 2840–50. ©2015 AACR.

Supplementary Materials and Methods, Supplementary Figure Legend, Supplementary Table 1. Supplementary Table 1: Cell line origin and characteristics

CD137 Supplementary Figs 1, 2 - PDF file 169K, Supplementary Figure 1. Ovarian cancer containing tumor specific reactive T cells. Supplementary Figure 2. CD137-enriched ovarian cancer TILs slow tumor growth in vivo.

Purpose: Adoptive T-cell immunotherapy with tumor infiltrating lymphocytes or genetically-modified T cells has yielded dramatic results in some cancers. However, T cells need to traffic properly into tumors to adequately exert therapeutic effects.Experimental Design: The chemokine CCL2 was highly secreted by malignant pleural mesotheliomas (MPM; a planned tumor target), but the corresponding chemokine receptor (CCR2) was minimally expressed on activated human T cells transduced with a chimeric antibody receptor (CAR) directed to the MPM tumor antigen mesothelin (mesoCAR T cells). The chemokine receptor CCR2b was thus transduced into mesoCAR T cells using a lentiviral vector, and the modified T cells were used to treat established mesothelin-expressing tumors.Results: CCR2b transduction led to CCL2-induced calcium flux and increased transmigration, as well as augmentation of in vitro T-cell killing ability. A single intravenous injection of 20 million mesoCAR + CCR2b T cells into immunodeficient mice bearing large, established tumors (without any adjunct therapy) resulted in a 12.5-fold increase in T-cell tumor infiltration by day 5 compared with mesoCAR T cells. This was associated with significantly increased antitumor activity.Conclusions: CAR T cells bearing a functional chemokine receptor can overcome the inadequate tumor localization that limits conventional CAR targeting strategies and can significantly improve antitumor efficacy in vivo. Clin Cancer Res; 17(14); 4719–30. ©2011 AACR.

Purpose: Whole tumor lysates are promising antigen sources for dendritic cell (DC) therapy as they contain many relevant immunogenic epitopes to help prevent tumor escape. Two common methods of tumor lysate preparations are freeze-thaw processing and UVB irradiation to induce necrosis and apoptosis, respectively. Hypochlorous acid (HOCl) oxidation is a new method for inducing primary necrosis and enhancing the immunogenicity of tumor cells.Experimental Design: We compared the ability of DCs to engulf three different tumor lysate preparations, produce T-helper 1 (TH1)-priming cytokines and chemokines, stimulate mixed leukocyte reactions (MLR), and finally elicit T-cell responses capable of controlling tumor growth in vivo.Results: We showed that DCs engulfed HOCl-oxidized lysate most efficiently stimulated robust MLRs, and elicited strong tumor-specific IFN-γ secretions in autologous T cells. These DCs produced the highest levels of TH1-priming cytokines and chemokines, including interleukin (IL)-12. Mice vaccinated with HOCl-oxidized ID8-ova lysate–pulsed DCs developed T-cell responses that effectively controlled tumor growth. Safety, immunogenicity of autologous DCs pulsed with HOCl-oxidized autologous tumor lysate (OCDC vaccine), clinical efficacy, and progression-free survival (PFS) were evaluated in a pilot study of five subjects with recurrent ovarian cancer. OCDC vaccination produced few grade 1 toxicities and elicited potent T-cell responses against known ovarian tumor antigens. Circulating regulatory T cells and serum IL-10 were also reduced. Two subjects experienced durable PFS of 24 months or more after OCDC.Conclusions: This is the first study showing the potential efficacy of a DC vaccine pulsed with HOCl-oxidized tumor lysate, a novel approach in preparing DC vaccine that is potentially applicable to many cancers. Clin Cancer Res; 19(17); 4801–15. ©2013 AACR.

Supplementary Figure 1. Flow cytometry analysis of vaccine-primed and CD3/CD28 costimulated T cells after chemokine-induced migration.

Purpose: Upregulation of CD137 (4-1BB) on recently activated CD8+ T cells has been used to identify rare viral or tumor antigen-specific T cells from peripheral blood. Here, we evaluated the immunobiology of CD137 in human cancer and the utility of a CD137-positive separation methodology for the identification and enrichment of fresh tumor-reactive tumor-infiltrating lymphocytes (TIL) or tumor-associated lymphocytes (TAL) from ascites for use in adoptive immunotherapy.Experimental Design: TILs from resected ovarian cancer or melanoma were measured for surface CD137 expression directly or after overnight incubation in the presence of tumor cells and homeostatic cytokines. CD137pos TILs were sorted and evaluated for antitumor activity in vitro and in vivo.Results: Fresh ovarian TILs and TALs naturally expressed higher levels of CD137 than circulating T cells. An HLA-dependent increase in CD137 expression was observed following incubation of fresh enzyme-digested tumor or ascites in IL-7 and IL-15 cytokines, but not IL-2. Enriched CD137pos TILs, but not PD-1pos or PD-1neg CD137neg cells, possessed autologous tumor reactivity in vitro and in vivo. In melanoma studies, all MART-1–specific CD8+ TILs upregulated CD137 expression after incubation with HLA-matched, MART-expressing cancer cells and antigen-specific effector function was restricted to the CD137pos subset in vitro. CD137pos TILs also mediated superior antitumor effects in vivo, compared with CD137neg TILs.Conclusions: Our findings reveal a role for the TNFR-family member CD137 in the immunobiology of human cancer where it is preferentially expressed on tumor-reactive subset of TILs, thus rationalizing its agonistic engagement in vivo and its use in TIL selection for adoptive immunotherapy trials. Clin Cancer Res; 20(1); 44–55. ©2013 AACR.

Supplementary Table - PDF file 64K, Table 1. Relative expression of CD137 and PD-1 on tumor-activated TILs

Supplementary Figure Legend - PDF file 61K, Supplementary figure legend

Supplementary Materials and Methods - PDF file 113K, Additional experimental procedures including Western Blot, Flow Cytometry, and Xenograft models