Search

Domenica Musumeci,1,2 Valentina Roviello,3 Giovanni N Roviello1 1CNR-Institute of Biostructure and Bioimaging, Naples, Italy; 2Department of Chemical Sciences, University of Naples Federico II, Naples, Italy; 3Analytical Chemistry for the Environment and Centro Servizi Metereologici Avanzati, University of Naples Federico II, Naples, Italy Background: Nucleobase-bearing peptides and their interaction with DNA and RNA are an important topic in the development of therapeutic approaches. On one hand, they are highly effective for modulating the nucleic-acid-based biological processes. On the other hand, they permit to overcome some of the main factors limiting the therapeutic efficacy of natural oligonucleotides, such as their rapid degradation by nucleases. Methods and results: This article describes the synthesis and characterization of a novel thymine-bearing nucleoamino acid based on the l-diaminopropionic acid (l-Dap) and its solid phase oligomerization to α-peptides (oligoDapT), characterized using mass spectrometry, spectroscopic techniques, and scanning electron microscopy (SEM) analysis. The interaction of the obtained nucleopeptide with DNA and RNA model systems as both single strands (dA12, rA12, and poly(rA)) and duplex structures (dA12/dT12 and poly(rA)/poly(rU)) was investigated by means of circular dichroism (CD) and ultraviolet (UV) experiments. From the analysis of our data, a clear ability of the nucleopeptide to bind nucleic acids emerged, with oligoDapT being able to form stable complexes with both unpaired and double-stranded DNA and RNA. In particular, dramatic changes in the dA12/dT12 and poly(rA)/poly(rU) structures were observed as a consequence of the nucleopeptide binding. CD titrations revealed that multiple peptide units bound all the examined nucleic acid targets, with TLdap/A or TLdap/A:T(U) ratios >4 in case of oligoDapT/DNA and ~2 in oligoDapT/RNA complexes. Conclusion: Our findings seem to indicate that Dap-based nucleopeptides are interesting nucleic acid binding-tools to be further explored with the aim to efficiently modulate DNA- and RNA-based biological processes. Keywords: nucleopeptides, nucleic acid interaction, poly(rA) binding, circular dichroism

Giovanni N Roviello,1 Caterina Vicidomini,1 Vincenzo Costanzo,1 Valentina Roviello2 1CNR Istituto di Biostrutture e Bioimmagini, Via Mezzocannone site and Headquarters, 2Centro Regionale di Competenza (CRdC) Tecnologie, Via Nuova Agnano, Napoli, Italy Abstract: In the present study, we report the interaction of an artificial oligolysine (referred to as AOL) realized in our laboratory with targets of biomedical importance. These included polyinosinic acid (poly rI) and its complex with polycytidylic acid (poly I:C), RNAs with well-known interferon-inducing ability, and double-stranded (ds) DNA. The ability of the peptide to bind both single-stranded poly rI and ds poly I:C RNAs emerged from our circular dichroism (CD) and ultraviolet (UV) studies. In addition, we found that AOL forms complexes with dsDNA, as shown by spectroscopic binding assays and UV thermal denaturation experiments. These findings are encouraging for the possible use of AOL in biomedicine for nucleic acid targeting and oligonucleotide condensation, with the latter being a key step preceding their clinical application. Moreover, we tested the ability of AOL to bind to proteins, using serum albumin as a model protein. We demonstrated the oligolysine–protein binding by CD experiments which suggested that AOL, positively charged under physiological conditions, binds to the protein regions rich in anionic residues. Finally, the morphology characterization of the solid oligolysine, performed by scanning electron microscopy, showed different crystal forms including cubic-shaped crystals confirming the high purity of AOL. Keywords: nucleic acid binding, polyinosinic acid, double-stranded nucleic acids, oligolysine, circular dichroism

Plants are continuously exposed to environmental challenges, including pollutants, pesticides, and heavy metals, collectively termed xenobiotics. These substances induce oxidative stress by generating reactive oxygen species (ROS), which can damage cellular components such as lipids, proteins, and nucleic acids. To counteract this, plants have evolved complex metabolic pathways to detoxify and process these harmful compounds. Oxidative stress in plants primarily arises from the overproduction of hydrogen peroxide (H 2 O 2 ), superoxide anions (O 2 •- ), singlet oxygen ( 1 O 2 ), and hydroxyl radicals ( • OH), by-products of metabolic activities such as photosynthesis and respiration. The presence of xenobiotics leads to a notable increase in ROS, which can result in cellular damage and metabolic disruption. To combat this, plants have developed a strong antioxidant defense mechanism that includes enzymatic antioxidants that work together to eliminate ROS, thereby reducing their harmful effects. In addition to enzymatic defenses, plants also synthesize various non-enzymatic antioxidants, including flavonoids, phenolic acids, and vitamins. These compounds effectively neutralize ROS and help regenerate other antioxidants, offering extensive protection against oxidative stress. The metabolism of xenobiotic substances in plants occurs in three stages: the first involves modification, which refers to the chemical alteration of xenobiotics to make them less harmful. The second involves conjugation, where the modified xenobiotics are combined with other substances to increase their solubility, facilitating their elimination from the plant. The third stage involves compartmentalization, which is the storage or isolation of conjugated xenobiotics in specific parts of the plant, helping to prevent damage to vital cellular functions. Secondary metabolites found in plants, such as alkaloids, terpenoids, and flavonoids, play a vital role in detoxification and the defense against oxidative stress. Gaining a deeper understanding of the oxidative mechanisms and the pathways of xenobiotic metabolism in plants is essential, as this knowledge can lead to the formulation of plant-derived strategies aimed at alleviating the effects of environmental pollution and enhancing human health by improving detoxification and antioxidant capabilities, as discussed in this review.

This review explores the potential of antimicrobial metabolites derived from Caucasian medicinal plants as alternatives to conventional antibiotics. With the rise of antibiotic resistance posing a global health threat, there is a pressing need to investigate alternative sources of antimicrobial agents. Caucasian medicinal plants have traditionally been used for their therapeutic properties, and recent research has highlighted their potential as sources of antimicrobial compounds. Representatives of 15 families of Caucasian medicinal plant extracts (24 species) have been explored for their efficacy against these pathogens. The effect of these plants on Gram-positive and Gram-negative bacteria and fungi is discussed in this paper. By harnessing the bioactive metabolites present in these plants, this study aims to contribute to the development of new antimicrobial treatments that can effectively combat bacterial infections while minimizing the risk of resistance emergence. Herein we discuss the following classes of bioactive compounds exhibiting antimicrobial activity: phenolic compounds, flavonoids, tannins, terpenes, saponins, alkaloids, and sulfur-containing compounds of Allium species. The review discusses the pharmacological properties of selected Caucasian medicinal plants, the extraction and characterization of these antimicrobial metabolites, the mechanisms of action of antibacterial and antifungal plant compounds, and their potential applications in clinical settings. Additionally, challenges and future directions in the research of antimicrobial metabolites from Caucasian medicinal plants are addressed.

This study presents the chemical synthesis, purification, and characterization of a novel non-natural synthetic amino acid. The compound was synthesized in solution, purified, and characterized using NMR spectroscopy, polarimetry, and melting point determination. Dynamic Light Scattering (DLS) analysis demonstrated its ability to form aggregates with an average size of 391 nm, extending to the low micrometric size range. Furthermore, cellular biological assays revealed its ability to enhance fibroblast cell growth, highlighting its potential for tissue regenerative applications. Circular dichroism (CD) spectroscopy showed the ability of the synthetic amino acid to bind serum albumins (using bovine serum albumin (BSA) as a model), and CD deconvolution provided insights into the changes in the secondary structures of BSA upon interaction with the amino acid ligand. Additionally, molecular docking using HDOCK software elucidated the most likely binding mode of the ligand inside the BSA structure. We also performed in silico oligomerization of the synthetic compound in order to obtain a model of aggregate to investigate computationally. In more detail, the dimer formation achieved by molecular self-docking showed two distinct poses, corresponding to the lowest and comparable energies, with one pose exhibiting a quasi-coplanar arrangement characterized by a close alignment of two aromatic rings from the synthetic amino acids within the dimer, suggesting the presence of π-π stacking interactions. In contrast, the second pose displayed a non-coplanar configuration, with the aromatic rings oriented in a staggered arrangement, indicating distinct modes of interaction. Both poses were further utilized in the self-docking procedure. Notably, iterative molecular docking of amino acid structures resulted in the formation of higher-order aggregates, with a model of a 512-mer aggregate obtained through self-docking procedures. This model of aggregate presented a cavity capable of hosting therapeutic cargoes and biomolecules, rendering it a potential scaffold for cell adhesion and growth in tissue regenerative applications. Overall, our findings highlight the potential of this synthetic amino acid for tissue regenerative therapeutics and provide valuable insights into its molecular interactions and aggregation behavior.

Cancer remains one of the main causes of death in the world due to its increasing incidence and treatment difficulties. Although significant progress has been made in this field, innovative approaches are needed to reduce tumor incidence, progression, and spread. In particular, the development of cancer vaccines is currently ongoing as both a preventive and therapeutic strategy. This concept is not new, but few vaccines have been approved in oncology. Antigen-based vaccination emerges as a promising strategy, leveraging specific tumor antigens to activate the immune system response. However, challenges persist in finding suitable delivery systems and antigen preparation methods. Exosomes (EXs) are highly heterogeneous bilayer vesicles that carry several molecule types in the extracellular space. The peculiarity is that they may be released from different cells and may be able to induce direct or indirect stimulation of the immune system. In particular, EX-based vaccines may cause an anti-tumor immune attack or produce memory cells recognizing cancer antigens and inhibiting disease development. This review delves into EX composition, biogenesis, and immune-modulating properties, exploring their role as a tool for prevention and therapy in solid tumors. Finally, we describe future research directions to optimize vaccine efficacy and realize the full potential of EX-based cancer immunotherapy.

In the search for novel, effective inhibitors of High-Mobility Group Box1 (HMGB1)-a protein involved in various inflammatory and autoimmune diseases as well as in cancer-we herein discovered a set of anti-HMGB1 G-quadruplex(G4)-forming aptamers by using an in vitro selection procedure applied to a doped library of guanine-rich oligonucleotides. The selected DNA sequences were then studied in a pseudo-physiological buffer mimicking the extracellular medium, where HMGB1 exerts its pathological activity, using spectroscopic, electrophoretic, and chromatographic techniques. All the oligonucleotides proved to fold into monomeric G4s and in some cases also dimeric species, stable at physiological temperature. Remarkably, the protein preferentially recognized the sequences forming dimeric parallel G4 structures, as evidenced by a properly designed chemiluminescent binding assay which also highlighted a good selectivity of these aptamers for HMGB1. Moreover, all aptamers showed anti-HMGB1 activity, inhibiting protein-induced cell migration. The acquired data allowed identifying L12 as the best anti-HMGB1 aptamer, featured by high thermal and enzymatic stability, no toxicity at least up to 5 μM concentration on healthy cells, along with potent anti-HMGB1 activity (IC 50 ca. 28 nM) and good binding affinity for the protein, thus indicating it as a very promising lead candidate for in vivo studies., (© 2024 Wiley‐VCH GmbH.)

Peptide Nucleic Acids (PNAs) represent a promising tool for gene modulation in anticancer treatment. The uncharged peptidyl backbone and the resistance to chemical and enzymatic degradation make PNAs highly advantageous to form stable hybrid complexes with complementary DNA and RNA strands, providing higher stability than the corresponding natural analogues. Our and other groups' research has successfully shown that tailored PNA sequences can effectively downregulate the expression of human oncogenes using antigene, antisense, or anti-miRNA approaches. Specifically, we identified a seven bases-long PNA sequence, complementary to the longer loop of the main G-quadruplex structure formed by the bcl2midG4 promoter sequence, capable of downregulating the expression of the antiapoptotic Bcl-2 protein and enhancing the anticancer activity of an oncolytic adenovirus. Here, we extended the length of the PNA probe with the aim of including the double-stranded Bcl-2 promoter among the targets of the PNA probe. Our investigation primarily focused on the structural aspects of the resulting DNA 2 -PNA heterotriplex that were determined by employing conventional and accelerated microsecond-scale molecular dynamics simulations and chemical-physical analysis. Additionally, we conducted preliminary biological experiments using cytotoxicity assays on human A549 and MDA-MB-436 adenocarcinoma cell lines, employing the oncolytic adenovirus delivery strategy., Competing Interests: The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (© 2024 The Author(s).)

The study of antioxidants is of pivotal importance in biomedicine as these molecules could be involved in biological pathways associated with disease. The identification of new antioxidants together with the acquisition of a deeper knowledge on their biology, could lead to the use of these compounds as drugs for innovative treatments. Plants are an important reservoir of phytodrugs that in many cases can be isolated with good extraction yields directly from the vegetal source and are often endowed with a low toxicity profile. Georgia, a country situated on the Black Sea coast in the Caucasus region at the intersection of Western Asia and Eastern Europe, is renowned for its unique woodland habitats and immense biological diversity due to the great variety of climate zones and landscapes. Many wild plants in the area are used as remedies for a number of illnesses in the local traditional medicine. However, the scientific knowledge of these sources of natural drugs and of their molecular components is still far from exhaustive. Therefore, with the present work we reviewed the scientific literature on some of the main Georgian medicinal plants and found that several species are a valuable source of hydrophilic and hydrophobic antioxidants, endowed in some cases with a high ROS-scavenging ability. The analysis of the literature also demonstrated that most of the medicinal extracts and compounds isolated from these plants are beneficial in suppressing multiple diseases in vitro. This review will provide information for scientists looking to develop secure plant-based pharmaceuticals as well as a rationale for using Georgian medicinal plants for the treatment of a range of diseases., (Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.net.)

Nucleobase-containing molecules are compounds essential in biology due to the fundamental role of nucleic acids and, in particular, G-quadruplex DNA and RNA in life. Moreover, some molecules different from nucleic acids isolated from different vegetal sources or microorganisms show nucleobase moieties in their structure. Nucleoamino acids and peptidyl nucleosides belong to this molecular class. Closely related to the above, nucleopeptides, also known as nucleobase-bearing peptides, are chimeric derivatives of synthetic origin and more rarely isolated from plants. Herein, the self-assembly properties of a vast number of structures, belonging to the nucleic acid and nucleoamino acid/nucleopeptide family, are explored in light of the recent scientific literature. Moreover, several technologically relevant properties, such as the hydrogelation ability of some of the nucleobase-containing derivatives, are reviewed in order to make way for future experimental investigations of newly devised nucleobase-driven hydrogels. Nucleobase-containing molecules, such as mononucleosides, DNA, RNA, quadruplex (G4)-forming oligonucleotides, and nucleopeptides are paramount in gel and hydrogel formation owing to their distinctive molecular attributes and ability to self-assemble in biomolecular nanosystems with the most diverse applications in different fields of biomedicine and nanotechnology. In fact, these molecules and their gels present numerous advantages, underscoring their significance and applicability in both material science and biomedicine. Their versatility, capability for molecular recognition, responsiveness to stimuli, biocompatibility, and biodegradability collectively contribute to their prominence in modern nanotechnology and biomedicine. In this review, we emphasize the critical role of nucleobase-containing molecules of different nature in pioneering novel materials with multifaceted applications, highlighting their potential in therapy, diagnostics, and new nanomaterials fabrication as required for addressing numerous current biomedical and nanotechnological challenges.

Alzheimer disease (AD) is one of the most common and disabling neuropathies in the ever-growing aged population around the world, that especially affects Western countries. We are in urgent need of finding an effective therapy but also a valid prophylactic means of preventing AD. There is a growing attention currently paid to DNA vaccination, a technology particularly used during the COVID-19 era, which can be used also to potentially prevent or modify the course of neurological diseases, including AD. This paper aims to discuss the main features and hurdles encountered in the immunization and therapy against AD using DNA vaccine technology. Ultimately, this work aims to effectively promote the efforts in research for the development of safe and effective DNA and RNA vaccines for AD.

Asymmetry plays a major role in biology at all scales. This can be seen in the helix of DNA, the fact that the human heart is on the left side, or that most people use their right hand. A single protein such as Myosin 1D can induce helical motion in another molecule. This causes cells, organs, and even entire bodies to twist in a domino effect, causing left-right behaviour. More generally, athlete movements are often asymmetric and, during the physical rehabilitation after injury, the asymmetry is visually discernible. Herein, we review the molecular basis of the movement asymmetries and report on the available knowledge on the few therapeutics investigated so far such as meloxicam. From a more rehabilitative perspective, it is very important to use effective methods to control the process of resolving the injury-related movement asymmetry through the complex use of specialised exercises, measurements, and gait analysis, which can all provide useful information on the effectiveness of the rehabilitation plans. If for each athlete, the normal range of asymmetry is known, the asymmetry can be individually treated and the evolution can be monitored over time. Appropriate measures should be taken if the movement asymmetry is outside this range. In addition, genetic, physiological, and psychological factors relevant to athlete health should be considered in the process of assessing and improving exercise asymmetry, which we also discuss in this review. The main proposal of this work is that the movement asymmetries in athletes should be individually treated, while taking into account the athlete's genetics, physical condition, and previous injuries.

Some viruses are known to be associated with the onset of specific cancers. These microorganisms, oncogenic viruses or oncoviruses, can convert normal cells into cancer cells by modulating the central metabolic pathways or hampering genomic integrity mechanisms, consequently inhibiting the apoptotic machinery and/or enhancing cell proliferation. Seven oncogenic viruses are known to promote tumorigenesis in humans: human papillomavirus (HPV), hepatitis B and C viruses (HBV, HCV), Epstein-Barr virus (EBV), human T-cell leukemia virus 1 (HTLV-1), Kaposi sarcoma-associated herpesvirus (KSHV), and Merkel cell polyomavirus (MCPyV). Recent research indicates that SARS-CoV-2 infection and COVID-19 progression may predispose recovered patients to cancer onset and accelerate cancer development. This hypothesis is based on the growing evidence regarding the ability of SARS-CoV-2 to modulate oncogenic pathways, promoting chronic low-grade inflammation and causing tissue damage. Herein, we summarize the main relationships known to date between virus infection and cancer, providing a summary of the proposed biochemical mechanisms behind the cellular transformation. Mechanistically, DNA viruses (such as HPV, HBV, EBV, and MCPyV) encode their virus oncogenes. In contrast, RNA viruses (like HCV, HTLV-1) may encode oncogenes or trigger host oncogenes through cis-/-trans activation leading to different types of cancer. As for SARS-CoV-2, its role as an oncogenic virus seems to occur through the inhibition of oncosuppressors or controlling the metabolic and autophagy pathways in the infected cells. However, these effects could be significant in particular scenarios like those linked to severe COVID-19 or long COVID. On the other hand, looking at the SARS-CoV-2─cancer relationship from an opposite perspective, oncolytic effects and anti-tumor immune response were triggered by SARS-CoV-2 infection in some cases. In summary, our work aims to recall comprehensive attention from the scientific community to elucidate the effects of SARS-CoV-2 and, more in general, β-coronavirus infection on cancer susceptibility for cancer prevention or supporting therapeutic approaches.

Raman nanoparticle probes are a potent class of optical labels for the interrogation of pathological and physiological processes in cells, bioassays, and tissues. Herein, we review the recent advancements in fluorescent and Raman imaging using oligodeoxyribonucleotide (ODN)-based nanoparticles and nanostructures, which show promise as effective tools for live-cell analysis. These nanodevices can be used to investigate a vast number of biological processes occurring at various levels, starting from those involving organelles, cells, tissues, and whole living organisms. ODN-based fluorescent and Raman probes have contributed to the achievement of significant advancements in the comprehension of the role played by specific analytes in pathological processes and have inaugurated new possibilities for diagnosing health conditions. The technological implications that have emerged from the studies herein described could open new avenues for innovative diagnostics aimed at identifying socially relevant diseases like cancer through the utilization of intracellular markers and/or guide surgical procedures based on fluorescent or Raman imaging. Particularly complex probe structures have been developed within the past five years, creating a versatile toolbox for live-cell analysis, with each tool possessing its own strengths and limitations for specific studies. Analyzing the literature reports in the field, we predict that the development of ODN-based fluorescent and Raman probes will continue in the near future, disclosing novel ideas on their application in therapeutic and diagnostic strategies.

Laurus nobilis (bay laurel) is a natural source of biological compounds, and some of its extracts and phytocompounds are also endowed with antiviral activity toward the family of the severe acute respiratory syndrome (SARS)-associated β-coronaviruses. Some glycosidic laurel compounds such as laurusides were proposed as inhibitors of important protein targets of SARS-CoV-2, which clearly recalls their potential as anti-COVID-19 drugs. Due to the frequent genomic variations of the β-coronaviruses and the consequent importance of evaluating a new drug candidate with respect to the variants of the target β-coronavirus, we decided to investigate at an atomistic level the molecular interactions of the potential laurel-derived drugs laurusides 1 and 2 (L01 and L02, respectively) toward a well-conserved and crucial target, the 3C-like protease (M pro ), using the enzymes of both the wild-type of SARS-CoV-2 and of the more recent Omicron variant. Thus, we performed molecular dynamic (MD) simulations of laurusides-SARS-CoV-2 protease complexes to deepen the knowledge on the stability of the interaction and compare the effects of the targeting among the two genomic variants. We found that the Omicron mutation does not significantly impact the lauruside binding and that L02 connects more stably with respect to L01 in the complexes from both variants, even though both compounds prevalently interact within the same binding pocket. Although purely in silico, the current study highlights the potential role of bay laurel phytocompounds in the antiviral and specifically anti-coronavirus research and shows their potential binding toward M pro , corroborating the important commitment of bay laurel as functional food and disclosing novel scenarios of lauruside-based antiviral therapies.

It has been previously proposed that some types of cancer cells reprogram their metabolic pathways, favoring the metabolism of glucose by aerobic glycolysis (Warburg effect) instead of oxidative phosphorylation, mainly because the mitochondria of these cells are damaged, thus displaying mitochondrial dysfunction. However, in several cancers, the mitochondria do not exhibit any dysfunction and are also necessary for the tumor's growth and maintenance. Remarkably, if the mitochondria are dysfunctional, specific processes associated with the release of cytochrome c (cyt c), such as apoptosis, are significantly impaired. In these cases, cellular biotherapies such as mitochondrial transplantation could restore the intrinsic apoptotic processes necessary for the elimination of cancers. On the other hand, if the mitochondria are in good shape, drugs that target the mitochondria are a valid option for treating the related cancers. Famously, the mitochondria are targeted by the human papillomavirus (HPV), and HPV-related cancers depend on the host's mitochondria for their development and progression. On the other hand, the mitochondria are also important during treatment, such as chemotherapy, since they are key organelles for the increase in reactive oxygen species (ROS), which significantly increases cell death due to the presence of oxidative stress (OS). In this way, the mitochondria in HPV infection and in the development of HPV-related cancer could be targeted to reduce or eliminate HPV infections or HPV-related cancers. To our knowledge, there was no previous review specifically focusing on this topic, so this work aimed to summarize for the first time the potential use of mitochondria-targeting drugs, providing molecular insights on the main therapeutics developed so far in HPV infection and HPV-related cancer. Thus, we reviewed the mechanisms associated with HPV-related cancers, with their early proteins and mitochondrial apoptosis specifically induced by different compounds or drugs, in which these molecules induce the production of ROS, the activation of proapoptotic proteins, the deactivation of antiapoptotic proteins, the loss of mitochondrial membrane potential (Δψm), cyt c release, and the activation of caspases, which are all events which lead to the activation of mitochondrial apoptosis pathways. This makes these compounds and drugs potential anticancer therapeutics that target the mitochondria and could be exploited in future biomedical strategies.

In the modern era, the consumption of antibiotics represents a revolutionary weapon against several infectious diseases, contributing to the saving of millions of lives worldwide. However, the misuse of antibiotics for human and animal purposes has fueled the process of antimicrobial resistance (AMR), considered now a global emergency by the World Health Organization (WHO), which significantly increases the mortality risk and related medical costs linked to the management of bacterial diseases. The current research aiming at developing novel efficient antibiotics is very challenging, and just a few candidates have been identified so far due to the difficulties connected with AMR. Therefore, novel therapeutic or prophylactic strategies to fight AMR are urgently needed. In this scenario, vaccines constitute a promising approach that proves to be crucial in preventing pathogen spreading in primary infections and in minimizing the usage of antibiotics following secondary bacterial infections. Unfortunately, most of the vaccines developed against the main resistant pathogens are still under preclinical and clinical evaluation due to the complexity of pathogens and technical difficulties. In this review, we describe not only the main causes of AMR and the role of vaccines in reducing the burden of infectious diseases, but we also report on specific prophylactic advancements against some of the main pathogens, focusing on new strategies that aim at improving vaccine efficiency., Competing Interests: The authors declare no conflicts of interest.

A complex network of processes inside the human immune system provides resistance against a wide range of pathologies. These defenses form an innate and adaptive immunity, in which certain immune components work together to counteract infections. In addition to inherited variables, the susceptibility to diseases may be influenced by factors such as lifestyle choices and aging, as well as environmental determinants. It has been shown that certain dietary chemical components regulate signal transduction and cell morphologies which, in turn, have consequences on pathophysiology. The consumption of some functional foods may increase immune cell activity, defending us against a number of diseases, including those caused by viruses. Here, we investigate a range of functional foods, often marketed as immune system boosters, in an attempt to find indications of their potential protective role against diseases caused by viruses, such as the influenza viruses (A and B), herpes simplex virus (HSV), and severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), in some cases mediated by gut microbiota. We also discuss the molecular mechanisms that govern the protective effects of some functional foods and their molecular constituents. The main message of this review is that discovering foods that are able to strengthen the immune system can be a winning weapon against viral diseases. In addition, understanding how the dietary components function can aid in the development of novel strategies for maintaining human bodily health and keeping our immune systems strong.

A new family of Cu(II) and Ni(II) salen complexes was synthesized and fully characterized through various physicochemical methods. Their catalytic activity was evaluated in the phase transfer C α -alkylation reaction of the Schiff bases of D,L-alanine ester and benzaldehyde derivatives. It was found that the introduction of a chlorine atom into the ortho - and para -positions of the phenyl ring of the substrate resulted in an increase in both the chemical yield and the asymmetric induction ( ee 66-98%). The highest enantiomeric excess was achieved in the case of a Cu(II) salen complex based on ( S , S )-cyclohexanediamine and salicylaldehyde at -20 °C. The occurrence of a bulky substituent in the ligand present in the complexes led to a drastic decrease in ee and chemical yield. For instance, the introduction of bulky substituents at positions 3 and 5 of the phenyl ring of the catalyst resulted in a complete loss of the stereoselectivity control in the alkylation reaction.

The present work reports the synthesis of new N4-donor compounds carrying p-xylyl spacers in their structure. Different Schiff base aliphatic N-donors were obtained synthetically and subsequently evaluated for their ability to interact with two models of nucleic acids: calf-thymus DNA (CT-DNA) and the RNA from yeast Saccharomyces cerevisiae (herein simply indicated as RNA). In more detail, by condensing p-xylylenediamine and a series of aldehydes, we obtained the following Schiff base ligands: 2-thiazolecarboxaldehyde ( L1 ), pyridine-2-carboxaldehyde ( L2 ), 5-methylisoxazole-3-carboxaldehyde ( L3 ), 1-methyl-2-imidazolecarboxaldehyde ( L4 ), and quinoline-2-carboxaldehyde ( L5 ). The structural characterisation of the ligands L1 - L5 (X-ray, 1 H NMR, 13 C NMR, elemental analysis) and of the coordination polymers {[CuL1]PF 6 } n (herein referred to as Polymer1 ) and {[AgL1]BF 4 } n, (herein referred to as Polymer2 , X-ray, 1 H NMR, ESI-MS) is herein described in detail. The single crystal X-ray structures of complexes Polymer1 and Polymer2 were also investigated, leading to the description of one-dimensional coordination polymers. The spectroscopic and in silico evaluation of the most promising compounds as DNA and RNA binders, as well as the study of the influence of the 1D supramolecular polymers Polymer1 and Polymer2 on the proliferation of Escherichia coli bacteria, were performed in view of their nucleic acid-modulating and antimicrobial applications. Spectroscopic measurements (UV-Vis) combined with molecular docking calculations suggest that the thiazolecarboxaldehyde derivative L1 is able to bind CT-DNA with a mechanism different from intercalation involving the thiazole ring in the molecular recognition and shows a binding affinity with DNA higher than RNA. Finally, Polymer2 was shown to slow down the proliferation of bacteria much more effectively than the free Ag(I) salt.

Physical rehabilitation plays a fundamental role in the management of individuals with disabilities associated with age-related muscle loss or affected by catastrophic conditions such as trauma, surgery, cancer or other severe pathologies. These events have in common an extended period of physical inactivity. Patients who undergo prolonged bed rest often present with a number of complications; for example, muscle loss that can exacerbate existing conditions determined by sarcopenia, which in turn greatly limits physical functions. The main scope of this work is to summarize certain key strategies for the physiotherapeutic management of physically inactive patients, regardless of the reason behind their prolonged bed rest, with a particular focus on physical rehabilitation, nutrition and forest-bathing. The importance of correct nutrition in counter-acting the loss of muscle mass and consequent function is explored alongside a description of the main nutrients that are needed for muscle regeneration. From a biomolecular perspective, some specific molecular mechanisms associated with physical rehabilitation are also reported not only in the context of physical therapy, but also within nature-inspired techniques, such as forest-bathing as well as body self-healing. Combining a targeted physiotherapeutic approach with an appropriate diet as well as nature-based therapy could thus help with the recovery of bed ridden patients.

G-quadruplex (G4) oligonucleotides are higher-order DNA and RNA secondary structures of enormous relevance due to their implication in several biological processes and pathological states in different organisms. Strategies aiming at modulating human G4 structures and their interrelated functions are first-line approaches in modern research aiming at finding new potential anticancer treatments or G4-based aptamers for various biomedical and biotechnological applications. Plants offer a cornucopia of phytocompounds that, in many cases, are effective in binding and modulating the thermal stability of G4s and, on the other hand, contain almost unexplored G4 motifs in their genome that could inspire new biotechnological strategies. Herein, we describe some G4 structures found in plants, summarizing the existing knowledge of their functions and biological role. Moreover, we review some of the most promising G4 ligands isolated from vegetal sources and report on the known relationships between such phytochemicals and G4-mediated biological processes that make them potential leads in the pharmaceutical sector.

i-Motifs, also known as i-tetraplexes, are secondary structures of DNA occurring in cytosine-rich oligonucleotides (CROs) that recall increasing interest in the scientific community for their relevance in various biological processes and DNA nanotechnology. This study reports the design of new structurally modified CROs, named Double-Ended-Linker-CROs (DEL-CROs), capable of forming stable i-motif structures. Here, two C-rich strands having sequences d(AC 4 A) and d(C 6 ) have been attached, in a parallel fashion, to the two linker's edges by their 3' or 5' ends. The resulting DEL-CROs have been investigated for their capability to form i-motif structures by circular dichroism, poly-acrylamide gel electrophoresis, HPLC-size-exclusion chromatography, and NMR studies. This investigation established that DEL-CROs could form more stable i-motif structures than the corresponding unmodified CROs. In particular, the i-motif formed by DEL-5'-d(C 6 ) 2 resulted stable enough to be detected even at near physiological conditions (37 °C, pH 7.0). The results open the way to developing pH-switchable nanocarriers and aptamers based on suitably functionalized DEL-CROs., Competing Interests: Declaration of competing interest The authors declare that they have no conflict of interests., (Copyright © 2022 Elsevier B.V. All rights reserved.)

Multivalent molecules are a potential group of bioactive compounds endowed with high affinity and specificity in innovative biomolecule-targeting therapeutic approaches. Herein, we report on a new and versatile N,N,N,N-donor ligand L (1 R ,4 R )-N1,N4-bis(quinolin-2-ylmethylene)cyclohexane-1,4-diamine with two coordinating quinoline moieties connected with trans -1,4-diaminocyclohexane. It coordinates Cu + forming a [2 × 2] square grid-type complex C1 [Cu 4 L 4 ] 4+ and Ni 2+ giving a triangle-type complex C2 [Ni 3 L 3 ] 6+ . We screened their potential as versatile metal-based Serum Albumin (SA), double helical and G-quadruplex DNA binders taking advantage of their shape, size and stability effects using different spectroscopic experiments (UV-Vis, fluorescence, circular dichroism). The findings of our work suggest the potential utility of the metal complexes herein described in the context of the new drug discovery.

Willardiine is a nonprotein amino acid containing uracil, and thus classified as nucleobase amino acid or nucleoamino acid, that together with isowillardiine forms the family of uracilylalanines isolated more than six decades ago in higher plants. Willardiine acts as a partial agonist of ionotropic glutamate receptors and more in particular it agonizes the non-N-methyl-D-aspartate (non-NMDA) receptors of L-glutamate: ie. the α-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid (AMPA) and kainate receptors. Several analogues and derivatives of willardiine have been synthesised in the laboratory in the last decades and these compounds show different binding affinities for the non-NMDA receptors. More in detail, the willardiine analogues have been employed not only in the investigation of the structure of AMPA and kainate receptors, but also to evaluate the effects of receptor activation in the various brain regions. Remarkably, there are a number of neurological diseases determined by alterations in glutamate signaling, and thus, ligands for AMPA and kainate receptors deserve attention as potential neurodrugs. In fact, similar to willardiine its analogues often act as agonists of AMPA and kainate receptors. A particular importance should be recognized to willardiine and its thymine-based analogue AlaT also in the peptide chemistry field. In fact, besides the naturally-occurring short nucleopeptides isolated from plant sources, there are different examples in which this class of nucleoamino acids was investigated for nucleopeptide development. The applications are various ranging from the realization of nucleopeptide/DNA chimeras for diagnostic applications, and nucleoamino acid derivatization of proteins for facilitating protein-nucleic acid interaction, to nucleopeptide-nucleopeptide molecular recognition for nanotechnological applications. All the above aspects on both chemistry and biotechnological applications of willardine/willardine-analogues and nucleopeptide will be reviewed in this work.

1,3-diaryl-2-propanone derivatives are synthetic compounds used as building blocks for the realization not only of antimicrobial drugs but also of new nanomaterials thanks to their ability to self-assemble in solution and interact with nucleopeptides. However, their ability to interact with proteins is a scarcely investigated theme considering the therapeutic importance that 1,3-diaryl-2-propanones could have in the modulation of protein-driven processes. Within this scope, we investigated the protein binding ability of 1,3-bis(1'-uracilyl)-2-propanone, which was previously synthesized in our laboratory utilizing a Dakin-West reaction and herein indicated as U2O, using bovine serum albumin (BSA) as the model protein. Through circular dichroism (CD) and UV spectroscopy, we demonstrated that the compound, but not the similar thymine derivative T2O, was able to alter the secondary structure of the serum albumin leading to significant consequences in terms of BSA structure with respect to the unbound protein (Δ β-turn + Δ β-sheet = +23.6%, Δ α = -16.7%) as revealed in our CD binding studies. Moreover, molecular docking studies suggested that U2O is preferentially housed in the domain IIIB of the protein, and its affinity for the albumin is higher than that of the reference ligand HA 14-1 (HDOCK score (top 1-3 poses): -157.11 ± 1.38 (U2O); -129.80 ± 6.92 (HA 14-1); binding energy: -7.6 kcal/mol (U2O); -5.9 kcal/mol (HA 14-1)) and T2O (HDOCK score (top 1-3 poses): -149.93 ± 2.35; binding energy: -7.0 kcal/mol). Overall, the above findings suggest the ability of 1,3-bis(1'-uracilyl)-2-propanone to bind serum albumins and the observed reduction of the α-helix structure with the concomitant increase in the β-structure are consistent with a partial protein destabilization due to the interaction with U2O.

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins' CD spectra starting from their ".pdb" file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands' profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.

The recent development of mRNA vaccines against the SARS-CoV-2 infection has turned the spotlight on the potential of nucleic acids as innovative prophylactic agents and as diagnostic and therapeutic tools. Until now, their use has been severely limited by their reduced half-life in the biological environment and the difficulties related to their transport to target cells. These limiting aspects can now be overcome by resorting to chemical modifications in the drug and using appropriate nanocarriers, respectively. Oligonucleotides can interact with complementary sequences of nucleic acid targets, forming stable complexes and determining their loss of function. An alternative strategy uses nucleic acid aptamers that, like the antibodies, bind to specific proteins to modulate their activity. In this review, the authors will examine the recent literature on nucleic acids-based strategies in the COVID-19 era, focusing the attention on their applications for the prophylaxis of COVID-19, but also on antisense- and aptamer-based strategies directed to the diagnosis and therapy of the coronavirus pandemic.

Humanity may benefit greatly from intact riverine ecosystems not only because they supply water to be used in the most common human activities, but also for the effects that clean rivers can have on human health. Herein, we used a computational approach to show that some phytochemicals produced by riparian plants as secondary metabolites, which are naturally released into river waters, can have therapeutic properties. These include antipsoriatic activities which we demonstrated in silico by modelling the interaction of apiin, guanosine and hyperoside, a few main river plant metabolites, with NF-kB, IL-17 and IL-36, which are recognized targets involved in psoriasis disease. In particular, we found that apiin and hyperoside are endowed with docking energies and binding affinities which are more favorable than the known reference inhibitors of the three protein targets whilst, in silico, guanosine shows comparable activity with respect to the inhibitors of IL-36 and NF-kB. The low skin permeation (logKp < −8) we predicted for apiin and hyperoside led us to hypothesize their possible utilization as topic antipsoriatic therapeutics, and in particular after PAINS (pan-assay interference compounds) score evaluation, we reached the conclusion that apiin, with no predicted tendency to react nonspecifically with the numerous targets involved in the biological cellular pathways, is particularly interesting for the desired therapeutic application.

Benzofuran derivatives are synthetic compounds that are finding an increasing interest in the scientific community not only as building blocks for the realization of new materials, but also as potential drugs thanks to their ability to interact with nucleic acids, interfere with the amyloid peptide aggregation and cancer cell cycle. However, their ability to interact with proteins is a theme still in need of investigation for the therapeutic importance that benzofurans could have in the modulation of protein-driven processes and for the possibility of making use of serum albumins as benzofurans delivery systems. To this scope, we investigated the protein binding ability of two 4-nitrophenyl-functionalized benzofurans previously synthesized in our laboratory and herein indicated as BF1 and BDF1, which differed for the number of furan rings (a single moiety in BF1, two in BDF1), using bovine serum albumin (BSA) as a model protein. By circular dichroism (CD) spectroscopy we demonstrated the ability of the two heteroaromatic compounds to alter the secondary structure of the serum albumin leading to different consequences in terms of BSA thermal stability with respect to the unbound protein (ΔT m > 3 °C for BF1, -0.8 °C for BDF1 with respect to unbound BSA, in PBS buffer, pH 7.5) as revealed in our CD melting studies. Moreover, a molecular docking study allowed us to compare the possible ligand binding modes of the mono and difuranic derivatives showing that while BF1 is preferentially housed in the interior of protein structure, BDF1 is predicted to bind the albumin surface with a lower affinity than BF1. Interestingly, the different affinity for the protein target predicted computationally was confirmed also experimentally by fluorescence spectroscopy (k D = 142.4 ± 64.6 nM for BDF1 vs. 28.4 ± 10.1 nM for BF1). Overall, the above findings suggest the ability of benzofurans to bind serum albumins that could act as their carriers in drug delivery applications.

Old forests containing ancient trees are essential ecosystems for life on earth. Mechanisms that happen both deep in the root systems and in the highest canopies ensure the viability of our planet. Old forests fix large quantities of atmospheric CO 2 , produce oxygen, create micro-climates and irreplaceable habitats, in sharp contrast to young forests and monoculture forests. The current intense logging activities induce rapid, adverse effects on our ecosystems and climate. Here we review large old trees with a focus on ecosystem preservation, climate issues, and therapeutic potential. We found that old forests continue to sequester carbon and fix nitrogen. Old trees control below-ground conditions that are essential for tree regeneration. Old forests create micro-climates that slow global warming and are irreplaceable habitats for many endangered species. Old trees produce phytochemicals with many biomedical properties. Old trees also host particular fungi with untapped medicinal potential, including the Agarikon, Fomitopsis officinalis , which is currently being tested against the coronavirus disease 2019 (COVID-19). Large old trees are an important part of our combined cultural heritage, providing people with aesthetic, symbolic, religious, and historical cues. Bringing their numerous environmental, oceanic, ecological, therapeutic, and socio-cultural benefits to the fore, and learning to appreciate old trees in a holistic manner could contribute to halting the worldwide decline of old-growth forests., (© The Author(s) 2022.)

Strengthening the immune system in order to better withstand the threat of COVID-19 is an important way to ensure the protection of our health against the current pandemic associated with SARS-CoV-2. There are many ways to achieve this, but with current circumstances, certain modalities stand out as being the most valid and are certainly worth greater consideration. Here we review the effects that particular immuno-strengthening activities can have on limiting the severity of COVID-19 disease as well as preventing virus infection. Physical activity, in particular, should not be discounted as an important method of prevention of viral diseases as it triggers many biological processes within the human body which in turn lead to heightened natural defences against viral infections. When exercise is performed in forested areas, these protective health benefits may be increased since many plant species emit biogenic volatile compounds (VOCs) which, when inhaled, have many protective properties. These VOCs have been shown in particular to have immunostimulatory effects on the human body and, thus, they could be of use in the prevention and/or treatment of COVID-19. Being amongst trees may also help to alleviate stress and anxiety, lowering cortisol levels and consequently helping the proper functioning of the immune system. In the following work, we have performed an analysis of the available scientific literature which looks at the effects of physical exercise as well as 'forest-bathing' on the immune system's ability to fight disease, especially of course as it relates to COVID-19. Our review aims at shedding light on the benefits of exercising outdoors in green areas and suggests reforestation as a protective measure against future outbreaks., Competing Interests: Conflict of interestThe authors declare that they have no conflict of interest., (© The Author(s), under exclusive licence to Springer Nature Switzerland AG 2021.)

The aim of this review article is to summarize the knowledge available to date on prophylaxis achievements in the frame of the fight against Coronaviruses. This work will give an overview of what is reported in the recent literature on vaccines (under investigation or already developed like BNT162b2, mRNA-1273, and ChAdOx1-S) effective against the most pathogenic Coronaviruses (SARS-CoV-1, MERS-CoV-1, and SARS-CoV-2), with of course particular attention paid to those under development or already in use to combat the current COVID-19 (CoronaVIrus Disease 19) pandemic. Our main objective is to make a contribution to the comprehension, even at a molecular level, of what is currently ready for anti-SARS-CoV-2 prophylactic intervention, as well as to provide the reader with an overall picture of the most innovative approaches for the development of vaccines that could be of general utility in the fight against the most pathogenic Coronaviruses., (Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.net.)

The coronavirus disease 2019 (COVID-19) is causing major sanitary and socioeconomic issues, yet some locations are less impacted than others. While densely populated areas are likely to favor viral transmission, we hypothesize that other environmental factors could explain lower cases in some areas. We studied COVID-19 impact and population statistics in highly forested Mediterranean Italian regions versus some northern regions where the amount of trees per capita is much lower. We also evaluated the affinity of Mediterranean plant-emitted volatile organic compounds (VOCs) isoprene, α-pinene, linalool and limonene for COVID-19 protein targets by molecular docking modeling. Results show that while mean death number increased about 4 times from 2020 to 2021, the percentage of deaths per population (0.06-0.10%) was lower in the greener Mediterranean regions such as Sardinia, Calabria and Basilica versus northern regions with low forest coverage, such as Lombardy (0.33%) and Emilia Romagna (0.29%). Data also show that the pandemic severity cannot be explained solely by population density. Modeling reveals that plant organic compounds could bind and interfere with the complex formed by the receptor binding domain of the coronavirus spike protein with the human cell receptor. Overall, our findings are likely explained by sea proximity and mild climate, Mediterranean diet and the abundance of non-deciduous Mediterranean plants which emit immunomodulatory and antiviral compounds. Potential implications include 'forest bathing' as a therapeutic practice, designing nasal sprays containing plant volatile organic compounds, and preserving and increasing forest coverage., Supplementary Information: The online version contains supplementary material available at 10.1007/s10311-021-01309-5., Competing Interests: Conflict of interestThe author declared that there is no conflict of interest., (© The Author(s), under exclusive licence to Springer Nature Switzerland AG 2021.)

The practice of spending time in green areas to gain the health benefits provided by trees is well known, especially in Asia, as 'forest bathing', and the consequent protective and experimentally detectable effects on the human body have been linked to the biogenic volatile organic compounds released by plants. Houseplants are common in houses over the globe and are particularly appreciated for aesthetic reasons as well for their ability to purify air from some environmental volatile pollutants indoors. However, to the best of our knowledge, no attempt has been made to describe the health benefits achievable from houseplants thanks to the biogenic volatile organic compounds released, especially during the day, from some of them. Therefore, we performed the present study, based on both a literature analysis and in silico studies, to investigate whether the volatile compounds and aerosol constituents emitted by some of the most common houseplants (such as peace lily plant, Spathiphyllum wallisii , and iron plant, Aspidistra eliator ) could be exploited in 'indoor forest bathing' approaches, as proposed here for the first time not only in private houses but also public spaces, such as offices, hospitals, and schools. By using molecular docking (MD) and other in silico methodologies for estimating vapor pressures and chemico-physical/pharmacokinetic properties prediction, we found that β-costol is an organic compound, emitted in appreciable amounts by the houseplant Spathiphyllum wallisii , endowed with potential antiviral properties as emerged by our MD calculations in a SARS-CoV-2 M pro (main protease) inhibition study, together with sesquirosefuran. Our studies suggest that the anti-COVID-19 potential of these houseplant-emitted compounds is comparable or even higher than known M pro inhibitors, such as eugenol, and sustain the utility of houseplants as indoor biogenic volatile organic compound emitters for immunity boosting and health protection.