Search

Abstract Background Biodistribution of photosensitizer (PS) in photodynamic therapy (PDT) can be assessed by fluorescence imaging that visualizes the accumulation of PS in malignant tissue prior to PDT. At the same time, excitation of the PS during an assessment of its biodistribution results in premature photobleaching and can cause toxicity to healthy tissues. Combination of PS with a separate fluorescent moiety, which can be excited apart from PS activation, provides a possibility for fluorescence imaging (FI) guided delivery of PS to cancer site, followed by PDT. Results In this work, we report nanoformulations (NFs) of core–shell polymeric nanoparticles (NPs) co-loaded with PS [2-(1-hexyloxyethyl)-2-devinyl pyropheophorbide-a, HPPH] and near infrared fluorescent organic dyes (NIRFDs) that can be excited in the first or second near-infrared windows of tissue optical transparency (NIR-I, ~ 700–950 nm and NIR-II, ~ 1000–1350 nm), where HPPH does not absorb and emit. After addition to nanoparticle suspensions, PS and NIRFDs are entrapped by the nanoparticle shell of co-polymer of N-isopropylacrylamide and acrylamide [poly(NIPAM-co-AA)], while do not bind with the polystyrene (polySt) core alone. Loading of the NIRFD and PS to the NPs shell precludes aggregation of these hydrophobic molecules in water, preventing fluorescence quenching and reduction of singlet oxygen generation. Moreover, shift of the absorption of NIRFD to longer wavelengths was found to strongly reduce an efficiency of the electronic excitation energy transfer between PS and NIRFD, increasing the efficacy of PDT with PS-NIRFD combination. As a result, use of the NFs of PS and NIR-II NIRFD enables fluorescence imaging guided PDT, as it was shown by confocal microscopy and PDT of the cancer cells in vitro. In vivo studies with subcutaneously tumored mice demonstrated a possibility to image biodistribution of tumor targeted NFs both using HPPH fluorescence with conventional imaging camera sensitive in visible and NIR-I ranges (~ 400–750 nm) and imaging camera for short-wave infrared (SWIR) region (~ 1000–1700 nm), which was recently shown to be beneficial for in vivo optical imaging. Conclusions A combination of PS with fluorescence in visible and NIR-I spectral ranges and, NIR-II fluorescent dye allowed us to obtain PS nanoformulation promising for see-and-treat PDT guided with visible-NIR-SWIR fluorescence imaging.

Abstract Formation and electronic excitation energy transfer process in the nanosystem consisting of Ce0.85Tb0.15F3 nanoparticles, cetrimonium bromide (CTAB) surfactant, and chlorin e6 photosensitizer were studied. It was shown that chlorin e6 molecules bind to Ce0.85Tb0.15F3 NP in the presence of CTAB forming thus Ce0.85Tb0.15F3 NP-CTAB-chlorin e6 nanosystem. We consider that binding occurs via chlorin e6 embedding in the shell of CTAB molecules, formed around NP. In the Ce0.85Tb0.15F3 NP-CTAB-chlorin e6 nanosystem, electronic excitation energy transfer from Ce3+ to chlorin e6 takes place both directly (with the 0.33 efficiency for 2 μM chlorin e6) and via Tb3+.

Background: Biodistribution of photosensitizer (PS) in photodynamic therapy (PDT) can be assessed by fluorescence imaging that visualizes the accumulation of PS in malignant tissue prior to PDT. At the same time, excitation of the PS during an assessment of its biodistribution results in premature photobleaching and can cause toxicity to healthy tissues. Combination of PS with a separate fluorescent moiety, which can be excited apart from PS activation, provides a possibility for fluorescence imaging (FI) guided delivery of PS to cancer site, followed by PDT. Results: In this work, we report nanoformulations (NFs) of core–shell polymeric nanoparticles (NPs) co-loaded with PS [2-(1-hexyloxyethyl)-2-devinyl pyropheophorbide-a, HPPH] and near infrared fluorescent organic dyes (NIRFDs) that can be excited in the first or second near-infrared windows of tissue optical transparency (NIR-I, ~ 700–950 nm and NIR-II, ~ 1000–1350 nm), where HPPH does not absorb and emit. After addition to nanoparticle suspensions, PS and NIRFDs are entrapped by the nanoparticle shell of co-polymer of N-isopropylacrylamide and acrylamide [poly(NIPAM-co-AA)], while do not bind with the polystyrene (polySt) core alone. Loading of the NIRFD and PS to the NPs shell precludes aggregation of these hydrophobic molecules in water, preventing fluorescence quenching and reduction of singlet oxygen generation. Moreover, shift of the absorption of NIRFD to longer wavelengths was found to strongly reduce an efficiency of the electronic excitation energy transfer between PS and NIRFD, increasing the efficacy of PDT with PS-NIRFD combination. As a result, use of the NFs of PS and NIR-II NIRFD enables fluorescence imaging guided PDT, as it was shown by confocal microscopy and PDT of the cancer cells in vitro. In vivo studies with subcutaneously tumored mice demonstrated a possibility to image biodistribution of tumor targeted NFs both using HPPH fluorescence with conventional imaging camera sensitive in visible and NIR-I ranges (~ 400–750 nm) and imaging camera for short-wave infrared (SWIR) region (~ 1000–1700 nm), which was recently shown to be beneficial for in vivo optical imaging. Conclusions: A combination of PS with fluorescence in visible and NIR-I spectral ranges and, NIR-II fluorescent dye allowed us to obtain PS nanoformulation promising for see-and-treat PDT guided with visible-NIR-SWIR fluorescence imaging. [ABSTRACT FROM AUTHOR]

Europium-doped gadolinium orthovanadate nanoparticles (GdVO 4 :Eu 3+ ) were used as a donor in fluorescence resonance energy transfer (FRET) experiments in water solutions. Using Methylene Blue as an excitation energy acceptor, we have observed highly efficient FRET between GdVO 4 :Eu 3+ nanoparticles and MB. Despite the strong decrease of both the donor GdVO 4 :Eu 3+ luminescence and lifetime, the FRET-induced emission of the acceptor MB has not been observed. This feature has been explained by small fluorescence quantum yield of MB, high efficiency of the intersystem crossing and triplet state formation for MB and small amount of MB molecules bonded to the GdVO 4 :Eu 3+ nanoparticles. The long lifetime, large Stokes shift, narrow emission, X-ray excited luminescence and high FRET efficiency (∼ 90%) make GdVO 4 :Eu 3+ nanoparticles prospective as an excitation source for the photosensitizer MB activation in such applications as photodynamic therapy. [ABSTRACT FROM AUTHOR]

Formation and electronic excitation energy transfer process in the nanosystem consisting of CeTbF nanoparticles, cetrimonium bromide (CTAB) surfactant, and chlorin e photosensitizer were studied. It was shown that chlorin e molecules bind to CeTbF NP in the presence of CTAB forming thus CeTbF NP-CTAB-chlorin e nanosystem. We consider that binding occurs via chlorin e embedding in the shell of CTAB molecules, formed around NP. In the CeTbF NP-CTAB-chlorin e nanosystem, electronic excitation energy transfer from Ce to chlorin e takes place both directly (with the 0.33 efficiency for 2 μM chlorin e) and via Tb. [ABSTRACT FROM AUTHOR]

As the step to design nanosystems for X-ray excited sensitizing of singlet oxygen, nanoparticles of polystyrene and polystyrene with encapsulated 2,5-diphenyloxazole were synthesized. Binding of the photosensitizer chlorin e6molecules to both kinds of nanoparticles was shown. Excitation energy transfer from styrene chromophores of polystyrene to the bound chlorin e6molecules occurs in the case of both kinds of nanoparticles. Efficiency of the energy transfer in 2,5-diphenyloxazole-mediated case is higher (0.17) as compared to the non-mediated one (0.12). [ABSTRACT FROM AUTHOR]

Optical absorption, fluorescence and phosphorescence spectra of the telomere fragment d(AGGGTTAGGGTTAGGGTTAGGG) (Tel22) were studied and compared with those of the native DNA. Main centers of optical absorption in telomeres are A, T and G nucleic bases and G-quadruplexes. The fluorescence of telomeres is associated mainly with G-bases and other long-wave centers, possibly G-quadruplex structures, whereas their phosphorescence is associated with AT-sequences as it takes place for the native DNA. A significant increase of phosphorescence-to-fluorescence intensity ratio was observed for Tel22 as compared to DNA. Results obtained are promising for the detection of DNA macromolecules containing the extended telomeric sequences. [ABSTRACT FROM AUTHOR]

Abstract: A mixed quantum classical methodology is utilized to compute the time and frequency resolved emission spectrum of a chromophore complex dissolved in ethanol. The single complex is formed by a butanediamine dendrimer to which pheophorbide-a molecules are covalently linked. The electronic excitations are described in a Frenkel-exciton model treated quantum mechanically and all nuclear coordinates are described classically by carrying out room-temperature MD simulations. Starting with the full quantum formula for the emission spectrum, it is translated to the mixed quantum classical case and used to compute time resolved spectra up to 2ns. To account for radiative decay the chromophore complex excited-state dynamics have to be described in a density matrix theory. While the full emission spectrum only reflects excited-state decay the introduction of partial spectra allows to uncover details of excitation energy redistribution among the chromophores. [Copyright &y& Elsevier]

Abstract: Photoinduced electronic excitation energy transfer in chromophore complexes is studied by utilizing a mixed quantum classical methodology. Electronic excitations are characterized by a Frenkel-exciton model and treated quantum mechanically while all nuclear coordinates are described classically finally by carrying out room-temperature MD simulations. The theory is applied to the chromophore complex dissolved in ethanol. is formed by a butanediamine dendrimer to which four pheophorbide-a molecules have been covalently linked. The excited electronic states have to be described in an improved exciton model which accounts for charge distributions in the chromophores electronic ground and excited state. It also includes a correct description of the excitonic coupling among different chromophores based on the introduction of atomic centered transition charges. Excitation energy transfer is discussed in using adiabatic exciton states as well as a full solution of the time-dependent Schrödinger equation. To underline the effect of strong excitonic coupling emphasis is also placed on MD runs where two chromophores are positioned close together. Relations are discussed to the standard treatment of exciton dynamics in using the density matrix theory as well as by introducing rate equations based on rate expressions according to Förster. [Copyright &y& Elsevier]

The efficiency of electronic excitation energy transfer from photo-excited rhodamine 110 (Rh110, energy donor) to rhodamine B (RhB, energy acceptor) in an exhaustively deionized colloidal silica suspension has been studied. This colloidal suspension shows Bragg reflection due to the formation of colloidal crystals and the Bragg-peak wavelength is controllable by the volume fraction of the silica spheres. When the Bragg-peak wavelength matches with the fluorescence band of Rh110, a depletion was observed in the Rh110 fluorescence spectrum. This means the fluorescence of Rh110 is partially trapped due to the Bragg reflection inside the crystal lattice. In the coexistence of RhB, the enhancement of RhB fluorescence intensity was observed. These facts clearly indicate the trapped photon energy of Rh110 is efficiently transferred to RhB within the colloidal crystals. The quantitative measurements showed that the enhancement of the transfer efficiency is 20% (or slightly more) in the present experimental conditions. [ABSTRACT FROM AUTHOR]

The processes of electronic excitation energy transfer (EEET) between different types of dye molecules inserted into the matrix of a porous glass have been investigated. An extreme character of the dependence of the EEET efficiency on the size of pores has been revealed. The dependence of the fractal dimensionality of the distribution of dye molecules on the sizes of the pores has been determined. [ABSTRACT FROM AUTHOR]

Fluorescence characteristics of solid solutions of CdSe/ZnS quantum dots (donor) and organic dye 3,3′-Diethyloxadicarbocyanine iodide (acceptor) in polymethylmetacrylate films have been investigated. The fluorescence intensity increase caused by the exciting radiation at the frequency of the QD absorption has been found for the films containing both QDs and DODCI. The abrupt rise of the fluorescence polarization degree has been observed at the high-frequency edge of the radiation spectrum of these films. Possible processes (nonradiative electronic excitation energy transfer, acceptor photodegradation) accounting for the experimental dependences are also discussed. [Copyright &y& Elsevier]

The possibility of using photolytically active acceptors of the electronic excitation energy to expand the spectral sensitivity region and to perform optical recording with amplification in molecular media is considered. An analysis of image formation under energy transfer conditions described by the Perrin model is made. The possibilities of increasing the sensitivity and contrast of recording are revealed. [ABSTRACT FROM AUTHOR]

1,2-Naphthoquinone-(2)-diazo-4-sulfonic acid esters show specific photochemical behaviour and absorption characteristics, which deviate from that of 1,2-naphthoquinone-(2)-diazo-5-sulfonic acid esters. The 1,2-naphthoquinone-(2)-diazo-5/6/7-sulfonic acid esters show identical absorbance and photochemical behaviours. Bi- and trichromophoric naphthoquinone diazo derivatives (NQD) are characterized by non-reciprocity behaviour, which means that the rate of photolytic cleavage is dependent on the concentrations of the starting compound and intermediates of the photodecomposition, and quantum yields change with the progress of reaction. These interesting experimental results, namely the differences in absorption and photolytic behaviour motivated the preparation and investigation of the model compound, which contains both chromophores, NQD4 and NQD5, para to each other in a benzophenone backbone molecule. The results of kinetic investigations confirm that the exposure of this model compound at 436 nm effects a sequential photolytic mechanism. At this exposure the compound was excited mainly within the NQD5 chromophore, because the NQD4 chromosphore absorbs only slightly at 436 nm. A logical explanation for this effect is the existence of a photophysical process in which the excitation energy is transferred from a local excited NQD-5 substituent (donor) to the NQD-4 substituent (acceptor). [ABSTRACT FROM AUTHOR]

Polystyrene (PS)-diphenyloxazole (PPO) nanoparticles with attached cross-linked poly-N-isopropylacrylamide (PNIPAM) chains were obtained resulting in PS-PPO-PNIPAM hybrid nanosystems (NS). Fluorescence spectra of chlorin e6 added to PS-PPO-PNIPAM hybrid NS revealed electronic excitation energy transfer (EEET) from PS matrix and encapsulated PPO to chlorin e6. EEET efficiency increased strongly during 1 h after chlorin e6 addition, indicating that uptake of chlorin e6 by PNIPAM part of hybrid NS still proceeds during this time. Heating of PS-PPO-PNIPAM-chlorin e6 NS from 21 to 39 °C results in an enhancement of EEET efficiency; this is consistent with PNIPAM conformation transition that reduces the distance between PS-PPO donors and chlorin e6 acceptors. Meanwhile, a relatively small part of chlorin e6 present in the solution is bound by PNIPAM; thus, further studies in this direction are necessary. [ABSTRACT FROM AUTHOR]