Search

The Severe Acute Respiratory Syndrome (CoVID 19) provoked by Coronavirus 2 (SARS CoV 2) require science-based responses. The aim of this work is to assess pitfalls found during the search of viral genomes due to sampling timing, swabbing, storage, heat-infectivity inactivation and further sample processing. According to several meta-analysis, on the day of symptom onset, the median false-negative rate is estimated to be 38% and decreased to 20% on day 8 (3 days after symptom onset) then increased to 66% on day 21 suggesting that rRT-PCRs adds little information immediately after exposure. RNA isolation from samples requires cautious handling using RNase-free solutions, pipet tips and glassware. The rRT PCR detection limits are estimated between 39 and 779 copies/mL but 3000 to 20.000 copies/ml for the antigen test. External cross contamination by imperceptible splatting requires risk management integrating the Pharmacopoeias by processing at least 10 negative contiguous to 10 positive controls in each sennries of 100 tests. . For Ct >34 it was suggested no transmissible disease. The detection of antibodies one month or later after clinical signs may confirm positivity. Lack of immune response in non-immune compromised asymptomatic people may invalidate positivity. False positive disrupts efficiency for containing infections and leads to societal anxiety undermining health workforce. Because spurious methods create confusion, each step of diagnosis requires quality-control and risk assessment, knowing that rRT PCRs amplify more than 10.000 million times the signal of 1 viral element

To investigate which cytokines, chemokines and growth factors are involved in the immunopathogenesis of idiopathic uveitis, and whether cytokine profiles are associated with. Serum and aqueous humor (AH) samples of 75 patients with idiopathic uveitis were analyzed by multiplex immunoassay. Infectious controls consisted of 16 patients with ocular toxoplasmosis all confirmed by intraocular fluid analyses. Noninfectious controls consisted of 7 patients with Behçet disease related uveitis and 15 patients with sarcoidosis related uveitis. The control group consisted of AH and serum samples from 47 noninflammatory control patients with age-related cataract. In each sample, 27 immune mediators ± IL-21 and IL-23 were measured. In idiopathic uveitis, 13 of the 29 mediators, including most proinflammatory and vascular mediators such as IL-6, IL-8, IL-12, G-CSF, GM-CSF, MCP-1, IP-10, TNF-α and VEGF, were significantly elevated in the aqueous humor when compared to all controls. Moreover, IL-17, IP-10, and IL-21, were significantly elevated in the serum when compared to all controls. We clustered 4 subgroups of idiopathic uveitis using a statistical analysis of hierarchical unsupervised classification, characterized by the order of magnitude of concentrations of intraocular cytokines. The pathogenesis of idiopathic uveitis is characterized by the presence of predominantly proinflammatory cytokines and chemokines and vascular endothelial growth factor with high expression levels as compared to other causes of uveitis. There are indications for obvious Th-1/ IL21-Th17 pathways but also IL9-Th9 and increased IFN-γ-inducing cytokine (IL12) and IFN-γ-inducible CXC chemokine (IP-10). The combined data suggest that immune mediator expression is different among idiopathic uveitis. This study suggests various clusters among the idiopathic uveitis group rather than one specific uveitis entity.

Resume Le tableau d’hemorragies retiniennes recidivantes chez de jeunes adultes a ete decrit pour la premiere fois en 1880 par Henry Eales. Les signes associes d’inflammation oculaire ont ete rapportes 5 ans plus tard. La maladie de Eales correspond a un tableau de vascularite retinienne ischemique qui atteint en priorite la retine peripherique des jeunes patients. La majorite des cas ont ete rapportes en Inde. Son etiologie est inconnue mais elle semblerait dans certains cas etre liee a une hypersensibilite mediee par le systeme immun a l’antigene Mycobacterium tuberculosis (MTB). Sa pathogenese est reliee a une ischemie retinienne extensive secondaire a une vasculopathie occlusive avec liberation de facteurs angiogeniques de type VEGF. Les atteintes sont retiniennes et comprennent des periphlebites, une ischemie retinienne capillaire principalement en peripherie pouvant se compliquer de retinopathie proliferante avec neovascularisation retinienne et/ou papillaire, d’hemorragies intravitreennes recidivantes et de decollements de la retine tractionnels. Ces complications peuvent mettre en jeu le pronostic visuel. L’histoire naturelle de la maladie de Eales est assez variable avec une remission temporaire ou permanente dans certains cas et une progression continue pour d’autres. L’evolution se fait vers la bilateralisation de la maladie frequemment ce qui necessite un suivi regulier. Le traitement de la maladie de Eales depend du stade de la maladie et n’est pas bien defini. L’observation simple, la chirurgie par vitrectomie et/ou les injections intravitreennes de VEGF font partie de la prise en charge d’une hemorragie intravitreenne dans ce contexte, en association a la corticotherapie si une vascularite retinienne est presente. Une pan-photocoagulation retinienne par laser est necessaire en cas de neovascularisation retinienne.

To evaluate the efficacy and safety of dexamethasone (DEX) implant compared with inferior fornix-based sub-Tenon triamcinolone injection (PSTA) for treatment of uveitis.A total of 48 eyes received DEX and 49 eyes received PSTA as the first treatment.A total of 31 eyes were implanted with DEX relapsed (64.5%) after the first injection, while 32 eyes were injected with PSTA as the first treatment relapsed (65.3%). Kaplan-Meier estimated survival to overall relapse after the first injection was a mean 20 months± 3.6 months for DEX (median,7) and 14 months± 1.9 months (median,9) for the PSTA (P = 0.505). Of 49 eyes receiving the PSTA implant as the first treatment, inflammation persisted in 14.3% after the first injection but persisted in none after the DEX injection (P = 0.005).DEX implantation achieved a higher rate of disease control in the initial 12 weeks postinjection with a relative equivalence in the duration of effect and relapse rates when compared with PSTA.

We describe the frequency, demographic and clinical features, and visual outcomes of ocular syphilis infections observed during 2012-2015 at a tertiary reference center in Paris, France. Twenty-one cases (29 eyes) were identified. The occurrence of ocular syphilis increased from 1 case in 2012 to 5 cases in 2013, 6 cases in 2014, and 9 cases in 2015 (2.22-25.21/1,000 individual patients/year for the period). Among case-patients, an annual 20%-33% were co-infected with HIV. Seventy-six percent of ocular syphilis infections occurred in men who have sex with men. Seventy-five percent of case-patients had a good final visual outcome (best-corrected visual acuity >0.3 logMAR score). Visual outcome was worse for HIV-positive patients than for HIV-negative patients (p = 0.0139). At follow-up, the best visual outcomes were observed in patients whose mean time from first ocular symptom to consultation was 15 days (SD +19 days).

Organizations working for the elimination of Chlamydia-triggered blindness (trachoma) follow the WHO SAFE strategy (surgery for trichiasis, antibiotics, face washing and environmental changes) with the aim to achieve a minimum of 80% of children with clean faces in endemic communities, mass treatment covering the whole district with trachoma rates of 10% or more and surveillance plans. Trachoma recurrence that is common after implementing the SAFE strategy 3, 5 or even 7 times evidence that the cognitive processes requiring assimilation and integration of knowledge did not register with parents, caretakers and children. Moreover, repeated awareness campaigns to improve hygiene did not systematically produce irreversible changes of behavior in neglected populations. In view of this evidence, the rational behind mass drug administration as the mainstay of preventable blindness elimination demands a wider scope than simple mathematical models. The reluctance to see disappointing outcomes that leads to repeated interventions may suggest from a sociologic point of view that the strategies are products of those evaluating the activities of those who fund them and vice versa. A similar articulation emerges for reciprocal interactions between researchers and those judging the pertinence and quality of their work. So far, the lack of autocritic elimination strategy approaches may expose inbred circles that did not properly grasp the fact that antibiotics, trichiasis surgery and education limited to improvement of hygiene are inefficient if not associated with long-term basic educational actions in schools.

Background: Health authorities are working toward the global elimination of trachoma by the year 2020 with actions focused on the World Health Organization SAFE strategy (surgery of trichiasis, antibiotics, face washing and environmental changes) with emphasis on hygienist approaches for education. Objectives: The present survey was performed to assess the sustainability of the SAFE strategy 3 years after trachoma was eliminated from 6 villages. Methods: In February 2013 a rapid trachoma assessment was conducted in 6 villages of Kolofata’s district, Extreme north Region, Cameroon, where trachoma was eliminated in 2010. A total of 300 children (1–10 years) from 6 villages were examined by trained staff. Results: The prevalence of active trachoma (children aged > 1 and < 10 years) in 2013 was 15% and in at least 25% was observed absence of face washing and flies in their eyes and nose. Income level, quality of roads, hygiene, and illiteracy were similar in all the villages; they did not change between 2010 and 2013 and could not be analyzed as independent risk factors. Discussion: The heterogeneity of methods described for clinical trials makes it inappropriate to conduct meta-analysis for the present and for other SAFE-related trials. The results obtained after implementation the SAFE strategy (recurrence) reveal that the causes (infectious agents and dirtiness) and effects (illness) were not connected by illiterate people living under conditions of extreme poverty. So far, antibiotics, surgery and hygiene education are insufficient for the sustainability of trachoma elimination and highlight that hypothetic-deductive processes seem not operational after implementing the awareness campaigns. Trachoma recurrence detected in 2013 in sedentary populations of Kolofata receiving efficacious treatments against Chlamydia sp. suggest that the elimination goals will be delayed if strategies are limited to medical actions. Restricting efforts to repeated pharmacological and surgical interventions for people infected with susceptible bacteria could be understood as the hidden side of a passive attitude toward basic education actions.

PURPOSE To assess the influence of donor characteristics on the outcome of anterior lamellar keratoplasty (ALK) and to evaluate whether corneal donor tissue considered unsuitable for penetrating or posterior lamellar keratoplasty due to poor endothelial condition may be safely used for ALK. METHODS Institutional setting. One hundred sixty-six consecutive ALK (166 patients) performed for optical indication in eyes with corneal diseases not involving the corneal endothelium. The main outcome measures were graft survival, early (0-12 months postoperatively) and late (after 12 months) annual endothelial cell loss, and postoperative logarithm of the minimum angle of resolution visual acuity. RESULTS The average and extreme values of donor tissue characteristics were: donor age, 70.6 years (range, 28-88 years); organ culture time, 20.9 days (range, 12-35 days); graft endothelial cell density before transplantation, 2047 cells per millimeters (range, 100-3300 cells/mm2); and deswelling time, 2.0 days (range, 1-4 days). The average follow-up time of patients was 48.1 ± 24.8 months (mean ± SD). None of the donor characteristics significantly influenced graft survival or postoperative endothelial cell loss (early and late phase). Donor age >80 years was associated with lower postoperative visual acuity at all postoperative points in time (P < 0.05). At 3 years, the mean logarithm of the minimum angle of resolution visual acuity was 0.44 (20/55) for grafts from donors older than 80 years and 0.25 (20/35) for younger donors. This result was shown to be significant both in univariate and in multivariate analysis. CONCLUSIONS Grafts from elderly donors should be discarded before ALK. Conversely, donor tissue with poor endothelial cell density (

Resume Suite a la demande de procedures pour le traitement des endophtalmies dans des regions de pauvrete, nous avons construit une approche qui tienne compte des donnees pharmacocinetiques, sachant qu’administres par voie orale ou intramusculaire les antibiotiques doivent atteindre des taux endoculaires efficaces, du spectre des antibiotiques sur la flore la plus representative des endophtalmies, et de la disponibilite quotidienne des produits generiques bio equivalents sur le terrain. Les procedures basiques pour la prise en charge des endophtalmies post-chirurgicales dans les centres ophtalmologiques en zones de pauvrete sont presentees et discutees dans ce travail.

The objective of this study was to assess the factors associated with anatomical and visual outcomes in patients presenting with Acanthamoeba keratitis (AK).This is a retrospective noncomparative interventional case series study comprising 44 eyes from 42 patients presenting with AK, treated with topical hexamidine diisethionate and topical polyhexamethylene biguanide, monitored between 2004 and 2008. AK was confirmed by polymerase chain reaction or direct microscopic examination. Correlation between clinical presentation and prognosis was assessed. Anatomical outcome was assessed according to the percentage of eyes requiring at least 1 surgical procedure in addition to topical treatment. Visual outcome was assessed by the best-corrected visual acuity at the end of follow-up.Polymerase chain reaction results were positive for Acanthamoeba in 40 of the 44 eyes (91%) and in 16 of the 44 eyes (36%) by direct microscopic examination. Confocal microscopy suggested the presence of Acanthamoeba in 12 of 19 eyes (63%). Amniotic membrane transplantation was performed in 8 eyes, penetrating keratoplasty in 4 eyes, and evisceration in 2 eyes. The average follow-up time was 10 months. Surgical treatment was significantly associated (P0.05) with time from symptom onset to diagnosis of30 days, an initial visual acuity of ≤20/200, an infiltrate size of3 mm, preperforating infiltrates, and corneal neovascularization. The average final visual acuity was 20/48 in eyes that did not require surgical treatment (n = 34) and 20/1702 in eyes that required at least 1 surgical procedure (n = 10; P0.0001).Late diagnosis, low initial visual acuity, corneal neovascularization, large infiltrates, and preperforated infiltrates were associated with surgical treatment in patients presenting with AK. Surgical intervention was associated with worse visual outcome.

Purpose: To target the use of two biologic tests in the diagnostic of viral Herpesviridae anterior uveitis (AC) by the consideration of clinical behavior and delay of intraocular sampling.Methods: Aqueous humor samples were collected from 42 patients suspected of having AU of infectious origin at presentation. The diagnosis of infectious uveitis was confirmed by quantification of antibodies with the Goldmann-Witmer coefficient (GWC) and/or detection of Herpesviridae genomes with PCR. The data were compared with data of 16 uveitis control samples used to calculate the specificity of the tests.Results: Sixteen out of 42 eyes (38%) had a final diagnosis of anterior segment infectious uveitis of viral origin (Herpesviridae) confirmed by PCR positive result (5/14 eyes; 14 of the 16 eyes were tested by PCR) and/or specific intraocular antibody synthesis (14/16 eyes).Conclusions: While the GWC is progressively less often performed, these findings suggest that it still has a role in AU suspected of herpesvirus et...

Diagnosis of Acanthamoeba by microscopic examination, culture, and polymerase chain reactions (PCRs) has several limitations (sensitivity, specificity, lack of detection of several strains, cost of testing for discrimination among strains). We developed a new high-resolution melting real-time PCR (HRM) to detect and characterize Acanthamoeba infections. HRM performances were evaluated with strains from the American Type Culture Collection (ATCC) and with 20 corneal scrapings. The DNA extracted from specimens were amplified, detected, and characterized in 1 run using 2 original primers diluted in a solution containing an intercalating dye. Detection and molecular characterization of Acanthamoeba infections could be achieved in less than 2.5 h with a dramatic reduction in cost of reactants (postamplification procedures and radioactive or fluorescent-labeled molecular probes were unnecessary). HRM detection limits were 0.1 cyst/μL or less (including genotypes T5 and T11), and its sensitivity and specificity were higher than other molecular tests. For the tested strains from the ATCC, the HRM drafted 4 different profiles: Type I (genotypes T2 and T4), Type II (T5 and T7), Type III (T8), and Type IV (T1, T3, T6, T9, T11, T12, and T13).

Studies have shown that cancer requires two conditions for tumor progression: cancer cell proliferation and an environment permissive to and conditioned by malignancy. Chemotherapy aims to control the number and proliferation of cancer cells, but it does not effectively control the two best-known conditions of the tumor-permissive environment: neoangiogenesis and tolerogenic immunity. Many malignant diseases exhibit poor outcomes after treatment with chemotherapy. Therefore, we investigated the potential benefits of adding an induction regimen of antiangiogenesis and antitumor immunity to chemotherapy in poor outcome disease. In a prospective, randomized trial, we included patients with advanced, unresectable pancreatic adenocarcinomas, non-small cell lung cancer, or prostate cancer. Two groups of each primary condition were compared: group 1 (G1), n = 30, was treated with the standard chemotherapy and used as a control, and group 2 (G2), n = 30, was treated with chemotherapy plus an induction regimen of antiangiogenesis and antitumor immunity. This induction regimen included a low dose of metronomic cyclophosphamide, a high dose of Cox-2 inhibitor, granulocyte colony-stimulating factor, a sulfhydryl (SH) donor, and a hemoderivative that contained autologous tumor antigens released from patient tumors into the blood. After treatment, the G2 group demonstrated significantly longer survival, lower blood level of neoangiogenesis and immune-tolerance mediators, and higher blood levels of antiangiogenesis and antitumor immunity mediators compared with the G1 group. Toxicity and quality of life were not significantly different between the groups. In conclusion, in several advanced malignancies of different primary localizations, an increase in survival was observed by adding an induction regimen of antiangiogenesis and antitumor immunity to standard chemotherapy.

Cholera toxin and isoproterenol (β-adrenergic receptor agonist) are largely used to enhance cell proliferation. The aim of the study was to assess the effects of cholera toxin and isoproterenol on growth and differentiation of cells cultured from human superficial limbal explants.Limbal epithelial cells were cultured from superficial limbal explantsin basal medium either supplemented with cholera toxin or isoproterenol for 3 weeks. Growth kinetics and morphometry were studied by light and confocal microscopy. Progenitor and differentiated epithelial cell markers were studied by immunocytochemistry, flow cytometry, Colony Formation Assay, and reverse transcription and polymerase chain reaction.Cell proliferation was significantly higher with 0.5 µg/ml (p = 0.049), 1 µg/ml (p = 0.005), and 2 µg/ml (p = 0.008) isoproterenol whereas, cholera toxin and 4 µg/ml isoproterenol did not significantly increase cell proliferation. Multilayered epithelial cell sheets were obtained in all culture conditions. Addition of isoproterenol resulted in smaller cell size (p0.05) 14 days after cells were cultured, whereas cholera toxin had no effects. Strong expression of cytokeratins 3 and 4/5/6/8/10/13/18 and lower expression of cytokeratin 19, vimentin, and Delta N p63α were observed after 3 weeks of culture with no significant differences in the percentage of positive cells according to culture medium. Colony-forming efficiencies were observed after 2 weeks in all culture condition but not after 3 weeks.Isoproterenol was more efficient than cholera toxin for enhancing cell proliferation and resulted in smaller cell size. It appears to be useful and safe for growing human limbal epithelial progenitors from limbal explants with no feeders before transplantation to patients with limbal deficiency.

Purpose The first-line therapy for patients with keratitis is different for bacteria, filamentous fungi, and yeasts. The timely onset of treatments depends on rapid and accurate diagnosis. However, fungal cultures produce high rates of false-negative results. Nucleic acid amplification techniques (polymerase chain reaction [PCR]) improve fungal diagnosis performance, but they require complex postamplification procedures to differentiate filamentous fungi from yeasts or to identify the agent. The objective of this work was to develop a new diagnostic strategy based on real-time PCR high-resolution melting (HRM) analysis that in 1 run (a) detects and semiquantifies yeasts and filamentous fungi, (b) differentiates yeasts from filamentous fungi, and (c) discriminates among relevant species of yeasts. Design Experimental study to compare HRM diagnosis performances with microscopic examination of corneal scrapings and fungal culture. Participants and Controls High-resolution melting detection limits and specificity were assessed with (a) isolated strains; (b) agents (other than fungi) producing keratitis; (c) corneal scrapings from fungal keratitis (culture positive and negative); and (d) corneal scrapings from bacterial, viral, or Acanthamoeba keratitis. Methods The DNA extracted from cornea specimens was mixed with primers diluted in the MeltDoctor HRM Master Mix (Applied Biosystems, Paris, France) in 2 tubes, the first for yeasts, containing the forward primer CandUn (5′CATGCCTGTTTGAGCGTC) and the reverse primer FungUn2 (5′TCCTCCGCTTATTGATATGCT), and the second for filamentous fungi, containing the forward primer FilamUn1 (5′TGCCTGTCCGAGCGTCAT) and FungUn2. Molecular probes were not necessary. The yields of DNA extraction and the PCR inhibitors were monitored by adding internal controls to each sample. Main Outcome Measures Detection of fungi in corneal samples by HRM. Results High-resolution melting consistently detects the equivalent of 0.1 colony-forming units /ml of yeasts and filamentous fungi, differentiates filamentous fungi from yeasts, and discriminates among relevant species of yeasts. High-resolution melting sensitivity and specificity were 100% for culture-positive samples, detecting and characterizing fungi in 7 of 10 culture-negative suspected fungal keratitis. Conclusions High-resolution melting is a new, sensitive, specific, and inexpensive test that detects fungi and differentiates filamentous fungi from yeasts directly from clinical specimens in less than 2.30 hours after DNA extraction. Financial Disclosure(s) The author(s) have no proprietary or commercial interest in any materials discussed in this article.

To evaluate the incidence, clinical and microbiological characteristics and risk factors of infectious keratitis in patients with limbal stem cell deficiency (LSCD).Retrospective comparative case series of 35 patients with severe LSCD.The mean follow-up time was 46 months. Infectious keratitis were mainly caused by Gram positive bacteria (94%). Only 7 infections (37%) healed under fortified adapted antibiotics. In 8 cases (42%), amniotic membrane transplantation was required and in 4 cases (21%) «à chaud» keratoplasty was performed. Significant risk factors associated with infectious keratitis were: soft contact lens extended wear, history of persistent epithelial defects, number of quadrants of corneal vascularization, re-epithelialization time after amniotic membrane or corneal transplantation, and use of corticosteroid or cyclosporin eye drops.Infectious keratitis in LSCD is frequent and severe. The restoration of the epithelial barrier integrity and a careful use of therapeutic contact lenses may help to prevent infection.

Objective: Trachoma (Chlamydia-triggered blinding infection) provoked irreversible visual impairment in about 8 million people in 2011, and the prevalence among children with dirty faces is more than three fold that among children with clean faces. In 250 villages with a high prevalence of trachoma (Kolofata district, Far North Region, Cameroon), the lack of water for facial cleanliness was reported during trachoma awareness campaigns. The objective of this study was to determine if the lack of water was linked with the absence of means to dig wells. Methods: Wells, waterholes, motorcycles, irrigation pumps, electricity, goats and oxen, cell phones and distance from waterholes were recorded in January 2011 in 50 randomized villages of Kolofata’s district. Results: The number of villages with

The aim of this work was to determine the diagnostic performance of real-time polymerase chain reaction (RT-PCR) and to assess intraocular specific antibody secretion (Goldmann-Witmer coefficient) on samples from patients with signs of posterior uveitis presumably of infectious origin and to target the use of these two biologic tests in the diagnostic of Toxoplasma/viral Herpesviridae posterior uveitis by the consideration of clinical behavior and delay of intraocular sampling.Aqueous humour and/or vitreous fluid were collected from patients suspected of having posterior uveitis of infectious origin at presentation (140 samples). The diagnosis was confirmed by quantification of antibodies with the Goldmann-Witmer coefficient (GWC) and for detection of Herpesviridae and Toxoplasma gondii genomes with RT-PCR. Forty-one patients had final diagnosis of uveitis of non-Toxoplasma/non-viral origin and 35 among them constituted the control group. The main outcome measures were sensitivity, specificity, and positive and negative predictive values (PPV and NPV).When pre-intraocular testing indication was compared with final diagnosis, GWC was a more sensitive and specific method than RT-PCR, and was successful in detecting T. gondii, especially if the patient is immunocompetent and the testing is carried out later in the disease course, up to 15 months. For viral Herpesviridae uveitis, the sensitivity and PPV of PCR evaluation was higher than detected with GWC with respectively 46% compared with 20% for sensitivity and 85% versus 60% for PPV. In either viral retinitis or toxoplasmosis infection, RT-PCR results were positive from 24 h, although GWC was not significant until 1 week after the onset of signs. In toxoplasmosis patients, positive RT-PCR results were statistically correlated with the chorioretinitis area (more than three disc areas; p = 0.002), with the age older than 50 (p = 0.0034) and with a clinical anterior inflammation (Tyndall ≥1/2+) and panuveitis; (p = 0.0001).For the diagnosis of viral or toxoplasmosis-associated intraocular inflammation, the usefulness of laboratory diagnosis tools (RT-PCR and GWC) depends on parameters other than the sensitivity of the tests. Certain patient characteristics such as the age of the patients, immune status, duration since the onset of symptoms, retinitis area, predominant site and extent of inflammation within the eye should orientate the rational for the choice of laboratory testing in analysis of intraocular fluids.

Resume Introduction Etudier les caracteristiques des keratites bacteriennes afin d’identifier des facteurs de risque et des facteurs pronostics. Patients et methodes Etude retrospective sur 111 yeux de 105 patients hospitalises entre 2005 et 2006 pour une keratite bacterienne confirmee (identification d’un germe au laboratoire) ou fortement suspectee (evolution favorable sous traitement antibiotique sans germe identifie sur les prelevements). Resultats Les principaux facteurs de risque retrouves etaient le port de lentilles de contact (39,6 %), une pathologie de la surface oculaire (36,9 %), une chirurgie oculaire (27,9 %) et un traumatisme oculaire (11,7 %). Les cocci Gram+ representaient 46,8 % des cas ( Staphylococcus ), les bacilles Gram− 19,8 % ( Pseudomonas ), les bacilles Gram+ 7,2 % ( Proprionibacterium et Corynebacterium ), les cocci Gram− 2,7 % ( Branhamella ) et les coccobacille Gram− 0,9 % ( Moraxella ). Dans 22,5 % des cas aucun germe n’a ete retrouve. Dans 25,6 % des cas, deux germes ou plus ont ete retrouves. Le suivi moyen etait de 6,5 mois. Le taux de guerison de l’infection etait de 77,5 % avec un traitement purement medical et 99,1 % avec un traitement medicochirurgical. Une greffe de membrane amniotique a ete realise dans 16,2 % des cas et une keratoplastie a chaud dans 8,1 %. L’acuite visuelle moyenne initiale etait a 0,04 et l’acuite visuelle finale a 0,14. L’acuite visuelle finale moyenne est 0,09 pour les Gram+ et 0,44 pour les Gram− ( p = 0,03). Conclusion Les keratites bacteriennes sont des infections graves engageant le pronostic visuel. Les keratites a germe Gram+ sont les plus frequentes, sauf chez les porteurs de lentilles, et plus severes.

The milestones marking substantial changes in the lives or in the survival of humans deserve to be remembered. It has been only 11 years since we experienced an event that not even the most optimistic amongst us would have predicted before 1997. Let us place the facts in time. At the beginning of the 80s, we faced the distressing reality that more than three quarters of all children, men and women found to have antibodies directed against a new infectious agent named human immune deficient virus (HIV) were bound to die. The mere reactivity of the serum of a human being against a virus characterized in 1983 (antibodies) handed an almost inevitable sentence of death. At that time the evolution of this viral infection was assessed by the quantification of a sub type of white cells, the auxiliary lymphocytes or CD4. This count was the principal evidence for most of the predictions on how a person might survive without degradation, and the value of such cells was the abacus used to forecast the time when an individual would develop irreversible blindness, to anticipate respiratory failure, and to predict the time before weakness would appear after devastating diarrhea, etc. We should recall that the CD4 cell count was even used as a predictor of the initiation of cognitive shrinkage, forecasting dementia as well as the signs that would take hold of personality as a consequence of infections or neoplastic transformations in the encephalitic mass.

Sensitive and specific laboratory tests adapted to ophthalmologic micro specimens are necessary for the clinical management of corneal ulcers (CU). The goal of this work is to analyze the correlation of diagnosis tests specificities with pricing policies for public laboratories. Human specimen procedures were extracted from the National Eye Center Laboratory registers in Paris, France with reimbursement values (pricing) confronting the National Social Security Services. According to cost of reactants and human resources, the official quotation for public laboratories for urinary tract diagnosis is 19 Euros (signals allowing for ruling-out negatives takes less than 2 min) and less than 27 Euros for a comprehensive laboratory diagnosis of CU, which includes testing for bacteria, fungi and protozoa (Acanthamoeba); antibacterial and antifungal susceptibility testing for positive cultures and adapted DNA extraction procedures for viral and protozoa PCR (>1 hour handling). Pricing calculations produced oversimplified conclusions for CU diagnosis, ignoring pathology differences, diagnosis procedures, risks and sphere of action. Comprehensive revision of cost assessment policies and diagnosis pricing should be implemented for specialized laboratories to maintain the quality of public medical care and avoid interruptions in the transmission of knowledge to younger generations. Key words: Aberration, cost assessment, laboratory diagnosis, public health, microbiological diagnosis ophthalmology.

Resume But Evaluer la cinetique de la croissance des cellules epitheliales limbiques in vitro a partir d’explants limbiques preleves sur des greffons conserves en organoculture. Patients et methodes Vingt et un explants limbiques preleves sur les collerettes corneosclerales de greffons corneens humains conserves en organoculture pendant 18 a 24 jours ont ete cultivees a 37 °C pendant dix, 13 ou 18 jours. La surface du voile cellulaire a ete mesuree pendant la culture a l’aide d’un logiciel. En fin de culture, les cellules dissociees ont ete comptees et analysees en immunoperoxydase. Resultats La courbe de la surface du voile cellulaire ( S ) en fonction de la duree de culture ( t ) est decrite au mieux par un modele polynomial d’equation S = 0,024 t 3 − 0,038 t 2 − 0,044 t + 0,092. La duree moyenne du cycle cellulaire est de 24 heures. La croissance cellulaire est d’autant plus grande que le delai post-mortem de prelevement du donneur est court. La plupart des cellules expriment la cytokeratine-3 (expression variable d’une cellule a l’autre). Plus de 50 % des cellules expriment la vimentine. Conclusion Le limbe preleve sur un greffon corneen humain conserve en organoculture pendant trois semaines conserve un potentiel de proliferation cellulaire compatible avec une utilisation therapeutique pour une allogreffe de limbe ou une therapie cellulaire epitheliale corneenne allogenique. Le potentiel de croissance des cellules epitheliales limbiques est cependant altere par l’ischemie froide post-mortem du donneur et le delai post-mortem de prelevement des cornees doit donc etre aussi court que possible.

Background: Acanthamoeba keratitis (AK) is a sight-threatening infection, and none of the current diagnosis tests are able to detect in one reaction low levels of the vast majority of strains associated with pathology. The goal of this work was to validate a new tool for the detection of the American Type Cell Collection (ATCC) referenced Acanthamoeba monitoring simultaneously DNA extraction yields and PCR inhibitors. Performances were assessed on corneal scrapings. Methods: Primers were selected in a region bracketing a 41 591 bp of the A castellanii mitochondrion gene. DNA extraction and PCR inhibitors were monitored by adding an internal control (virus). Acanthamoeba were detected and quantified by the real-time fast-duplex TaqMan PCR (f-d-real-t PCR) and negativity confirmed by SYBR Green real-time PCR. Results: The f-d-real-t PCR detects 0.1 cyst/μl or less of the 10 referenced strains (sensitivity slightly lower for Aastronyxis). Bacteria, fungi and herpesviruses do not cross-react. The specificity and sensitivity of the f-d-real-t PCR were higher than culture and other real-time PCR on 20 keratitis samples. Conclusion: The f-d-real t PCR detects in less than 2 h the Acanthamoeba strains available from the ATCC with a higher sensitivity and specificity than techniques previously reported. Larger trials are necessary to validate its usefulness for disease management and environmental studies.

Background:Propionibacteriaceae (Propioni) are anaerobic bacteria associated with human and animal infections. Present-day methods of diagnosis for Propioni are unsatisfactory due to a lack of sensitivity of culture, time required for culture results (3 to 14 days) and difficulties in interpreting SYBR Green real-time PCR results. The goal of this work was to validate a new rapid and sensitive test for the diagnosis of Propioni infections (endophthalmitis, corneal ulcers and others).Material and methods:DNA was extracted using the MagNA Pure isolation kit (Roche), and bacterial detection and quantification were carried out with a set of original primers and probe (5′ATACGTAGGGTGCGAGCGTTGTCC; 5′TGGTGTTCCTCCTGATATCTGCGC and [Amino C6+JOE]-GATCGCGTCGGAAGTGTAATCTTGGGG-Black Hole Quencher). The PCR cycling programme consisted of one cycle at 95°C, 20 s and 45 cycles at 95°C, 3 s and 30 s at 60°C. DNA extraction yields were assessed in the same tube.Results:This test detects as few as 0.01 Equivalent PFU/μl Propioni in phosphate-buffered saline (PBS), aqueous humour, vitreous or cell suspensions. Propioni is detected as a single contaminant or mixed with other bacteria, fungi or human cells.Conclusion:The new real-time PCR is able to detect 0.01 Eq/CFU μl of Propioni suspended in PBS, vitreous, aqueous humour and human cells in less than 1.30 h.

Resume Les atteintes allergiques de la surface oculaire sont en constante augmentation et representent un motif frequent de consultation en ophtalmologie. Le dosage des IgE totales dans les larmes peut etre effectue par la nouvelle technique ultrasensible « 0-100 » sur Immunocap ® 100 (Phadia) dont la precision et la correlation avec la technique precedente ont ete evaluees. Le dosage de l’albumine dans le serum et les larmes permet l’estimation de la fraction filtree des IgE lacrymales a travers la barriere hematolacrymale. Le calcul du rapport IgE lacrymales dosees/filtrees permet de mettre en evidence une secretion locale d’IgE totales, signe d’une sensibilisation locale a un ou plusieurs allergenes. Si le diagnostic des conjonctivites saisonnieres aigues est le plus souvent pose a partir des arguments cliniques, de l’interrogatoire et du bilan allergologique classique, la recherche d’une secretion locale d’IgE au niveau de la surface oculaire peut apporter une aide diagnostique dans certains cas cliniques moins evocateurs comme les conjonctivites perannuelles ou plus severes comme les keratoconjonctivites vernales et atopiques.

OBJECTIVES: Chlamydia trachomatis infections, in the context of extreme poverty, may trigger trachoma. Because the levels of C. trachomatis eye infections in Mexico are unknown, this study sought to determine if C. trachomatis was present in the conjunctiva of children living in three poor, rural areas of the country. METHODS: Clinical diagnosis of conjunctival follicles in children was conducted during the 2004 visual acuity assessment campaigns in rural areas of the states of Chiapas, Oaxaca, and Zacatecas. C. trachomatis detection was carried out by sampling the children with follicles and examining the specimens after Giemsa or microimmunofluorescence (MIF) staining. RESULTS: A total of 941 children from 6 to 12 years of age were examined in 2004. Of the 484 in Chiapas, 30% were found to have follicles; of the 181 in Zacatecas, 22%; and of the 276 in Oaxaca, 42%. C. trachomatis was detected at levels ranging between 2% and 5%; positive by Giemsa in 4.5% of the children with follicles, and by MIF in 15.5%. CONCLUSIONS: Considering that the chlamydiae sampling procedures and detection methods used in this study were not the most sensitive, the results underestimate the chlamydial eye infections and represent a conservative assessment of a potential risk for preventable visual impairment. Because C. trachomatis was detected here at levels similar to those reported for low-endemic trachoma areas, health authorities should be prepared to implement appropriate measures should it be confirmed that the visual health of Mexico’s children is at risk.OBJETIVOS: En un contexto de pobreza extrema, la infección por Chlamydia trachomatis puede desencadenar el tracoma. Debido a que se desconocen los niveles de infección ocular con C. trachomatis en México, el objetivo de este estudio fue determinar la presencia de C. trachomatis en la conjuntiva de niños de tres zonas rurales pobres de México. MÉTODOS:El diagnóstico clínico de folículos conjuntivales en los niños se llevó a cabo durante la campaña de evaluación de la agudeza visual en áreas rurales de los estados de Chiapas, Oaxaca y Zacatecas en 2004. Para la detección de C. trachomatis se tomaron muestras de los niños con folículos y se analizaron mediante la tinción de Giemsa o microinmunofluorescencia (MIF). RESULTADOS: En total se examinaron 941 niños de 6 a 12 años de edad en 2004. Se observaron folículos en 30% de los 484 niños de Chiapas, en 22% de los 181 de Zacatecas y en 42% de los 276 niños de Oaxaca. Se detectó C. trachomatis en niveles entre 2% y 5%; de los niños con folículos, 4,5% resultaron positivos por Giemsa y 15,5% por MIF. CONCLUSIONES: Estos resultados subestiman el nivel de infección ocular por clamidia, ya que los procedimientos de muestreo y los métodos de detección de clamidia empleados en este estudio no eran los más sensibles, por lo que representan una valoración conservadora del riesgo de trastornos visuales prevenibles. Como los niveles de C. trachomatis encontrados son similares a los informados para áreas de baja endemia de tracoma, las autoridades de salud deben estar listas para implementar medidas apropiadas si se confirmaran los riesgos para la salud visual de los niños mexicanos.

One component of control programmes to eliminate trachoma is the treatment of Chlamydia trachomatis infection. A diagnosis of trachoma is based on clinical grounds, but the signs of active trachoma do not always correlate with the presence of C. trachomatis. During a therapeutic trial, the level of C. trachomatis infection in children with active trachoma in Guinea and Pakistan was assessed using a qualitative commercially available PCR that targeted the C. trachomatis plasmid. The influence of the quality of specimens on the efficiency of the PCR was investigated using two quantitative real-time PCRs targeting the specific omp1 gene of C. trachomatis and human chromosomal DNA, respectively. C. trachomatis was detected in c. 23% of children (aged 1–10 years) who presented with clinically active trachoma. Controls showed that PCR-related problems did not influence this detection rate. For 14% of the positive samples, C. trachomatis was detected in only one eye, with a significantly lower mean load of bacteria. These results suggest that epidemiological and therapeutic surveys should be conducted by sampling and testing both eyes. Moreover, the high variability of the cell load observed in the conjunctival swabs suggests that the effectiveness of swabbing may be questionable.

Resume Les keratomycoses et les infections fongiques endo-oculaires sont difficiles a traiter et de mauvais pronostic ; ce dernier va dependre de la rapidite du diagnostic et de la mise en route d’un traitement efficace. Le traitement des lesions corneennes fait appel a des collyres antibiotiques a spectre large, amphotericine B, natamycin, ou plus specifiques, des levures fluconazole, flucytosine. Dans les cas graves, en echec therapeutique, le voriconazole et la caspofungine ont pu etre utilises sous la forme collyre, en dernier recours, sous surveillance car il n’existe pas de recul quant a leur tolerance en usage local. Les infections profondes et les endophtalmies necessitent un traitement par voie generale ; ces dernieres annees, l’utilisation du voriconazole et de la caspofungine a permis d’ameliorer considerablement le traitement de ces infections.

Aim: To compare the efficacy and safety of Azyter, azithromycin 1.5% eye drops, for 3 days with tobramycin 0.3% for 7 days to treat purulent bacterial conjunctivitis. Methods: This was a multicentre, randomised, investigator-masked study including 1043 children and adults with purulent bacterial conjunctivitis. Patients received either azithromycin 1.5% twice-daily for 3 days or tobramycin 0.3%, 1 drop every two hours for 2 days, then four times daily for 5 days. Clinical signs were evaluated and cultures obtained at D0, D3 and D9 (where D refers to “day”). Primary variable was the clinical cure at the Test-of-Cure (TOC)-visit (D9±1), for patients with D0-positive cultures. The cure was defined as: bulbar conjunctival injection and discharge scores of 0. Results: Among 471 patients with D0-positivity in the per protocol set, 87.8% of the azithromycin 1.5% group and 89.4% of the tobramycin group were clinically cured at the TOC-visit. Azithromycin was non-inferior to tobramycin for clinical and bacteriological cure. Clinical cure was significantly higher with azithromycin 1.5% at D3. The safety profile of azithromycin was satisfactory with a good patient and investigator’s acceptability. Conclusions: Azithromycin 1.5% for 3 days was as effective and as safe as tobramycin for 7 days. Furthermore, more azithromycin than tobramycin patients presented an early clinical cure at Day 3. Due to its twice daily dosing regimen for 3 days, azithromycin represents a step forward in the management of purulent bacterial conjunctivitis, especially in children.

Trachoma is a sight-threatening process triggered by infection of the conjunctiva with Chlamydiae. When this infection becomes chronic and is associated with poverty it triggers trachoma, the prime cause of infectious blindness in the world. Since the 1958 report indicating that the highest incidence of trachoma in Pakistan was found in the province of Punjab, no new trials have been published. In the present study, we assessed the prevalence of trachoma in 3968 children living in 11 rural villages in the district of Attock, Punjab, Pakistan. The children with trachoma were sampled to detect C. trachomatis by PCR.Children in rural villages in the district of Attock were examined for trachoma in February 2004. Samples were obtained by scraping, and DNA was extracted (MagnaPure-LC Robot) and amplified to detect C. trachomatis (Amplicor-Roche). The quality of sampling was assessed by quantifying the number of cells by real-time PCR.The prevalence of trachoma was 3.7% (0 to 6.2%). PCR was positive in 20% of samples from trachomatous children and the number of cells was always100/sample. The income levels, illiteracy, use of latrines, water supply, and the presence of animals close to dwellings were similar in all the villages. In Sujjenda, the prevalence was doubled in the warmest season.Trachoma was diagnosed in 3.7% of the children aged10 years. The low rates for positive PCR may be due to loss of the plasmid, the involvement of other Chlamydiae, or their absence in chronic infections. The results obtained here underestimate the prevalence of trachoma because most of the mothers (and babies) were not tested in the district of Attock.

Purpose The objective of this study was to identify fungi species isolated in contact lenses boxes from January 2000 to November 2012 and to compare with fungi species found in corneal samples over the same period. Methods Retrospective study from January 2000 to November 2012. Over the same period, were analyzed isolates from 68 patients with clinical signs of keratomycosis confirmed by corneal samples culture. The temporal analysis (over the last 12 years) of the isolates was performed using the chi2 test pattern. Results 456/2433 contact lenses boxes fungi (18.7%). Non-filamentous fungi (yeasts) were isolated in 280 boxes (61.3%), including 85% of Candida (46% Candida parapsilosis) and 15% of other non-filamentous fungi. Filamentous fungi were isolated in 200 boxes (43.8%): Fusarium sp. (46.5%), Penicillium (23%), Aspergillus (12%)other filamentous fungi (18.5%). Fusarium sp. were isolated in 51.4% of patients with clinical signs of keratomycosis. A significant increase in filamentous fungi (chi2 = 6.4 p

International audience; PURPOSE: We examined, retrospectively, the efficacy of voriconazole in Fusarium eye infections. METHODS: Voriconazole-treated patients with proven or probable keratitis or endophthalmitis from the voriconazole database (9 patients) and six French ophthalmology departments (15 patients) were included. Sociodemographic features, predisposing factors, history of corneal trauma, associated ocular conditions, other diseases and prior therapies were analysed. Investigator-determined success was defined as infection resolution with medical treatment. Failure was no response or persistent infection and required surgery. RESULTS: Most patients were Caucasian (83 %) and male (71 %). The infection was keratitis (63 %) or endophthalmitis (37 %) and proven in 23 (96 %). Prior therapy included topical and/or systemic amphotericin (46 %), fluconazole (17 %) or others (33 %), often in combination. Causative fungi were Fusarium solani (14, 58 %), Fusarium moniliforme (1), Fusarium oxysporum (1) and Fusarium spp. (8). Voriconazole was administered systemically, topically and/or by intraocular injection, and 16 patients (67 %) received salvage and eight primary therapy. The overall response was 67 % (73 % keratitis and 56 % endophthalmitis) but seven patients required adjunctive surgery. However, response was 63 % for eight primary therapy patients and 69 % for 16 salvage therapy patients. Response by species was Fusarium solani 64 % (9/14) and all others 80 % (8/10). In 13 patients (77 %), voriconazole was used in combination (response 69 vs. 64 % alone) with topical [amphotericin B 10/24 (42 %), caspofungin 5 (21 %), natamycin 1 (4 %)] and systemic agents [caspofungin 3 (13 %), amphotericin 2 (8 %)]. CONCLUSIONS: Topical and systemic voriconazole appears to be effective alone or in combination with other agents for treating severe Fusarium keratitis or endophthalmitis.

Purpose To assess the influence of culture time on maintenance of limbal epithelial progenitors in the explant culture system. Methods Limbal epithelial cells were cultured from 2-mm2 human limbal explants in cholera toxin-free medium with no feeders for 9-21 days. Expression of differentiation and progenitor markers was assessed by immunochemestry and RT-PCR. The clonal growth ability of cultured epithelial cells at each time of culture and with murine 3T3 feeders or human corneal stromal feeders was evaluated by determining colony forming efficiency (CFE). Results The average number of cultured cells obtained after 7, 14, and 21 days was, respectively, 500, 60489, and 195949. Expression of broad spectrum cytokeratins, CK3, CK19, vimentin, p63, and ABCG-2 was observed at all culture time points by immunocytochemistry and RT-PCR. Epithelial colonies were observed at 9, 11, 14 and 18 of culture but not at 21 days, both with murine 3T3 feeders and human corneal stromal feeders. Higher number of colonies was obtained when limbal epithelial cells were cultured with murine 3T3 feeders than with human corneal stromal feeders. The highest number of colonies was obtained at 14 days of culture with murine 3T3 feeders. The average cell Feret diameter (µm)/circularity for clones obtained from 11-, 14-, and 18-day primary cultures were, respectively, 38.4/0.76, 34.2/0.80, and 45.7/0.72 (p

The aim of this study was to determine the penetration of doripenem administered intravenously into the rabbit aqueous and vitreous humors. Nineteen New Zealand White rabbits received a 20-mg dose of doripenem intravenously over 60 min. Specimens of aqueous humor, vitreous humor, and blood were obtained 30 min ( n = 5), 1 h ( n = 5), 2 h ( n = 5), and 3 h ( n = 4) after the beginning of the infusion and analyzed by high-performance liquid chromatography (HPLC). A pharmacokinetic (PK) model was developed to fit the experimental data. Doripenem concentrations in aqueous humor were lower than those in plasma ultrafiltrates at all sampling times, with an average aqueous humor-to-plasma ultrafiltrate area under the concentration-time curve ratio estimated as 8.3%. A pharmacokinetic model with peripheral elimination described the data adequately and was tentatively used to predict concentration-versus-time profiles and pharmacokinetic-pharmacodynamic (PK-PD) target attainment in patients under various dosing regimens. In conclusion, systematically administered doripenem does not seem to be a promising approach for the treatment of intraocular infections, especially since it could not be detected in the vitreous humor. However, this study has provided an opportunity to develop a new PK modeling approach to characterize the intraocular distribution of doripenem administered intravenously to rabbits, with tentative extrapolation to humans.

Purpose To assess the clinical relevance of tear anti-herpes simplex virus (HSV) antibody measurement for the diagnosis of herpes simplex keratitis. Methods Records of 364 patients clinically suspect of HSV-related keratitis who had tear anti-HSV IgG assessment (tear-quantified anti-HSV IgG/filtrated IgG ratio) in our institution between January 2000 and August 2008 were retrospectively analyzed. Patients were classified into 4 groups as follows: group 1, anti-HSV IgG negative in serum and tears; group 2, anti-HSV IgG negative in tears and positive in serum; group 3, anti-HSV IgG nonsignificantly positive in tears and positive in serum; and group 4, anti-HSV IgG significantly positive in serum and tears. Randomly selected patient charts from each group were reviewed for clinical data. Results The prevalence of anti-HSV IgG in blood increased with age from >70% before 20 years to 95% after 70 years. The prevalence of anti-HSV IgG in tears increased with age from 20% before 20 years to >50% after 70 years. The presence (either significant or not) of anti-HSV IgG in tears was significantly associated with decreased corneal sensation, presence of stromal opacities, and with neurotrophic keratitis. Logistic regression showed no significant association between age and clinical signs except for herpetic ulcers and herpetic necrotizing keratitis. Conclusions Tear production of anti-HSV IgG increases with age, and it is associated with sequelae of herpes simplex keratitis. Conversely, it is poorly associated with clinical signs of acute herpes simplex keratitis.

Purpose Acanthamoeba keratitis (AK) is a sight-threatening infection. Classic PCR enhanced sensitivity but required post-amplification procedures, increasing contamination risks. The reported real-time PCRs are unable to detect all the genotypes associated with pathology. We present a new strategy validated American Type Cell Collection strains and corneal scrapings. Methods A were detected by a fast PCR (f-d-real-t PCR) and negativity confirmed by SYBR Green. Sequences selected in the mitochondrion were: forward primer: 5‘GCAGTCGCGGTAATACGA; reverse: 5’ACCACCTACGCACCCTTTACA and probe: 6-FAM-AGTGTTATTCGCATTGACTGGGTGTAA-TAMRA. Results The new test detects all A with different lab equipment (1 cyst or less/specimen). A.astronyxis signals are inferior to others; however, primers diluted in SYBR Green mix (without probe) detect 0.1 cyst/µl or less of this strain. For clinical samples microscopic examination and cultures detected 6 out 10 but f-d-real-t PCR 100% with results confirmed by SYBR Green. Other PCRs bracketing different regions (ribosome) detected 80 % and produced false positives for samples containing Salmonella lexinton, C. sporulans, S. marcescens and Propionibacteria. Conclusion Highly sensitive diagnosis is necessary to administrate efficient treatments at the onset of AK. The strains from the ATCC with higher sensitivity and specificity than techniques previously reported. New approaches based on High Resolution Melting r-t PCR are in development in the CHNO to detect and molecularly characterize in one run different strains of protozoa and Fungi infecting the eye.

Background and aims: Trachoma is a sight-threatening process triggered by the infection of the conjunctiva with Chlamydiae. Blindness associated with trachoma was reported in Sahelian areas of Cameroon. However, data on the prevalence of this neglected infection in the Far North Region are not available. The aim of this study was a) to assess clinical trachoma and b) to detect Chlamydia in the conjunctiva of trachomatous populations living in the Far North Regions of Cameroon. Methods: A total of 2,423 randomly selected children (1–10 years) and 1,590 women over 14 from randomly selected villages from the Kolofata Health District (115,000 inhabitants) were included in a cross-sectional study in February 2009. Trained staff examined and obtained conjunctival swabs from trachomatous subjects. DNA was extracted and amplified to detect Chlamydia DNA by real-time PCR. The quality of sampling was assessed by quantifying the number of epithelial cells. Results: Children (2,397 or 98.9% of the predicted number) and women (1,543; 97.0%) were examined. The prevalence of follicular trachoma (TF) in children was 21% (95% CI 17.8–24.5) and of intense inflammatory trachoma (TI) 5.2% (95% CI 3.6–7.3). Among the women, trichiasis (TT) was observed in 3.4% (95% CI 2.4–4.7), corneal opacities (CO) in 1.4% (95% CI 0.8–2.3) and trachoma-related blindness in 0.9% (95% CI 0.4–1.8). Conditions related to income, illiteracy, latrines, water supply and animals wandering close to dwellings were similar in all the villages. PCR was positive in 35% of children with active trachoma and in 6% of adult females presenting TT and/or related corneal opacities. Conclusion: The prevalence of trachoma and the severe trachoma sequelae found during this survey underline the urgent need to implement efficient blindness prevention interventions to improve the visual future of the people in the Sahelian region.

Background: Purulent bacterial conjunctivitis affects all ages with high frequency in newborns and children. In a subset of 150 children included in a large study having enrolled 1043 patients, our aim was to analyze in children, the efficacy and safety of azithromycin 1.5% eye-drops in the treatment of this disease. Methods: This multicenter, randomized, investigator-masked, parallel-group study, included 150 children and adolescents to study safety and compare azithromycin 1.5% eye drops twice daily for 3 days and tobramycin 0.3% 1 drop every 2 hours for 2 days then 4 times daily for 5 days. Out of 150 patients included, 58 had positive cultures and were studied for efficacy. Signs and symptoms were evaluated and cultures obtained at baseline, Days 3 and 9. Primary efficacy variable was the clinical cure (score 0 for bulbar conjunctival injection and purulent discharge) at the test of cure visit (day 9). Results: Both treatments were effective with a clinical and microbiologic cure of more than 80% of children on day 9. Azithromycin therapy provided a greater bacteriologic cure on day 3 than did tobramycin (P < 0.001) and eradicated bacteria that were defined as resistant, using classical antibiogram. No adverse effects were noted on the ocular surface. Conclusions: Azithromycin 1.5% eye drops leads to a rapid clinical and microbiological cure.

Aims An epidemiological study carried out in 2006 indicated a high prevalence of blinding trachoma in the Kolofata Health District, Far North Region, Republic of Cameroon. As a result, the national blindness control programme of Cameroon instituted a trachoma elimination programme using the SAFE strategy. Methods A campaign to treat the entire district population with azithromycin 1.5% eye drops was undertaken in February 2008. To measure the effectiveness of treatment on the prevalence of active trachoma, two epidemiological studies were conducted on a representative sample of children aged between 1 and 10 years. The first study was performed just prior to the treatment campaign and the second study was performed 1 year later. Results The prevalence of active forms of trachoma (trachomatous inflammation—follicular (TF) + TF/trachomatous inflammation—intense (TI)) dropped from 31.5 (95% CI 26.4 to 37.5)% before treatment to 6.3 (95% CI 4.1 to 9.6)% 1 year after treatment—a reduction of nearly 80%. There were no reports of serious or systemic side effects. Tolerance was excellent and no treatment was interrupted. Conclusion Mass treatment with azithromycin 1.5% eye drops is feasible, well tolerated and effective.