Search

Introduction. Bronchial asthma is a common disease characterized by chronic inflammation of the airways. Paediatric asthma is still a current problem and children with exacerbation frequently are hospitalized. The aim of the study was to determine the prevalence of allergic and non-allergic asthma in children hospitalized at the Department of Paediatric Pulmonology and Rheumatology of the University Children’s Hospital in Lublin in 2016-2020, and to analyze the most common allergens associated with allergic asthma. Materials and methods. The study group consisted of 667 patients, aged 6 to 215 months (average 64 months). The data collected for this retrospective study includes: gender, age, month, quarter of year, and year of hospitalization, type of asthma and type of allergens. Results. We observed a decrease of hospitalization in the analyzed years: in 2016 – 160 children, and in 2020 – 74. Children with allergic asthma (375 children) were more frequently hospitalized than patients with non-allergic asthma, and we found correlations between age and type of asthma and between age and type of allergy. Non-allergic asthma was observed in the youngest children, while in older children, allergic-asthma dominated. We also observed significant differences in children’s hospitalization depending on the season of the year. The most frequent allergen causing asthma was house dust mites. Conclusions. The incidence of hospitalizations caused by asthma exacerbation is declining. Among the youngest population, exacerbations of asthma related to respiratory tract infection predominate, while in the older, allergy to inhalation allergens is the main cause.

Adoptive transfer of T cells engineered to express chimeric immunoreceptors is an effective strategy to treat hematologic cancers; however, the use of this type of therapy for solid cancers, such as ovarian cancer, remains challenging because a safe and effective immunotherapeutic target has not yet been identified. Here, we constructed and evaluated a novel redirected T-cell–based immunotherapy targeting human follicle-stimulating hormone receptor (FSHR), a highly conserved molecule in vertebrate animals with expression limited to gonadal tissues, ovarian cancer, and cancer-associated vasculature. Receptor ligand–based anti-FSHR immunoreceptors were constructed that contained small binding fragments from the ligand for FSHR, FSH, fused to T-cell transmembrane and T-cell signaling domains. Human T cells transduced to express anti-FSHR immunoreceptors were specifically immunoreactive against FSHR-expressing human and mouse ovarian cancer cell lines in an MHC-nonrestricted manner and mediated effective lysis of FHSR-expressing tumor cells, but not FSHR-deficient targets, in vitro. Similarly, the outgrowth of human ovarian cancer xenografts in immunodeficient mice was significantly inhibited by the adoptive transfer of FSHR-redirected T cells. Our experimental observations show that FSHR is a promising immunotherapeutic target for ovarian cancer and support further exploration of FSHR-targeted immune therapy approaches for patients with cancer. Cancer Immunol Res; 3(10); 1130–7. ©2015 AACR.

The expression of 18S used as a internal control (housekeeper). cDNA was constructed from total RNA isolated from 10e5 cells (cultured at 60-70% confluence). PCR performed using intron-spanning primers. Validation criteria included water blanks, and NO RT samples. For human 18SrRNA 5’CAGCCACCCGAGATTGAGCA3’ and Rev: 5’TAGTAGCGACGGGCGGTGTG3’ (amplicon 253bp) (Genbank:: NR_003286.2). For mouse ID8 cell line Ribosomal RNA for mouse Eukaryotic small ribosomal subunit [Genbank: NR_003278] primers Fw: 5’AGGGGAGAGCGGGTAAGAGA-3’ and Rev: 5’GGACAGGACTAGGCGGAACA3’ were used (amplicon size of 249bp).

Supplementary Figure Legend from Follicle-Stimulating Hormone Receptor as a Target in the Redirected T-cell Therapy for Cancer

PDF file - 113K, Flow Cytometry analysis of an antigen surface expression on mouse AE17 cell lines transduced to express human FR�� or mesothelin and human ovarian cancer cell line, A1847. FR��-specific mAb Mov18, EpCAM-specific and mesothelin-specific K1 antibody and P4 Biobody were used to measure antigen expression on tumor cell lines (open empty histogram), compared to a matched isotype Ab control (filled gray histogram). Numbers within plots refer to specific mean fluorescent intensity (MFI).

PDF file - 21K, BBIR-z T cells loaded with biotinylated molecules and then washed do not produce IFN�� in response to specific antigen stimulation. Following 45min incubation at 37oC with 1ug/ml of mesothelin specific biotinylated antybodies; P4 Biobody or K1 and control Bio-IgG1 antibody, BBIR-z T cells were washed with PBS and tested against plate-immobilized human mesothelin (105 cells/10ng mesothelin/well). After overnight incubation, culture supernatants were analyzed for human IFN�^ cytokine by ELISA. Concentration of IFN�� is expressed in pg/ml (means �� SEM; n = 3).

PDF file - 67K, Upper. CD28 co-stimulation protects against antigen-induced cell death. Annexin V and 7-AAD staining of T cells (untransduced, BBIR-z and BBIR-28z) following 72 h (grey bars) and 96 h (black bars) co-culture with A1847 at an E:T ratio 1:1, painted with either Bio-IgG1 or Bio-EpCAM antibodies. Apoptosis was quantified as a percentages of apoptotic cells- Annexin V+ and 7AAD+ (means �� SEM; n = 3). Lower. Annexin V/7-AAD assay plots showing T cells after 96 h co-culture with A1847 cell line labeled with biotinylated IgG1 (Bio-IgG1) (top panels) and biotinylated EpCAM specific (Bio-EpCAM) antybodies, at an E:T ratio of 1:1. One representative FACS analysis is shown (n=3).

EGNOS is the first generation satellite navigation system developed in Europe. The Implementation phase started in 1999 and the entry into Safety Of Life operations has been declared in 2011. It has been designed for stringent Civil Aviation operations (up to Precision Approach Category 1) which are guaranteed all over the EU and is compliant to the International ICAO Standards. The system concept corresponds to the SBAS (defined by ICAO), standing for Satellite Based Augmentation Systems. It is based on a ground segment augmenting existing GNSS signals and delivering to the end users in quasi real time, a very reliable set of corrections, then improving the accuracy and the integrity of the positioning. EGNOS is the second system of a worldwide family of similar regional systems of other regions of the world (North America, Japan, India, South Korea, China, etc…). As these systems have to be designed, qualified, operated and maintained in full interoperability with the others of the same family, an international working group called SBAS Interoperability Working Group was created in 1997 by the US FAA and ESA, which has grown since 1997, now gathering more than 10 SBAS Development Agencies / Service Providers. This paper, in its first part, will provide a detailed update on the status, organisation and main achievements of this International SBAS Interoperability Working Group, and in particular, present the status of the Global SBAS project combining all SBAS development and modernization projects around the world, for an objective to offer a quasi-global coverage of the SBAS services. At European level, for EGNOS, the Implementation Phase of the second generation of EGNOS called EGNOS V3 has started (January 2018). EGNOS V3 is designed to augment, not only the GPS L1 signals but new signals from both GPS and Galileo in dual frequency L1 and L5, and will then offer significantly enhanced services. The paper will present in its second part the benefits expected from EGNOS V3 and the on-going R&D activities to prepare the future evolutions (post EGNOS V3) addressing, in particular, services outside Aviation.

Peripheral T cell lymphomas (PTCLs) are generally chemotherapy resistant and have a poor prognosis. The lack of targeted immunotherapeutic approaches for T cell malignancies results in part from potential risks associated with targeting broadly expressed T cell markers, namely T cell depletion and clinically significant immune compromise. The knowledge that the T cell receptor (TCR) &beta, chain in human &alpha, /&beta, TCRs are grouped into V&beta, families that can each be targeted by a monoclonal antibody can therefore be exploited for therapeutic purposes. Here, we develop a flexible approach for targeting TCR V&beta, families by engineering T cells to express a chimeric CD64 protein that acts as a high affinity immune receptor (IR). We found that CD64 IR-modified T cells can be redirected with precision to T cell targets expressing selected V&beta, families by combining CD64 IR-modified T cells with a monoclonal antibody directed toward a specific TCR V&beta, family in vitro and in vivo. These findings provide proof of concept that TCR V&beta, family-specific T cell lysis can be achieved using this novel combination cell&ndash, antibody platform and illuminates a path toward high precision targeting of T cell malignancies without substantial immune compromise.

Tuberous sclerosis complex (TSC) represents a genetic condition, in which the clinical manifestations are caused by the disinhibition of the mammalian target of rapamycin (mTOR) pathway due to mutations in the TSC1 (hamartin) or TSC2 (tuberin) genes. The deregulated mTOR activity leads to multi-site tumors, including subependymal giant cell astrocytoma (SEGA). SEGA is a brain tumor that affects around 15% of TSC patients. The aim of the study was to evaluate miR-21 expression in the serum of two groups of TSC patients: with or without SEGA tumors. We found no differences in the level of miR-21 depending on the presence of SEGA. Next, we studied the influence of prolonged rapamycin administration on miR-21 level in the blood serum of TSC patients (6-12 months of rapamycin) and in primary cultures of SEGA-derived cells treated with rapamycin in vitro . Here we show that rapamycin treatment leads to the upregulation of miR-21 in both patients’ serum and in primary SEGA tumor cells in the culture indicating the regulatory relationship between rapamycin treatment and miR-21 expression.

Background: Peripheral T-cell lymphomas (PTCL) encompass a highly heterogeneous group of T-cell malignancies and are generally associated with a poor prognosis. Combination chemotherapy results in consistently poorer outcomes for T-cell lymphomas compared with B-cell lymphomas.1 There is an urgent clinical need to develop novel approaches to treatment of PTCL. While CD19- and CD20-directed immunotherapies have been successful in the treatment of B-cell malignancies, T-cell malignancies lack suitable immunotherapeutic targets. Brentuximab Vedotin, a CD30 antibody-drug conjugate, is not applicable to PTCL subtypes which do not express CD30.2 Broadly targeting pan-T cell markers is predicted to result in extensive T-cell depletion and clinically significant immune deficiency; therefore, a more tumor-specific antigen that primarily targets the malignant T-cell clone is needed. We reasoned that since malignant T cells are clonal and express the same T-cell receptor (TCR) in a given patient, and since the TCR β chain in human α/β TCRs can be grouped into 24 functional Vβ families targetable by monoclonal antibodies, immunotherapeutic targeting of TCR Vβ families would be an attractive strategy for the treatment of T-cell malignancies. Methods: We developed a flexible approach for targeting TCR Vβ families by engineering T cells to express a CD64 chimeric immune receptor (CD64-CIR), comprising a CD3ζ T cell signaling endodomain, CD28 costimulatory domain, and the high-affinity Fc gamma receptor I, CD64. T cells expressing CD64-CIR are predicted to be directed to tumor cells by Vβ-specific monoclonal antibodies that target tumor cell TCR, leading to T cell activation and induction of tumor cell death by T cell-mediated cytotoxicity. Results: This concept was first evaluated in vitro using cell lines. SupT1 T-cell lymphoblasts, which do not express a native functioning TCR, were stably transduced to express a Vβ12+ MART-1 specific TCR, resulting in a Vβ12 TCR expressing target T cell line.3 Vβ family specific cytolysis was confirmed by chromium release assays using co-culture of CD64 CIR transduced T cells with the engineered SupT1-Vβ12 cell line in the presence of Vβ12 monoclonal antibody. Percent specific lysis was calculated as (experimental - spontaneous lysis / maximal - spontaneous lysis) x 100. Controls using no antibody, Vβ8 antibody, and untransduced T cells did not show significant cytolysis (figure A). Next, the Jurkat T cell leukemic cell line, which expresses a native Vβ8 TCR, was used as targets in co-culture. Again, Vβ family target specific cytolysis was achieved in the presence of CD64 CIR T cells and Vβ8, but not Vβ12 control antibody. Having demonstrated Vβ family specific cytolysis in vitro using target T cell lines, we next evaluated TCR Vβ family targeting in vivo. Immunodeficient mice were injected with SupT1-Vβ12 or Jurkat T cells with the appropriate targeting Vβ antibody, and either CD64 CIR T cells or control untransduced T cells. The cell lines were transfected with firefly luciferase and tumor growth was measured by bioluminescence. The CD64 CIR T cells, but not untransduced T cells, in conjunction with the appropriate Vβ antibody, successfully controlled tumor growth (figure B). Our results provide proof-of-concept that TCR Vβ family specific T cell-mediated cytolysis is feasible, and informs the development of novel immunotherapies that target TCR Vβ families in T-cell malignancies. Unlike approaches that target pan-T cell antigens, this approach is not expected to cause substantial immune deficiency and could lead to a significant advance in the treatment of T-cell malignancies including PTCL. References 1. Coiffier B, Brousse N, Peuchmaur M, et al. Peripheral T-cell lymphomas have a worse prognosis than B-cell lymphomas: a prospective study of 361 immunophenotyped patients treated with the LNH-84 regimen. The GELA (Groupe d'Etude des Lymphomes Agressives). Ann Oncol Off J Eur Soc Med Oncol. 1990;1(1):45-50. 2. Horwitz SM, Advani RH, Bartlett NL, et al. Objective responses in relapsed T-cell lymphomas with single agent brentuximab vedotin. Blood. 2014;123(20):3095-3100. 3. Hughes MS, Yu YYL, Dudley ME, et al. Transfer of a TCR Gene Derived from a Patient with a Marked Antitumor Response Conveys Highly Active T-Cell Effector Functions. Hum Gene Ther. 2005;16(4):457-472. Figure Disclosures Schuster: Novartis, Genentech, Inc./ F. Hoffmann-La Roche: Research Funding; AlloGene, AstraZeneca, BeiGene, Genentech, Inc./ F. Hoffmann-La Roche, Juno/Celgene, Loxo Oncology, Nordic Nanovector, Novartis, Tessa Therapeutics: Consultancy, Honoraria.

The "New Integrity SBAS Test Bed" (NISTB) testbed is an end-to-end SBAS simulator capable of processing synthetic and real data recorded by regional and global ground station networks. The testbed supports the provision of Single-Frequency (SF) as well as Dual-Frequency (DF) SBAS Services exploiting the GPS and Galileo data. The output of the testbed is SBAS data stream following the Single-Frequency MOPS ICD, respectively the Dual-Frequency Multi-Constellation (DFMC) SBAS ICD. The performances of the generated SBAS Services are assessed with the Performance Assessment Tools (PAT) which was also developed in the scope of the NISTB project. This paper focusses on demonstrations of DFMC SBAS Service performances generated with the NISTB testbed on the basis of real observation data for GPS and GPS+GAL recorded by the operational EGNOS V2 (EV2) RIMS and the Galileo GESS network, respectively. The achieved results are compared with each other and against the GPS SF (Legacy) Service broadcast by the operational EV2 system which was post-processed in the project. Thus, the results allow for comparing the SBAS performances of SF and DFMC Services (GPS SF Service vs. GPS DF Service on the basis of the EV2 ground station network), DFMC SBAS performances using different network geometries (EV2 ground station network vs. GESS ground station network for GPS DF Services) and different space segments (GPS vs. GPS+GAL Dual-Frequency Services on the basis of the GESS ground station network). The NISTB testbed results clearly confirm the benefit in service performance of the Dual-Frequency SBAS Service over the Single-Frequency Legacy SBAS Service in terms of service availability and continuity extending to much larger regions. On the level of accuracy, it can be observed that, in the presence of calm ionospheric conditions, a better positioning accuracy is still achieved in case of the Single-Frequency SBAS Service. This is due to the increase of noise and multipath effects when using dual-frequency measurements (i.e. iono-free linear combination of signals) at user level in case of DFMC services. However, it is noted that all SBAS services studied with NISTB, both the DFMC Services as well as the EV2 broadcast Legacy Service, are compliant with the positioning accuracy targets of the applicable service.

Adoptive transfer of T cells engineered to express chimeric immunoreceptors is an effective strategy to treat hematologic cancers; however, the use of this type of therapy for solid cancers, such as ovarian cancer, remains challenging because a safe and effective immunotherapeutic target has not yet been identified. Here, we constructed and evaluated a novel redirected T-cell–based immunotherapy targeting human follicle-stimulating hormone receptor (FSHR), a highly conserved molecule in vertebrate animals with expression limited to gonadal tissues, ovarian cancer, and cancer-associated vasculature. Receptor ligand–based anti-FSHR immunoreceptors were constructed that contained small binding fragments from the ligand for FSHR, FSH, fused to T-cell transmembrane and T-cell signaling domains. Human T cells transduced to express anti-FSHR immunoreceptors were specifically immunoreactive against FSHR-expressing human and mouse ovarian cancer cell lines in an MHC-nonrestricted manner and mediated effective lysis of FHSR-expressing tumor cells, but not FSHR-deficient targets, in vitro. Similarly, the outgrowth of human ovarian cancer xenografts in immunodeficient mice was significantly inhibited by the adoptive transfer of FSHR-redirected T cells. Our experimental observations show that FSHR is a promising immunotherapeutic target for ovarian cancer and support further exploration of FSHR-targeted immune therapy approaches for patients with cancer. Cancer Immunol Res; 3(10); 1130–7. ©2015 AACR.

Despite recent advances in targeted therapies, epithelial ovarian cancer (EOC) remains the most lethal form of gynecologic malignancy. Thus, improving the clinical outcome of patients will require reinvestment in research development and further clinical investigation. T-cell accumulation in EOC is prognostic for survival and recent advances in adoptive T-cell therapy now provide a renewed opportunity to specifically modulate T-cell number and activity in EOC and mediate tumor regression. Here, we discuss the application of adoptive T-cell transfer based immunotherapy and its prospects for the treatment of EOC.

Neuroligins (NLGNs) are cell adhesion molecules located on the postsynaptic side of the synapse that interact with their presynaptic partners neurexins to maintain trans-synaptic connection. Fragile X syndrome (FXS) is a common neurodevelopmental disease that often co-occurs with autism and is caused by the lack of fragile X mental retardation protein (FMRP) expression. To gain an insight into the molecular interactions between the autism-related genes, we sought to determine whether FMRP controls the synaptic levels of NLGNs. We show evidences that FMRP associates with Nlgn1, Nlgn2, and Nlgn3 mRNAs in vitro in both synaptoneurosomes and neuronal cultures. Next, we confirm local translation of Nlgn1, Nlgn2, and Nlgn3 mRNAs to be synaptically regulated by FMRP. As a consequence of elevated Nlgns mRNA translation Fmr1 KO mice exhibit increased incorporation of NLGN1 and NLGN3 into the postsynaptic membrane. Finally, we show that neuroligins synaptic level is precisely and dynamically regulated by their rapid proteolytic cleavage upon NMDA receptor stimulation in both wild type and Fmr1 KO mice. In aggregate, our study provides a novel approach to understand the molecular basis of FXS by linking the dysregulated synaptic expression of NLGNs with FMRP.

Anti-neoplastic potential of calorie restriction or ligand-induced activation of peroxisome proliferator activated receptors (PPARs) has been demonstrated in multiple studies; however, mechanism(s) by which tumor cells respond to these stimuli remain to be elucidated. One of the potent agonists of PPARα, fenofibrate, is a commonly used lipid-lowering drug with low systemic toxicity. Fenofibrate-induced PPARα transcriptional activity is expected to shift energy metabolism from glycolysis to fatty acid β-oxidation, which in the long-term, could target weak metabolic points of glycolysis-dependent glioblastoma cells. The results of this study demonstrate that 25 μM fenofibrate can effectively repress malignant growth of primary glial tumor cells and glioblastoma cell lines. This cytostatic action involves G1 arrest accompanied by only a marginal level of apoptotic cell death. Although the cells treated with 25 μM fenofibrate remain arrested, the cells treated with 50 μM fenofibrate undergo massive apoptosis, which starts after 72 h of the treatment. This delayed apoptotic event was preceded by FoxO3A nuclear accumulation, FoxO3A phosphorylation on serine residue 413, its elevated transcriptional activity and expression of FoxO-dependent apoptotic protein, Bim. siRNA-mediated inhibition of FoxO3A attenuated fenofibrate-induced apoptosis, indicating a direct involvement of this transcription factor in the fenofibrate action against glioblastoma. These properties of fenofibrate, coupled with its low systemic toxicity, make it a good candidate in support of conventional therapies against glial tumors.

The Insulin-like Growth Factor-1 Receptor (IGF-IR) and the human polyomavirus JCV protein, T-Antigen cooperate in the transformation of neuronal precursors in the cerebellum, which may be a contributing factor in the development of brain tumors. Since it is not clear why T-Antigen requires IGF-IR for transformation, we investigated this process in neural progenitors from IGF-IR knockout embryos (ko-IGF-IR) and from their wild type non-transgenic littermates (wt-IGF-IR). In contrast to wt-IGF-IR, the brain and dorsal root ganglia of ko-IGF-IR embryos showed low levels of the anti-apoptotic protein Survivin, accompanied by elevated numbers of apoptotic neurons and an earlier differentiation phenotype. In wt-IGF-IR neural progenitors in vitro, induction of T-Antigen expression tripled the expression of Survivin, and accelerated cell proliferation. In ko-IGF-IR progenitors induction of T-Antigen failed to increase Survivin, resulting in massive apoptosis. Importantly, ectopic expression of Survivin protected ko-IGF-IR progenitor cells from apoptosis and siRNA inhibition of Survivin activated apoptosis in wt-IGF-IR progenitors expressing T-Antigen. Our results indicate that reactivation of the anti-apoptotic Survivin may be a critical step in JCV T-Antigen induced transformation, which in neural progenitors requires IGF-IR.

Insulin receptor substrate 1 (IRS-1) is a 160 kDa cytosolic protein implicated in insulin receptor and IGF-I receptor (IGF-IR) signaling (Baskin et al., 1994; Myers et al., 1994). Besides its metabolic and growth promoting function, IRS-1 is suspected to play a role in malignant transformation, presumably by amplifying the IGF-IR signal. The first convincing evidence indicating the transforming potential of IRS-1 was demonstrated in R− cells, which are mouse embryo fibroblasts from mice with targeted disruption of the IGF-IR gene. R− cells, which are resistant to SV40 T-antigen-mediated transformation, acquired a transformed phenotype following co-transfection with IRS-1 and T-antigen containing expression vectors (Sell et al., 1993; D’Ambrosio et al., 1995). In a similar manner, T-antigen from human polyomavirus JC (JCV T-antigen) also required the presence of the IGF-IR-IRS-1 signaling axis for transformation (Del Valle et al., 2002b). Interestingly, we have found nuclear IRS-1 in cells expressing JCV T-antigen, and in JCV T-antigen positive medulloblastoma clinical samples (Del Valle et al., 2002b; Lassak et al., 2002; Trojanek et al., 2006a). This first demonstration of nuclear IRS-1 was further confirmed by others. For example, nuclear IRS-1 has been found in cells transfected with v-src and SV40 T-antigen (Prisco et al., 2002; Tu et al., 2002, 2003), in fibroblasts stimulated with IGF-I (Prisco et al., 2002), in hepatocytes (Boylan and Gruppuso, 2002), in 32D cells (Tu et al., 2003), and in osteoblasts (Seol and Kim, 2003). More recently, nuclear IRS-1 was detected in breast cancer cells in association with estrogen receptor alpha (ERα) (Morelli et al., 2004). Although the mechanism by which IRS-1 is translocated to the nucleus is not well established, it could utilize its own putative nuclear localization signal (Tu et al., 2002). On the other hand, the abundant presence of nuclear IRS-1 in cells expressing proteins with high affinity to the nucleus, such as JCV T-antigen, SV40 T-antigen and ERα, may indicate that IRS-1 requires a chaperone for efficient nuclear translocation. The biological relevance of nuclear IRS-1 has been studied extensively during last several years. In fibroblasts stimulated with IGF-I, nuclear IRS-1 has been found in association with upstream binding factor (UBF1—regulator of RNA polymerase I), which coincided with increased rRNA synthesis (Drakas et al., 2004). In addition, a direct connection between IRS-1 and homologous recombination dependent DNA repair (HRR) has recently been postulated (Trojanek et al., 2003). This new signaling interaction involves perinuclear binding between hypo-phosphorylated IRS-1 and the major enzymatic component of HRR, Rad51. IGF-I-mediated IRS-1 tyrosine phosphorylation attenuated IRS-1 binding to Rad51 allowing efficient translocation of Rad51 to the sites of damaged DNA, which lead to the increased contribution of HRR in DNA repair of double strand breaks. In JCV T-antigen positive cells however, IRS-1 translocates to the nucleus, where it has been found in a complex with Rad51 (Trojanek et al., 2006a,c). Since the nuclear presence of IRS-1 was also demonstrated in the absence of T-antigen, in ERα positive breast cancer cells (Morelli et al., 2004), we asked whether ER-mediated IRS-1 nuclear translocation could inhibit HRR in medulloblastoma tumors, which are JCV negative. This could be quite relevant for medulloblastoma, since we have detected constitutively active ERβ in all medulloblastoma cell lines examined, and in over 30% of medulloblastoma clinical samples. The results presented in this report indicate the involvement of ERβ in the inhibition of the faithful component of DNA repair, HRR. The suspected mechanism involves the formation of an ERβ–IRS-1 complex in the nucleus, nuclear interaction between IRS-1 and Rad51, and the inhibition of HRR. This could represent the major driving mechanism for genomic instability and the development of mutagenic phenotype after genotoxic treatment, which may act independently or in synergy with JC polyomavirus large T-antigen.

Nbs1, a member of the Mre11-RAD50-Nbs1 complex, is phosphorylated by ATM, the product of the ataxia-telangiectasia mutated gene and a member of the phosphatidylinositol 3-kinase–related family of serine-threonine kinases, in response to DNA double-strand breaks (DSBs) to regulate DNA damage checkpoints. Here we show that BCR/ABL stimulated Nbs1 expression by induction of c-Myc–dependent transactivation and protection from caspase-dependent degradation. BCR/ABL-related fusion tyrosine kinases (FTKs) such as TEL/JAK2, TEL/PDGFβR, TEL/ABL, TEL/TRKC, BCR/FGFR1, and NPM/ALK as well as interleukin 3 (IL-3), granulocyte-macrophage colony-stimulating factor (GM-CSF), and stem cell factor (SCF) also stimulated Nbs1 expression. Enhanced ATM kinase–dependent phosphorylation of Nbs1 on serine 343 (S343) in response to genotoxic treatment was detected in leukemia cells expressing BCR/ABL and other FTKs in comparison to normal counterparts stimulated with IL-3, GM-CSF, and SCF. Expression of Nbs1-S343A mutant disrupted the intra–S-phase checkpoint, decreased homologous recombinational repair (HRR) activity, down-regulated XIAP expression, and sensitized BCR/ABL-positive cells to cytotoxic drugs. Interestingly, inhibition of Nbs1 phosphorylation by S343A mutant enhanced the antileukemia effect of the combination of imatinib and genotoxic agent.

Progressive multifocal leukoencephalopathy (PML) is a fatal demyelinating disease of the central nervous system resulting from the productive infection of oligodendrocytes by the opportunistic polyomavirus JC virus (JCV). Apoptosis is a host defense mechanism to dispose of damaged cells; however, certain viruses have the ability to deregulate apoptotic pathways to complete their life cycles. One such pathway involves survivin, a member of the inhibitor of apoptosis family, which is abundantly expressed during development in proliferating tissues but should be absent in normal, terminally differentiated cells. Immunohistochemistry performed in 20 cases of PML revealed the presence of survivin in JCV-infected oligodendrocytes and bizarre astrocytes within demyelinated plaques. Survivin up-regulation was also found in oligodendroglial and astrocytic cultures infected with JCV. Cell cycle analysis and DNA laddering demonstrated a significantly lower number of cells undergoing apoptosis on JCV infection compared with noninfected cultures; small interfering RNA inhibition of survivin resulted in a dramatic increase in apoptotic cells in JCV-infected cultures. This is the first report describing the activation of survivin by JCV infection in vitro and in PML clinical cases. These observations provide new insights into the anti-apoptotic mechanisms used by JCV to complete its lytic cycle and may suggest new therapeutic targets for PML.

We have previously reported that insulin-like growth factor-I (IGF-I) supports growth and survival of mouse and human medulloblastoma cell lines, and that IGF-I receptor (IGF-IR) is constitutively phosphorylated in human medulloblastoma clinical samples. Here, we demonstrate that a specific inhibitor of insulin-like growth factor-I receptor (IGF-IR), NVP-AEW541, attenuated growth and survival of mouse (BsB8) and human (D384, Daoy) medulloblastoma cell lines. Cell cycle analysis demonstrated that G1 arrest and apoptosis contributed to the action of NVP-AEW54. Interestingly, very aggressive BsB8 cells, which derive from cerebellar tumors of transgenic mice expressing viral oncoprotein (large T-antigen from human polyomavirus JC) became much more sensitive to NVP-AEW541 when exposed to anchorage-independent culture conditions. This high sensitivity to NVP-AEW54 in suspension was accompanied by the loss of GSK-3beta constitutive phosphorylation and was independent from T-antigen-mediated cellular events (Supplementary Materials). BsB8 cells were partially rescued from NVP-AEW541 by GSK3beta inhibitor, lithium chloride and were sensitized by GSK3beta activator, sodium nitroprusside (SNP). Importantly, human medulloblastoma cells, D384, which demonstrated partial resistance to NVP-AEW541 in suspension cultures, become much more sensitive following SNP-mediated GSK3beta dephosphorylation (activation). Our results indicate that hypersensitivity of medulloblastoma cells in anchorage-independence is linked to GSK-3beta activity and suggest that pharmacological intervention against IGF-IR with simultaneous activation of GSK3beta could be highly effective against medulloblastomas, which have intrinsic ability of disseminating the CNS via cerebrospinal fluid.

Background Redirection of T lymphocytes against tumor antigens can induce dramatic regression of advanced stage malignancy. The use of bispecific antibodies (BsAbs) that bind both the T-cell receptor (TCR) and a target antigen is one promising approach to T-cell redirection. However, BsAbs indiscriminately bind all CD3+ T-cells and trigger TCR activation in the absence of parallel costimulatory signals required to overcome T-cell unresponsiveness or anergy. Methods To address these limitations, a combination platform was designed wherein a unique BsAb referred to as frBsAb exclusively engages T-cells engineered to express a novel chimeric receptor comprised of extracellular folate receptor fused to intracellular TCR and CD28 costimulatory signaling domains in tandem; a BsAb-binding immune receptor (BsAb-IR). As a surrogate TCR, the BsAb-IR allows for concomitant TCR and costimulatory signaling exclusively in transduced T-cells upon engagement with specific frBsAbs, and can therefore redirect T-cells on command to desired antigen. Human primary T-cells were transduced with lentiviral vector and expanded for 14–18 days. BsAb-IRs were harvested and armed with frBsAbs to test for redirected cytotoxicity against CD20 positive cancer cell lines. Results Using frBsAbs specific for CD20 or HER2, the lytic activity of primary human T-cells expressing the BsAb-IR was specifically redirected against CD20+ leukemic cells or HER2+ epithelial cancer cells, respectively, while non-engineered T-cells were not activated. Notably, elimination of the CD28 costimulatory domain from the BsAb-IR construct significantly reduced frBsAb-redirected antitumor responses, confirming that frBsAbs are capable of delivering simultaneous TCR activation and costimulatory signals to BsAb-IR T-cells. Conclusion In summary, our results establish the proof of concept that the combination of BsAbs with optimized gene-engineered T-cells provides the opportunity to specify and augment tumor antigen-specific T-cell activation and may improve upon the early success of conventional BsAbs in cancer immunotherapy. Electronic supplementary material The online version of this article (doi:10.1186/s12967-014-0347-2) contains supplementary material, which is available to authorized users.

Adoptive transfer of T-cells engineered to express chimeric immune receptors is an effective strategy to treat hematological cancers, however, such therapy for solid cancers such as ovarian cancer remains challenging because a safe and effective immunotherapeutic target has not yet been identified. Here, we constructed and evaluated a novel redirected T-cell-based immunotherapy targeting human follicle-stimulating hormone receptor (FSHR), a highly conserved molecule in vertebrate animals with expression limited to gonadal tissues, ovarian cancer and cancer-associated vasculature. Receptor ligand-based anti-FSHR immune receptors were constructed that contained small binding fragments from the ligand for FSHR, follicle stimulating hormone (FSH), fused to T-cell transmembrane and T-cell signaling domains. Human T-cells transduced to express anti-FSHR immune receptors were specifically immunoreactive against FSHR-expressing human and mouse ovarian cancer cell lines in a MHC-non-restricted manner, and produced more than one Th1 type of proinflammatory cytokine. This observation is of special interest, as it provides the opportunity to address potential, but unpredicted, toxicity issues associated with targeting of FSHR in preclinical in vivo studies. Moreover, anti-FSHR-IR T-cells specifically upregulated surface expression of the activation marker CD69 in the presence of FSHR positive targets, but not FSHR-deficient the 293T cell line. Additionally, specific activation of anti-FSHR-IR T-cells by FSHR expressed on tumor cell surface led to efficient tumor cell killing in vitro. Furthermore, to assess the anti-tumor effect of anti-FSHR T-cells, we established human OvCa xenografts in NSG mice by subcutaneous flank injection of CaOV3 cancer cell line followed by two intravenous redirected T-cell administrations. As shown by caliper measurements, FSHR-redirected T-cells elicited anti-tumor potential with suppressed outgrowth of established tumor. Tumor growth was statistically reduced in comparison to control, GFP engineered T-cell treated group or PBS treated animals. These data suggest that systemic delivery of anti-FSHR T-cells to mice bearing FSHR-expressing tumors may result in tumor trafficking, activation, and lysis at location of tumor.In summary, we have successfully exploited for the first time a novel therapeutic antigen, the FSHR protein, expressed on tumor cell surface, to deliver T-cell based immune-therapy of cancer. Given its highly restricted expression in cancer, cancer-associated vessels and gonadal tissues, the rationale for FSHR targeting is strong and supports further exploration of FSHR-targeted immune therapy approaches for cancer patients.

This paper presents the SPRING simulator which is currently under development. SPRING is a tool dedicated to the assessment of the performances of a receiver, taking into account its environment.

Chimeric antigen receptors (CARs) possess fixed specificity for a single antigen and require empirical testing in T cells. To address this, we have developed a novel, adaptable immune receptor strategy that allows for the rapid generation and testing of T cells of nearly infinite antigen specificity.

Adoptive immunotherapies composed of T cells engineered to express a chimeric antigen receptor (CAR) offer an attractive strategy for treatment of human cancer. However, CARs have a fixed antigen specificity such that only one tumor-associated antigen (TAA) can be targeted, limiting the efficacy that can be achieved because of heterogeneous TAA expression. For this reason, a more generalized and effective application of CAR therapy would benefit from the capability to produce large panels of CARs against many known TAAs. In this study, we show a novel strategy to extend the recognition specificity potential of a bioengineered lymphocyte population, allowing flexible approaches to redirect T cells against various TAAs. Our strategy employs a biotin-binding immune receptor (BBIR) composed of an extracellular-modified avidin linked to an intracellular T-cell signaling domain. BBIR T cells recognized and bound exclusively to cancer cells pretargeted with specific biotinylated molecules. The versatility afforded by BBIRs permitted sequential or simultaneous targeting of a combination of distinct antigens. Together, our findings show that a platform of universal T-cell specificity can significantly extend conventional CAR approaches, permitting the tailored generation of T cells of unlimited antigen specificity for improving the effectiveness of adoptive T-cell immunotherapies for cancer. Cancer Res; 72(7); 1844–52. ©2012 AACR.

In HIV patients, antiretroviral medications trigger metabolic abnormalities, including insulin resistance. In addition, the inflammatory cytokine tumor necrosis factor-α (TNFα), which is elevated in human immunodeficiency virus encephalitis (HIVE), also induces insulin resistance and inflicts neuronal damage in vitro. In differentiated PC12 cells and rat cortical neurons, high glucose (HG; 25 mM) triggers reactive oxygen species (ROS) accumulation, contributing to the retraction of neuronal processes, with only a minimal involvement of neuronal apoptosis. In the presence of TNFα, HG-treated neurons undergo massive apoptosis. Because mammalian homolog of the Forkhead family of transcription factors, Forkhead box O transcription factor 3a (FOXO3a), controls ROS metabolism, we asked whether FOXO3a could affect the fate of differentiated neurons in the paradigm of HIVE. We observed FOXO3a nuclear translocation in HG-treated neuronal cultures, accompanied by partial loss of mitochondrial potential and gradual retraction of neuronal processes. Addition of TNFα to HG-treated neurons increased expression of the FOXO-dependent proapoptotic gene Bim, which resulted in extensive apoptotic death. Insulin-like growth factor-I (IGF-I) significantly lowered intracellular ROS, which was accompanied by IGF-I-mediated FOXO3a nuclear export and decrease in its transcriptional activity. The clinical relevance of these findings is supported by detection of nuclear FOXO3a in TUNEL-positive cortical neurons from HIVE, especially in brain areas characterized by elevated TNFα.

BackgroundGlioblastomas are characterized by rapid cell growth, aggressive CNS infiltration, and are resistant to all known anticancer regimens. Recent studies indicate that fibrates and statins possess anticancer potential. Fenofibrate is a potent agonist of peroxisome proliferator activated receptor alpha (PPARα) that can switch energy metabolism from glycolysis to fatty acid β-oxidation, and has low systemic toxicity. Fenofibrate also attenuates IGF-I-mediated cellular responses, which could be relevant in the process of glioblastoma cell dispersal.MethodsThe effects of fenofibrate on Glioma cell motility, IGF-I receptor (IGF-IR) signaling, PPARα activity, reactive oxygen species (ROS) metabolism, mitochondrial potential, and ATP production were analyzed in human glioma cell lines.ResultsFenofibrate treatment attenuated IGF-I signaling responses and repressed cell motility of LN-229 and T98G Glioma cell lines. In the absence of fenofibrate, specific inhibition of the IGF-IR had only modest effects on Glioma cell motility. Further experiments revealed that PPARα-dependent accumulation of ROS is a strong contributing factor in Glioma cell lines responses to fenofibrate. The ROS scavenger, N-acetyl-cysteine (NAC), restored cell motility, improved mitochondrial potential, and increased ATP levels in fenofibrate treated Glioma cell lines.ConclusionsOur results indicate that although fenofibrate-mediated inhibition of the IGF-IR may not be sufficient in counteracting Glioma cell dispersal, PPARα-dependent metabolic switch and the resulting ROS accumulation strongly contribute to the inhibition of these devastating brain tumor cells.

Recent studies suggest a potential role of lipid lowering drugs, fibrates and statins, in anticancer treatment. One candidate for tumor chemoprevention is fenofibrate, which is a potent agonist of peroxisome proliferator activated receptor alpha (PPARalpha). Our results demonstrate elevated expression of PPARalpha in the nuclei of neoplatic cells in 12 out of 13 cases of medulloblastoma, and of PPARgamma in six out of 13 cases. Further analysis demonstrated that aggressive mouse medulloblastoma cells, BsB8, express PPARalpha in the absence PPARgamma, and human medulloblastoma cells, D384 and Daoy, express both PPARalpha and PPARgamma. Mouse and human cells responded to fenofibrate by a significant increase of PPAR-mediated transcriptional activity, and by a gradual accumulation of cells in G1 and G2/M phase of the cell cycle, leading to the inhibition of cell proliferation and elevated apoptosis. Preincubation of BsB8 cells with fenofibrate attenuated IGF-I-induced IRS-1, Akt, ERKs and GSK3beta phosphorylation, and inhibited clonogenic growth. In Daoy and D384 cells, fenofibrate also inhibited IGF-I-mediated growth responses, and simultaneous delivery of fenofibrate with low dose of the IGF-IR inhibitor, NVP-AEW541, completely abolished their clonogenic growth and survival. These results indicate a strong supportive role of fenofibrate in chemoprevention against IGF-I-induced growth responses in medulloblastoma.

Purpose: This study examined the seminal vesicle fluid (SVF) as a potential local source of insulin-like growth factor-I (IGF-I) in the peripheral zone of the prostate. Experimental Design: IGF-I levels in seminal fluid were measured. The levels of the IGF-I receptor (IGF-IR) in its active, phosphorylated form as well as direct downstream targets were examined in the peripheral zone of the prostate. Results: In situ, we find that the IGF-IR is activated in the peripheral zone in areas of atrophy, prostatic intraepithelial hyperplasia, and cancer. In addition, immunostaining reveals preferential activation of the IGF-IR in p63-positive cells in areas of intermediate basal cell hyperplasia in the peripheral zone, indicating that prostate progenitor cells are highly sensitive to increases in local IGF-I levels. These areas of basal cell hyperplasia occur at high incidence in the peripheral zone of the prostate. Relatively high levels of IGF-I were identified in SVF. In addition, we find that SVF can stimulate the proliferation of both normal and cancer-derived prostate cells. Conclusions: These results suggest that SVF is a local source of IGF-I that provides chronic stimulation of prostate cells. This chronic stimulation could contribute to the development of prostate cancer in older men.

Targeted therapies utilizing monoclonal antibodies (mAbs) are now the major class of successful therapeutics for treating a variety of malignancies. Mechanistically, mAbs can have direct antitumoral activity but often their effectiveness relies upon antibody-dependent cellular cytotoxicity (ADCC). For instance, Trastuzumab is a therapeutic monoclonal antibody directed against HER2 that is well-tolerated and useful in the treatment of HER2-positive breast cancer, where efficacy is mediated in part by ADCC. In contrast, Trastuzumab is relatively ineffective in the treatment of epithelial ovarian cancer (EOC) where virtually all cancer cells express detectable levels of HER2. Poor response to mAb therapy in EOC and other types of cancers may be explained in part by diminished numbers and cytotoxic potential of NK cells in cancer patients, compared to healthy individuals. Therefore, reports of poor antitumor effect of Ab-therapy in cancer led us to hypothesize that the development of potent effector cells with the capacity to bind tumor-bound mAb and mediate strong antibody-directed cellular cytotoxicity would markedly improve the efficacy of mAb-targeted therapy for EOC. In order to expand applications for T cell-based immunotherapy and to enhance ADCC, we developed novel effector T cells engineered to express Fc binding immune receptors (FcIR) containing human Fc receptor of low FcγRIIIA (CD16), intermediate FcγRIIA (CD32) or high affinity FcγRI (CD64) molecules fused to intracellular TCR and co-stimulatory signaling domains in order to enable cytotoxic T cells to mediate strong mAb-directed cytotoxicity against antigen-expressing tumor cells. Following FcIR gene transduction, all forms of FcγRs were efficiently expressed on the surface of primary human T cells which allowed these cells to be armed with mAb. Trastuzumab-armed FcIR T cells specifically recognized HER2+ cancer cells, as did unarmed FcIRs but only when the cancer cells were first pre-bound with Trastuzumab. Addition of a CD28 cytoplasmic domain juxtaposed to the TCR CD3z signaling moiety increased IFN-g secretion by FcIR-28z transduced T cells following encounter with antigen-bound mAb on the cancer cell surface. Notably, T cells expressing a high affinity FcIRI (CD64) demonstrated the greatest specific anti-tumor reactivity in comparison to cells expressing FcγRIIA (CD32) or FcγRIIIA (CD16) FcIRs. In addition, FcIRI (CD64) T cells exhibited stronger specific lytic activity than NK cells, even at low antibody concentrations. Further, co-administration of FcIRI (CD64) FcIR-28z T cells with immunotherapeutic mAb, Trastuzumab, exerted strong antitumor activity in vivo, completely eliminating HER2+ tumor. In summary, our results show that ADCC can be enhanced by human T cells engineered to express an FcIR and that this novel approach may overcome issues of resistance to mAb-targeted therapies including those utilizing Trastuzumab. Citation Format: Katarzyna Urbanska, Mathilde Poussin, Caitlin Stashwick, Jenessa B. Smith, Daniel J. Powell Jr. Overcoming resistance to antibody targeted therapy in ovarian cancer [abstract]. In: Proceedings of the 10th Biennial Ovarian Cancer Research Symposium; Sep 8-9, 2014; Seattle, WA. Philadelphia (PA): AACR; Clin Cancer Res 2015;21(16 Suppl):Abstract nr POSTER-THER-1433.

Glioblastomas are one of the most aggressive brain tumors which are characterized by rapid cell growth, infiltration of the Central Nervous System (CNS), and resistance to all known anticancer regiments. Therefore, the development of new more effective therapies against Glioblastoma is the major challenge for modern medicine. Fenofibrate, a drug widely utilized to lower lipid concentration in the blood, is one of the very promising anti-cancer treatments with low systemic toxicity. This potent agonist of PPARδ is thought to shift energy metabolism from glycolysis to fatty acid α-oxidation and, therefore, it may be toxic to glycolysis -dependent brain tumor cells (Warburg effect). While the toxicity to cancer cells appears to be clear, the precise mechanism/s of fenofibrate action against brain tumors seems to be much more complex and remains to be elucidated. To understand metabolic basis of the anti-cancer action of fenofibrate, we have analyzed extracellular acidification (ECAR) and oxygen consumption (OCR) using XF 24 Extracellular Flux Analyzer (Seahorse Bioscience), mitochondrial membrane potential as well as ATP level in different glioblastoma cell lines (LN229, U87MG, T98G). Surprisingly, we found that basal oxygen consumption (OCR) decreased significantly in Glioblastoma cells pretreated with fenofibrate, and the addition of metabolic toxins did not change their metabolic profile. Decreased oxygen consumption was due to the direct interaction of fenofibrate with complex I, a protein involved in the mitochondrial electron transport chain. We additionally found that, in parallel to the metabolic changes, fenofibrate triggers cell cycle arrest followed by apoptosis. The mechanisms involve a PPARδ-mediated effect, which leads to the energy crisis and apoptosis, as well as a PPARδ-independent pathway which results in FOXO3a nuclear translocation and activation of the proapoptotic protein Bim. Overall our data strongly support an anticancer action of fenofibrate by shifting the glycolitic-dependent cell metabolism to fatty acids α-oxidation with subsequent energy crisis and apoptotic cell death. Citation Format: {Authors}. {Abstract title} [abstract]. In: Proceedings of the 103rd Annual Meeting of the American Association for Cancer Research; 2012 Mar 31-Apr 4; Chicago, IL. Philadelphia (PA): AACR; Cancer Res 2012;72(8 Suppl):Abstract nr 3230. doi:1538-7445.AM2012-3230

The IGF-IR is a multifunctional tyrosine kinase receptor involved in several biological processes including cell proliferation, differentiation, DNA repair, and cell survival. In the brain IGF-I plays a critical role during embryonic and early postnatal development. In the mature brain, IGF-I binding sites have been found in different regions of the brain, and multiple reports confirmed a strong neuroprotective action of the IGF-IR against different pro-apoptotic insults. When the IGF-IR signaling system is insufficiently deployed, either by low level of expression in elderly individuals, or by the inhibition associated with inflammatory cytokines, neuronal function and survival could be compromised. The examples of such CNS pathologies include HIV associated dementia, diabetic neuropathies, and Alzheimer's disease. On the other hand, elevated expression activity of the IGF-IR may support uncontrolled cell proliferation and protection from apoptosis. Probably the best example of the IGF-IR involvement in brain tumors is medulloblastomas in which functional cooperation between viral oncoprotein, JC virus large T-antigen, and IGF-IR has been recently established. Therefore, better understanding of the beneficial and potentially harmful aspects of the IGF-IR can be critical for the development of new clinical regimens against neurodegenerative disorders and brain tumors.