Search

Cerebral autoregulation (CA) refers to the ability to maintain cerebral blood flow (CBF) relatively constant under the condition of systemic arterial blood pressure (ABP) fluctuation. Up to now, the research on the function of CA has a history of nearly 100 years. From animal models to noninvasive real ⁃ time human hemodynamic monitoring, progress of detecting techniques, especially the wide application of transcranial Doppler ultrasonography (TCD) and the introduction of mathematical methods have brought revolutionary changes to the study of CA. This study aims to summarize the development history of mechanism of CA and detecting techniques, and to provide reference for the related clinical study.

Objective To investigate the expression of helper T cell 17 (Th17) cells and associated cytokines in patients with myasthenia gravis (MG) and its correlations to the level of anti - acetylcholine receptor (AChR) antibodies. Methods Thirty patients with MG including 16 patients with ocular myasthenia gravis (OMG) and 14 patients with general myasthenia gravis (GMG) were enrolled in the study from September 2016 to December 2017. Flow cytometry was used to calculate the percentage of circulating Th17 cells in the peripheral blood mononuclear cell (PBMC). Real-time reverse transcription polymerase chain reaction (RT - PCR) was used to examine the expression of interleukin - 17A (IL - 17A) retinoid-related orphan receptor γ (RORγ) mRNA. Enzyme-linked immunosorbent assay (ELISA) was used to detect IL-17A, IL-6, IL-23 and anti-AChR antibodies. Results The percentage of circulating Th17 cells (t = - 3.312, P = 0.002; t = - 2.286, P = 0.030), the expression of the IL-17A level (t = - 4.282, P = 0.004; t = - 2.788, P = 0.007) and RORγ mRNA (t = 4.408, P = 0.001; t = 1.991, P = 0.049) in GMG and OMG group were higher than those in control group with statistical significance. IL-23 was also higher in the GMG group than that in the control group (t = - 2.267, P = 0.031). The percentage of Th17 and level of IL-17A were positively correlated with the anti - AChR antibodies (r = 0.851, P = 0.012; r = 0.743, P = 0.025; respectively). Conclusions The high level of Th17 cells and IL - 17A may be closely related to the etiology of MG. It must be verified in the future. [ABSTRACT FROM AUTHOR]

Objective To report the clinical phenotype and genetic characteristics of an Alexander's disease type II patient with unusual presentation, so as to extend phenotype and gene mutation spectrum of Alexander's disease type II. Methods and Results A 41-year-old male patient suffered from paroxysmal right limb stiffness for 10 years, presenting with spastic hemiparesis on right side and bilateral pyramidal tract sign. Brain MRI showed long T2 signal in bilateral medulla, bulbar-pontine junction and the upper cervical spinal cord, as well as mild demyelination in bilateral periventricular white matter. Steroid pulse therapy was invalid. Antiepileptic drugs (AEDs) were partially effective. Genetic analysis showed one heterozygous deletion of glial fibrillary acidic protein (GFAP) gene [c.del 1044-1079 GTACCAGGACCTGCTCAATGTCAAGCTGGCCCTGGA (p.E348DdelY349-D360)] in the proband and his mother. This mutation has not been reported before. The patient was clearly diagnosed as Alexander's disease type II, and his family was diagnosed as Alexander's disease type II pedigree. Conclusions The novel mutation of GFAP gene expanded the gene mutation spectrum of Alexander's disease. The clinical phenotypes of family members may be variable even in the same family. [ABSTRACT FROM AUTHOR]

Objective: To analyze the stroke subtypes and influencing factors in four largest economic regions of China., Methods: We analyzed the investigation data of QUEST (Quality Evaluation of Stroke Care and Treatment) study conducted in 2006 which included 62 hospitals in a national scale. According to the concept of four economic regions designed by the Development Research Center of the State Council, we performed the univariate and multivariate analysis for the stroke subtypes and its related risk factors in the different economic regions., Results: There were 3362 (73.5%) ischemic stroke patients and 1214 (26.5%) hemorrhagic stroke patients among the total 4576 first-ever stroke patients. Comparison of stroke subtypes in the four different economic regions was statistically significant (P < 0.001), with a percentage of 80.8% ischemic stroke patients in the northeastern region, 78.9% in the eastern region, 68.3% in the central region and 67.0% in the western region. The comparisons of risk factors such as history of hypertension, diabetes, hyperlipidaemia, coronary artery event, atrial fibrillation, and overweight in the four different economic regions were also statistically significant (P < 0.05)., Conclusions: The subtypes of first-ever stroke vary in the four largest economic regions with a highest proportion of ischemic stroke in the northeastern region and relatively high proportion of hemorrhagic stroke in the central and western economic regions. There are also discrepancies of stroke risk factors in the different economic regions.