Search

The spread of antibiotic-resistant pathogens is a growing concern, and new families of antibacterials are desperately needed. Odilorhabdins are a new class of antibacterial compounds that bind to the bacterial ribosome and kill bacteria through inhibition of the translation. NOSO-95C, one of the first member of this family, was synthesized for the first time, and then a structure-activity relationships study was performed to understand which groups are important for antibacterial activity and for inhibition of the bacterial translation. Based on this study an analogue showing improved properties compared to the parent compound was identified and showed promising in vitro and in vivo efficacy against Enterobacteriaceae.

Antibacterial activity screening of a collection of Xenorhabdus strains led to the discovery of the Odilorhabdins, a novel antibiotic class with broad-spectrum activity against Gram-positive and Gram-negative pathogens. Odilorhabdins inhibit bacterial translation by a novel mechanism of action on ribosomes. A lead-optimization program identified NOSO-502 as a promising candidate. NOSO-502 has MIC values ranging from 0.5 to 4 μg/ml against standard Enterobacteriaceae strains and carbapenem-resistant Enterobacteriaceae (CRE) isolates that produce KPC, AmpC, or OXA enzymes and metallo-β-lactamases. In addition, this compound overcomes multiple chromosome-encoded or plasmid-mediated resistance mechanisms of acquired resistance to colistin. It is effective in mouse systemic infection models against E. coli EN122 (ESBL) or E. coli ATCC BAA-2469 (NDM-1), achieving an ED50 of 3.5 mg/kg and 1-, 2- and 3-log reductions in blood burden at 2.6, 3.8, and 5.9 mg/kg, respectively, in the first model and 100% survival in the second, starting with a dose as low as 4 mg/kg. In a UTI model of E. coli UTI89, urine, bladder and kidney burdens were reduced by 2.39, 1.96, and 1.36 log10 CFU/ml, respectively, after injecting 24 mg/kg. There was no cytotoxicity against HepG2, HK-2, or HRPT cells, no inhibition of hERG-CHO or Nav 1.5 -HEK current, and no increase of micronuclei at 512 μM. NOSO-502, a compound with a novel mechanism of action, is active against Enterobacteriaceae, including all classes of CRE, has a low potential for resistance development, shows efficacy in several mouse models, and has a favorable in vitro safety profile.

International audience; Growing resistance of pathogenic bacteria and shortage of antibiotic discovery platforms challenge the use of antibiotics in the clinic. This threat calls for exploration of unconventional sources of antibiotics and identification of inhibitors able to eradicate resistant bacteria. Here we describe a different class of antibiotics, odilorhabdins (ODLs), produced by the enzymes of the non-ribosomal peptide synthetase gene cluster of the nematode-symbiotic bacterium Xenorhabdus nematophila. ODLs show activity against Gram-positive and Gram-negative pathogens, including carbapenem-resistant Enterobacteriaceae, and can eradicate infections in animal models. We demonstrate that the bactericidal ODLs interfere with protein synthesis. Genetic and structural analyses reveal that ODLs bind to the small ribosomal subunit at a site not exploited by current antibiotics. ODLs induce miscoding and promote hungry codon readthrough, amino acid misincorporation, and premature stop codon bypass. We propose that ODLs' miscoding activity reflects their ability to increase the affinity of non-cognate aminoacyl-tRNAs to the ribosome.

The bacterial RNA polymerase (RNAP) is an essential enzyme that is responsible for making RNA from a DNA template and is targeted by several antibiotics. Rifampicin was the first of such antibiotics to be described and is one of the most efficient anti-tuberculosis drugs in use. In the past five years, structural studies of bacterial RNAP and the resolution of several complexes of drugs bound to RNAP subunits have revealed molecular details of the drug-binding sites and the mechanism of drug action. This knowledge opens avenues for the development of antibiotics. Here these drugs are reviewed, together with their mechanisms and their potential interest for therapeutic applications.

Objectives Despite extensive functional screening of the bacterial RNA polymerase (RNAP) over the past years, very few novel inhibitors have been reported. We have, therefore, decided to screen with a radically different, non-enzymic, protein-protein interaction assay. Our target is the highly conserved RNAP-sigma interaction that is essential for transcription. Methods Small molecule inhibitors of the RNAP-sigma interaction were tested for their activity on transcription and on bacteria. Results These compounds have antibacterial activity against Gram-positive bacteria including multiresistant clinical isolates. Conclusions This is, to our knowledge, the first example of a small molecule inhibitor of this interaction.

We have developed a multiwell assay for the detection of modulators of prokaryotic transcription based on the quantification of protein-protein interaction. This assay consists of three steps: (a) the immobilization of the Escherichia coli protein sigma70 in the well, (b) the incubation of the immobilized protein with core RNA polymerase and a potential inhibitor, and (c) washing and quantification of the binding of core to sigma70 with a monoclonal antibody conjugated to horseradish peroxidase. We show that this assay is sensitive, reproducible, and robust, and is able to discriminate between control competitors with different affinities. We demonstrate the usefulness of the assay to screen for microbial RNA polymerase inhibitors as potential new drugs for the treatment of emerging antibiotic-resistant bacteria.

International audience; Since the early 1980s, fungi have emerged as a major cause of human disease. Fungal infections are associated with high levels of morbidity and mortality, and are now recognized as an important public health problem. Gram-negative bacterial strains of genus Xenorhabdus are known to form symbiotic associations with soil-dwelling nematodes of the Steinernematidae family. We describe here the discovery of a new antifungal metabolite, cabanillasin, produced by Xenorhabdus cabanillasii. We purified this molecule by cation-exchange chromatography and reverse-phase chromatography. We then determined the chemical structure of cabanillasin by homo- and heteronuclear NMR and MS-MS. Cabanillasin was found to be active against yeasts and filamentous fungi involved in opportunistic infections.

The pharmacologic effect of an antibiotic is directly related to its unbound concentration at the site of infection. Most commercial antibiotics have been selected in part for their low propensity to interact with serum proteins. These nonspecific interactions are classically evaluated by measuring the MIC in the presence of serum. As higher-throughput technologies tend to lose information, surface plasmon resonance (SPR) is emerging as an informative medium-throughput technology for hit validation. Here we show that SPR is a useful automatic tool for quantification of the interaction of model antibiotics with serum proteins and that it delivers precise real-time kinetic data on this critical parameter.

Staphylococcus epidermidis is a major cause of nosocomial infections because of its ability to form biofilms on the surface of medical devices. Only a few antibacterial agents are relatively active against biofilms, and rifampin, a transcription inhibitor, ranks among the most effective molecules against biofilm-related infections. Whether this efficacy is due to advantageous structural properties of rifampin or to the fact that the RNA polymerase is a favorable target remains unclear. In an attempt to answer this question, we investigated the action of different transcription inhibitors against S. epidermidis biofilm, including the newest synthetic transcription inhibitors. This comparison suggests that most of the antibiotics that target the RNA polymerase are active on S. epidermidis biofilms at concentrations close to their MICs. One of these compounds, CBR703, despite its high MIC ranks among the best antibiotics to eradicate biofilm-embedded bacteria.

The dramatic rise of antibiotic-resistant bacteria over the past two decades has stressed the need for completely novel classes of antibacterial agents. Accordingly, recent advances in the study of prokaryotic transcription open new opportunities for such molecules. This paper reports the structure-activity relationships of a series of phenyl-furanyl-rhodanines (PFRs) as antibacterial inhibitors of RNA polymerase (RNAP). The molecules have been evaluated for their ability to inhibit transcription and affect growth of bacteria living in suspension or in a biofilm and for their propensity to interact with serum albumin, a critical parameter for antibacterial drug discovery. The most active of these molecules inhibit Escherichia coli RNAP transcription at concentrations of/=10 microM and have promising activities against various Gram-positive pathogens including Staphylococcus epidermidis biofilms, a major cause of nosocomial infection.

Objectives: Staphylococcus epidermidis biofilms form at the surface of implants and prostheses and are responsible for the failure of many antibiotic therapies. Only a few antibiotics are relatively active against biofilms, and rifampicin, a transcription inhibitor, is among the most effective molecules for treating biofilm-related infections. Having recently selected a new potential transcription inhibitor, we attempted to evaluate its efficacy against S. epidermidis biofilms. Methods: Biofilm-forming S. epidermidis strains were grown planktonically or as biofilms and their susceptibility to this transcription inhibitor was compared with reference antibiotics with different mechanisms of action. Conclusions: Our results demonstrate that this new molecule is active; its effects are fast and kinetically related to those of rifampicin, but unlike rifampicin it does not select for resistant bacteria.

Lipiarmycin (Lprm) (8), a macrocyclic antibiotic also known as tiacumicin (2), is currently under development under the name of OPT-80 (Optimer Pharmaceuticals, Inc., San Diego, Calif.) as a narrow-spectrum antibacterial agent to treat Clostridium difficile-associated diarrhea (1, 7). Lprm is a transcription inhibitor, but unlike rifampin and streptolydigin, it preferentially inhibits holoenzyme transcription at a much greater rate than it inhibits transcription of the core enzyme (5, 6). Genetic mapping experiments in Bacillus subtilis indicate that mutants are located between loci determining rifampin resistance and streptolydigin resistance (6). To precisely identify the positions of the mutations, we selected lipiarmycin-resistant colonies and sequenced the domains of the RNA polymerase located between these two loci. Lprm was produced and purified by fermentation of Actinoplanes deccanensis (DSMZ 43806) by the method of Talpaert et al. (8). Mutant strains were isolated as spontaneous variants of Bacillus subtilis CIP 52.62 that were able to form colonies on nutrient agar plates containing Lprm (40 μg/liter). At this concentration the frequency of resistant colonies was less than 10−7. Among the 10 resistant colonies selected, 8 exhibited an increased MIC for several classes of antibiotics and were likely to be permeability mutants (Table ​(Table1).1). Two mutants (mut1 and mut2) were highly resistant to Lprm. TABLE 1. Antibiotic resistance and transcription activity of Lprm-resistant Bacillus subtilis To correlate the resistance phenotypes with the activity of Lprm on the RNA polymerase, we tested enzymes from the wild-type and mutant colonies in an in vitro transcription assay by the method of Sonenshein et al. (6). The parent cells (CIP 52.62) and mutant cells specifically resistant to Lprm (mut1 and mut2) showed the same pattern of sensitivity to rifampin. In contrast, the transcription activity of the wild-type cells was more strongly affected by the addition of Lprm than was the activity of either mut1 or mut2. This confirmed the link between resistance to Lprm resistance and transcription. mut3 to mut10 strains were equally sensitive to rifampin and Lprm, suggesting that the resistance was not due to a mutation in the polymerase. After purification of the genomic DNA, we PCR amplified and sequenced the regions located between the loci determining rifampin and streptolydigin resistance. The following primers were used: 5′-1285CGTGTGGTTCGTGAGAGAATGT1306-3′, 5′-3257TAAGCTTCAAGTGCCCAAACCT3236-3′, and 5′-2524CTTGTTGGTAAAGTAACGCCTA2545-3′ for rpoB and 5′-1163CGTTTCGCACTCTTAATGTTGTG1141-3′, 5′-593CACAAGGACAACGCCGTAC611-3′, and 5′-2804GTTAACTGTGTACCAGGCTCACC2782-3′ for rpoC. A point mutation resulting in the substitution of the R326 of rpoC by L (CG[T/C]TT) was found in mut1 and mut2 in a highly conserved region; no mutation was detected in mut3 to mut10. When the PCR product harboring the R326L mutation was transfected into B. subtilis CIP 52.62, the frequency of lipiarmycin-resistant bacteria was 100-fold higher than the frequency observed for bacteria with the wild-type fragment. By analogy with the three-dimensional structure of the Thermus aquaticus enzyme (3), R326 is located in proximity to region 3.2 of σ, which in turn occupies the same space as the exiting RNA transcript (3). This could delineate a new binding site for transcription inhibitors.

International audience; Ensuring the availability of new antibiotics to eradicate resistant pathogens is a critical issue, but very few new antibacterials have been recently commercialized. In an effort to rationalize their discovery process, the industry has utilized chemical library and high-throughput approaches already applied in other therapeutical areas to generate new antibiotics. This strategy has turned out to be poorly adapted to the reality of antibacterial discovery. Commercial chemical libraries contain molecules with specific molecular properties, and unfortunately systemic antibacterials are more hydrophilic and have more complex structures. These factors are critical, since hydrophobic antibiotics are generally inactive in the presence of serum. Here, we review how the skewed distribution of systemic antibiotics in chemical space influences the discovery process.