Search

Journalism's societal role hinges on effective communication, demanding proficient language skills. This study assesses a South African University of Technology's Department of Journalism, probing existing selection methods' efficacy in predicting success in two English modules. Concerns persist about these methods accurately identifying students with essential language proficiency. The research explores alternatives for better assessing language abilities crucial for journalistic proficiency. The literature review underscores language proficiency's significance in journalism education, especially in African contexts, observing challenges faced by South African universities. Current practices, relying on high school English grades and standardised tests, may not precisely reflect required journalism-specific language skills. Using a non-experimental quantitative design, the study analyses correlations between selection methods and student performance in English modules. Findings indicate a weak correlation, advocating for a more comprehensive approach with alternative assessments. Proposed alternatives include writing samples, portfolio reviews, and situational judgement tests for a holistic selection process. The study suggests future research directions, emphasising broader generalisability and exploring correlations with practical skills and critical thinking. The study emphasises the imperative for journalism departments to reevaluate and enhance selection criteria, aligning them with dynamic professional demands. Contribution: This article contributes to journalism education by illuminating the shortcomings of current selection methods in assessing potential for success in English language-related modules. It proposes alternatives and advocates for a holistic approach, providing practical insights for journalism departments aiming to align their selection criteria with the evolving demands of the profession. Ultimately, this contribution aids in the development of skilled journalists.

Background: Motor development of many children in rural areas of South Africa is compromised because of various socio-economic factors, hence, the need to address these developmental needs. Aim: To examine the immediate and sustainable effects of a 9-week movement programme on fundamental movement skills (FMS) of school children. Setting: Seven to eight years old school children in Raymond Mhlaba Municipality, Eastern Cape province. Methods: A two-group, pre-post-re-test research design was used. Fundamental movement skills (FMS) proficiency was assessed using the Test of Gross Motor Development-Third Edition (TGMD-3) at pre-test, post-test and re-test after 6 months. Ninety-three school children (intervention group [IG] = 57) and (control group = 36), with a mean age of 7.12 (± 0.71) participated in the study. The twice-a-week FMS programme of 30 min was conducted during school hours. Statistical analysis included an ANOVA type of hierarchical linear model (HLM) (mixed models) procedure to test for intervention effects with school, time, sex and group as covariants. Cohen's effect size was calculated to assess the practical significance of changes. Results: Immediate and sustainable effects were found on locomotor (p < 0.05; d > 1.7, p < 0.05; d > 2.0), ball skills (p < 0.05; d > 0.7, p < 0.05; d > 1.5) and the gross motor index (GMI) of the IG (p < 0.05; d > 1.0, p < 0.05; d > 2.0). Conclusions: A short-duration FMS intervention significantly improve locomotor, ball skills, and GMI of school children in rural areas. Contributions: Interventions of this nature are encouraged to improve the FMS development of school children, especially in rural areas, as it can enhance the building blocks required in the future development of these children.

The current climate reflects not only a hostile politicization of diversity, equity, and inclusion (DEI) work but also an institutionalization of anti-DEI sentiments through legislation and litigation, leaving educational institutions to operate within a hyper-legalistic environment. Although there are a large number of education attorneys who interface regularly with educational institutions, the field of education knows very little about contemporary models of collaboration between attorneys for educational institutions and the values that inform these collaborations. In this article, we aim to illustrate the significant role of attorneys for P-20 educational institutions, the need for more research to help us better understand existing strengths and limitations, and ways to harness this role in meaningful ways to further DEI commitments.

Language is a fundamental aspect of human culture that influences cognitive and perceptual processes. Prior evidence demonstrates personality self-report can vary across multilingual persons' language contexts. We assessed how cultural identification, language dominance, or both dynamically influence bilingual respondents' self-conception, via self-reported personality, across English and Spanish contexts. During separate English and Spanish conditions, 133 Hispanic/Latino bilingual participants (70 female) completed the Big Five Inventory of personality. We used language use and acculturation surveys completed in both languages to calculate participants' relative language dominance and identification with U.S.-American and Hispanic culture. Participants reported higher levels of agreeableness, conscientiousness, and neuroticism in English relative to Spanish. Language dominance predicted cross-language differences in personality report, with higher extraversion reported in participants' dominant language. Within each language, greater endorsement of U.S.-American identity was associated with higher extraversion and conscientiousness and lower reported neuroticism. Agreeableness report in both languages was positively predicted by Hispanic identification. Our results clarify existing literature related to language and cultural effects on personality report among U.S. Hispanics/Latinos. These findings could inform assessments of self-relevant cognitions across languages among bilingual populations and hold relevance for health outcomes affected by cultural processes.

IntroductionFew studies have examined the relationship between education and cognition among the oldest-old.MethodsCognitive assessments were conducted biannually for 803 participants (62.6% women) of LifeAfter90, a longitudinal study of individuals ≥ 90 years old. Gender differences in associations between education (

* Context.--Localized amyloidosis of the bladder is rare and often mimics bladder malignancy. It is typically associated with the extracellular deposition of monoclonal light chains, either [kappa] or [lambda]. The cause is unknown, but it is thought to be due to chronic inflammation/cystitis. Objective.--To highlight the importance of localized urinary bladder amyloidosis as a rare mimicker of urothelial malignancy and elucidate its clinical, histopathologic, and cytopathologic manifestations. Design.--Cases of urinary bladder amyloidosis diagnosed during 2000-2023 were retrieved retrospectively from pathology archives. Electronic medical records, including cystoscopy findings and pathology slides including Congo red stain, were reviewed. Results.--Here we present 6 patients with localized urinary bladder amyloidosis. Four of the 6 patients were women, with ages ranging from 46 to 69 years, and a mean age of 58 years. Five of 6 patients presented with hematuria, while in 1 patient, bladder amyloidosis was discovered incidentally. Cystoscopy findings invariably were concerning for malignancy, with raised erythema in 5 patients and fungating mass protruding into the bladder lumen in 1 patient. Bladder biopsies and urine cytology were negative for malignancy in all cases. Congo red-positive amyloid deposits involved lamina propria with sparing of the detrusor muscle. In 5 cases, the deposits were typed as derived from the k light chain, whereas no information was available for 1 patient. Subsequent clinical workup ruled out systemic amyloidosis. Conclusions.--These cases of urinary bladder amyloidosis highlight the importance of considering rare amyloidosis in the differential diagnosis of hematuria and cystoscopy with a lesion mimicking malignancy. (Arch Pathol Lab Med. 2025;149:191-194; doi: 10.5858/arpa.2023-0559-OA), Amyloidosis is the deposition of insoluble amyloid protein fibrils in various tissues and organs. (1) Amyloidosis can be associated with an underlying plasma cell dyscrasia, sustained chronic inflammation, chronic hemodialysis, [...]

ImportanceMost research to understand postacute sequelae of SARS-CoV-2 infection (PASC), or long COVID, has focused on adults, with less known about this complex condition in children. Research is needed to characterize pediatric PASC to enable studies of underlying mechanisms that will guide future treatment.ObjectiveTo identify the most common prolonged symptoms experienced by children (aged 6 to 17 years) after SARS-CoV-2 infection, how these symptoms differ by age (school-age [6-11 years] vs adolescents [12-17 years]), how they cluster into distinct phenotypes, and what symptoms in combination could be used as an empirically derived index to assist researchers to study the likely presence of PASC.Design, setting, and participantsMulticenter longitudinal observational cohort study with participants recruited from more than 60 US health care and community settings between March 2022 and December 2023, including school-age children and adolescents with and without SARS-CoV-2 infection history.ExposureSARS-CoV-2 infection.Main outcomes and measuresPASC and 89 prolonged symptoms across 9 symptom domains.ResultsA total of 898 school-age children (751 with previous SARS-CoV-2 infection [referred to as infected] and 147 without [referred to as uninfected]; mean age, 8.6 years; 49% female; 11% were Black or African American, 34% were Hispanic, Latino, or Spanish, and 60% were White) and 4469 adolescents (3109 infected and 1360 uninfected; mean age, 14.8 years; 48% female; 13% were Black or African American, 21% were Hispanic, Latino, or Spanish, and 73% were White) were included. Median time between first infection and symptom survey was 506 days for school-age children and 556 days for adolescents. In models adjusted for sex and race and ethnicity, 14 symptoms in both school-age children and adolescents were more common in those with SARS-CoV-2 infection history compared with those without infection history, with 4 additional symptoms in school-age children only and 3 in adolescents only. These symptoms affected almost every organ system. Combinations of symptoms most associated with infection history were identified to form a PASC research index for each age group; these indices correlated with poorer overall health and quality of life. The index emphasizes neurocognitive, pain, and gastrointestinal symptoms in school-age children but change or loss in smell or taste, pain, and fatigue/malaise-related symptoms in adolescents. Clustering analyses identified 4 PASC symptom phenotypes in school-age children and 3 in adolescents.Conclusions and relevanceThis study developed research indices for characterizing PASC in children and adolescents. Symptom patterns were similar but distinguishable between the 2 groups, highlighting the importance of characterizing PASC separately for these age ranges.

Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5' and 3' regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5': GTTAACTTCA) and Syn3-10b-2 (3': GGGCCTGTGG). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5' sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3' sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter.

Background: Extracorporeal membrane oxygenation (ECMO) is increasingly used as a bridge to lung transplantation. Despite success in select populations, candidates requiring ECMO bridge to retransplantation have historically had poor 1-year survival. This study aimed to examine the characteristics of the recipient, donor, and transplant procedure type to guide selection of candidates for ECMO bridge to retransplantation. Methods: This was a retrospective cohort study of all US adult lung retransplant recipients between May 5, 2005, and December 31, 2022. We evaluated 1-year survival of ECMO-bridged retransplant patients, stratified by time from initial transplant, procedure type (single or bilateral retransplant), and ECMO era (2005-2017 vs 2018-2022). Results: In this national cohort, 111 of 1296 (8.6%) retransplant recipients underwent ECMO bridge. One-year survival was worse for ECMO bridge retransplant recipients (52.2% vs 74.0%; P < .001) and has worsened in the contemporary era (2018-2022) of ECMO bridge to retransplantation compared with prior years (P = .03). Time from initial transplantation and use of bilateral retransplant after an initial bilateral transplant were most strongly associated with improved 1-year survival of ECMO-bridged retransplant recipients. Of bilateral recipients bridged to bilateral transplant more than 1 year after primary transplantation, survival was 65.9% in ECMO-bridged patients as opposed to 77.2% in nonbridged patients. Conclusions: Careful selection of candidates and surgical procedure type remains essential in determining candidacy for ECMO bridge to retransplantation.

Abstract Background Diastrophic dysplasia is a rare autosomal recessive disorder characterized by abnormalities in bone and cartilage development, caused by pathogenic variants in the SLC26A2 gene. Case presentation This article presents a clinical case of preimplantation genetic testing for monogenic disorders (PGT-M) conducted for a family with two previous pregnancy losses due to diastrophic dysplasia in the fetus. We report a previously uncharacterized variant c.1358C > T in the SLC26A2 gene associated with diastrophic dysplasia. We detail the approach to performing PGT-M in the absence of material from the proband and close relatives from one partner for analysis. A testing system was developed to analyze pathogenic variants in the SLC26A2 gene, alongside with indirect markers such as short tandem repeats and single nucleotide polymorphisms. This allowed us to identify linkage groups associated with the analyzed pathogenic variants during the in vitro fertilization cycle with PGT-M, enabling the selection of an embryo that did not inherit pathogenic variants from either parent. The transfer of this embryo resulted in a successful pregnancy, resulting in the birth of a healthy child. Conclusion To our knowledge, this is a first report of variant c.1358C > T in the SLC26A2 gene associated with diastrophic dysplasia. The successful application of PGT-M enabled the selection of an embryo free from inherited pathogenic variants from both parents, highlighting the importance of PGT-M in improving reproductive outcomes for affected families.

Abstract Background Needle procedures, such as vaccinations, blood draws, and intravenous cannulation, are the most frequent source of childhood pain, causing fear and reducing the uptake of medical procedures. Every child has the right to expect pain relief, and we have evidence-based tools to reduce needle procedure-related pain. Therefore, the lack of analgesic provision for needle pain is not justified. We argue that better informed and motivated healthcare professionals and families can advocate for appropriate pain relief in every child, every time. Observations Engaging communication campaigns are needed to educate our healthcare professionals. Evidence-based modalities such as topical anaesthesia, sucrose or breastfeeding, comfort positioning, and age-appropriate distractions should be available for every child during needle procedures. However, high-quality information is not enough to change behaviour—healthcare professionals need to be motivated, encouraged, and inspired. Parents and carers should be empowered to advocate for their children and be aware that their child has the right to receive pain relief during these procedures. Conclusions and relevance This is a call to action—we need collaboration between academics, healthcare professionals, industry and charities, to expedite behavioural change and parental advocacy through high-quality communication strategies. Effective pain management in infants and children can play a crucial role in promoting the uptake of vaccinations and medical procedures and can influence future attitudes to pain.

Abstract Low-density lipoprotein receptor-related protein 1 (LRP1) is a multifunctional endocytic receptor whose dysfunction is linked to developmental dysplasia of the hip, osteoporosis and osteoarthritis. Our work addresses the critical question of how these skeletal pathologies emerge. Here, we show the abundant expression of LRP1 in skeletal progenitor cells at mouse embryonic stage E10.5 and onwards, especially in the perichondrium, the stem cell layer surrounding developing limbs essential for bone formation. Lrp1 deficiency in these stem cells causes joint fusion, malformation of cartilage/bone template and markedly delayed or lack of primary ossification. These abnormalities, which resemble phenotypes associated with Wnt signalling pathways, result in severe and persistent skeletal defects including a severe deficit in hip joint and patella, and markedly deformed and low-density long bones leading to dwarfism and impaired mobility. Mechanistically, we show that LRP1 regulates core non-canonical Wnt/planar cell polarity (PCP) components that may explain the malformation of long bones. LRP1 directly binds to Wnt5a, facilitates its cell-association and endocytic degradation and recycling. In the developing limbs, LRP1 partially colocalises with Wnt5a and its deficiency alters abundance and distribution of Wnt5a and Vangl2. Finally, using Xenopus as a model system, we show the regulatory role for LRP1 in Wnt/PCP signalling. We propose that in skeletal progenitors, LRP1 plays a critical role in formation and maturity of multiple bones and joints by regulating Wnt signalling, providing novel insights into the fundamental processes of morphogenesis and the emergence of skeletal pathologies.