Search

Abstract As spaceflight becomes more common with commercial crews, blood-based measures of crew health can guide both astronaut biomedicine and countermeasures. By profiling plasma proteins, metabolites, and extracellular vesicles/particles (EVPs) from the SpaceX Inspiration4 crew, we generated “spaceflight secretome profiles,” which showed significant differences in coagulation, oxidative stress, and brain-enriched proteins. While >93% of differentially abundant proteins (DAPs) in vesicles and metabolites recovered within six months, the majority (73%) of plasma DAPs were still perturbed post-flight. Moreover, these proteomic alterations correlated better with peripheral blood mononuclear cells than whole blood, suggesting that immune cells contribute more DAPs than erythrocytes. Finally, to discern possible mechanisms leading to brain-enriched protein detection and blood-brain barrier (BBB) disruption, we examined protein changes in dissected brains of spaceflight mice, which showed increases in PECAM-1, a marker of BBB integrity. These data highlight how even short-duration spaceflight can disrupt human and murine physiology and identify spaceflight biomarkers that can guide countermeasure development.

Key Clinical Message An encephalocele is a congenital malformation characterized by protrusion of the intracranial contents through a cranial defect. We report that a fetus of a pregnant mother who had two consecutive pregnancies with ultrasound‐detected encephalocele carried compound heterozygous variants in B3GALNT2 NM_152490.5:c.[1423C > T (p.Gln475Ter)]; [261‐2A > G] of maternal and paternal origins, respectively, as confirmed by exome sequencing followed by Sanger sequencing validation. The present case implies that mutations in B3GALNT2, a well‐known dystroglycanopathy causative gene, may result in a phenotype of neural tube defect, providing new insights into the clinical spectrum of B3GALNT2‐related disorders. Our study may contribute to prenatal screening/diagnosis and genetic counseling of congenital brain malformations.

Abstract Mitochondrial diseases (MDs) were a large group multisystem disorders, attributable in part to the dual genomic control. The advent of massively sequencing has improved diagnostic rates and speed, and was increasingly being used as a first-line diagnostic test. Paediatric patients (aged

Malware detection method based on gray images has received a lot of attention because it does not require disassembly and can obtain a high detection accuracy. There are some adversarial attacks against this type of detection method which has been put forward, but most of the current adversarial attack methods cannot ensure that the generated adversarial examples can remain the availability or functionality of the original PE file, or choose to add bytecode at the bottom of a PE file that is easy to be accurately detected through the file header information. Based on the analysis of the section alignment mechanism and file alignment mechanism of PE files, this paper proposes a bytecode attack method that can remain the availability and functionality (BARAF) of PE files. By modifying or adding bytecodes in the gap spaces generated by the file alignment mechanism and the expansion spaces derived from the section alignment mechanism, BARAF generates the adversarial example that can remain the availability and functionality to deceive the malware detection method based on gray images. Experimental results show that the adversarial examples generated by BARAF can reduce the accuracy of the malware detection method based on gray images by 31.58 percentage points at most, and it is difficult to detect the adversarial examples accurately through the file header information.

Abstract There is increasing awareness that oxidative stress may be implicated in the pathophysiology of autism spectrum disorder (ASD). Here we aimed to investigate blood oxidative stress marker profile in ASD children by a meta-analysis. Two independent investigators systematically searched Web of Science, PubMed, and Cochrane Library and extracted data from 87 studies with 4928 ASD children and 4181 healthy control (HC) children. The meta-analysis showed that blood concentrations of oxidative glutathione (GSSG), malondialdehyde, homocysteine, S-adenosylhomocysteine, nitric oxide, and copper were higher in children with ASD than that of HC children. In contrast, blood reduced glutathione (GSH), total glutathione (tGSH), GSH/GSSG, tGSH/GSSG, methionine, cysteine, vitamin B9, vitamin D, vitamin B12, vitamin E, S-adenosylmethionine/S-adenosylhomocysteine, and calcium concentrations were significantly reduced in children with ASD relative to HC children. However, there were no significance differences between ASD children and HC children for the other 17 potential markers. Heterogeneities among studies were found for most markers, and meta-regressions indicated that age and publication year may influence the meta-analysis results. These results therefore clarified blood oxidative stress profile in children with ASD, strengthening clinical evidence of increased oxidative stress implicating in pathogenesis of ASD. Additionally, given the consistent and large effective size, glutathione metabolism biomarkers have the potential to inform early diagnosis of ASD.

Immunoglobulin heavy chain translocations (IGH-t) have occasionally been reported in Chinese patients with chronic lymphocytic leukemia (CLL). The objective of the present study was to identify the clinicopathologic features of patients with IGH-t CLL and compare them with those of patients with non-IGH-t CLL. We performed fluorescence in situ hybridization (FISH) based on a routine CLL prognostic FISH panel using IGH, IGH-BCL2, BCL3, IGH-CMYC, and BCL6 FISH probes. Furthermore, we retrospectively evaluated the clinical features of 138 newly diagnosed CLL patients via chromosome banding analysis (CBA), FISH, and targeted next-generation sequencing. IGH-t was identified in 25 patients (18.1%). Patients with IGH-t CLL had lower flow scores than those with non-IGH-t CLL. The most frequent translocation was t(14;18) (10 patients), followed by t(14;19) (3 patients), and t(2;14)(p13;q32), t(7;14)(q21.2;q12), t(9;14)(p13;q32) (3 patients). The remaining nine patients included three with abnormal karyotypes without translocation involving 14q32, four with a normal karyotype, and two who failed CBA. The most frequently concomitant FISH-detected aberrations were 13q deletion, followed by +12 and TP53 deletion, while one case involved ATM deletion. Complex karyotypes were detected in five patients with IGH-t CLL, in whom all partner genes were non-BCL2. Available mutational information indicated that KMT2D mutation was the most frequent mutation among tested 70 patients, while TP53 mutation was the most frequent mutation in the IGH-t group. Moreover, the IGH-t group had higher FBXW7 (P=0.014) and ATM (P=0.004) mutations than the non-IGH-t group, and this difference was statistically significant. Our study demonstrates that IGH-t is not uncommon among Chinese CLL patients, and that its partner genes are multiple. The gene mutational profile of the IGH-t group was distinct from that of the non-IGH-t group, and the concomitant chromosomal abnormalities within the IGH-t CLL group differed. Thus, identification of IGH-t and its partner genes in CLL patients may help further refine risk stratification and strengthen the accurate management in CLL patients.

ObjectiveTo study the burden of neurodevelopmental diseases (NDDs) via cost-of-illness analysis of Chinese patients with genetic diagnosis.MethodsWe recruited NDD patients (0–18 years old) with genetic diagnosis (GD) from September 1, 2020 to January 30, 2021. We gathered basic information on the details of diagnosis, as well as the direct medical cost, direct non-healthcare cost and indirect cost before and after receiving GD. We corrected the cost for time biases by calculating the cost per day for each patient.ResultsFor the 502 patients with NDDs, the mean age was 4.08 ± 3.47. The household income was 0.6 (0.4, 1.0) 10,000 CNY per-month on average. The direct medical cost, direct non-healthcare cost and indirect cost were 12.27 (7.36, 22.23) 10,000 CNY, 1.45 (0.73, 2.69)10,000 CNY and 14.14(4.80, 28.25) 10,000 CNY per patient, respectively. Every patient received 1.20 (0.34, 3.60) 10,000 CNY on average (15.91%) from insurance. The daily total cost after receiving GD were ~62.48% lower than those before GD (191.59 CNY vs. 71.45 CNY). The descend range of lab cost (95.77%, P < 0.05) was the largest, followed by drugs (91.39%, P < 0.05), hospitalization (90.85%, P < 0.05), and consultation (57.41%, P < 0.05). The cost of rehabilitation kept slightly increasing but there were no significant differences (P > 0.05). The daily direct medical cost of each patient fell by 75.26% (P < 0.05) from 311.79 CNY to 77.14 CNY when the diagnostic age was younger than 1, and declined by 49.30% (P < 0.05) and 8.97% (P > 0.05) when the diagnostic age was 1–3 and older than 3, respectively.ConclusionsEarly genetic diagnosis is crucial for to reducing the burden of disease because of the amount of money spent was lower when they are diagnosed at younger age. Patients with NDDs can incur a heavy economic burden, especially in rehabilitation cost and indirect cost, because the insurance coverage for patients is low, so it is urgent for governments to pay more attention to these issues.

Abstract Background Microglia-mediated neuroinflammation is associated with epilepsy. Switching microglial polarization from the pro-inflammatory M1 phenotype to the anti-inflammatory M2 phenotype represents a novel therapeutic strategy for mitigating epileptogenesis. We previously found that dynorphins protected against epilepsy via activation of kappa opioid receptor (KOR). Here, this study aims to investigate the role and the mechanism of dynorphin in regulating microglial polarization. Methods A pilocarpine-induced rat model of epilepsy was established and lipopolysaccharide (LPS)-activated BV-2 microglial cells were used as an inflammatory model to explore the mechanism of dynorphin regulating microglial polarization. Results Overexpression of the dynorphin precursor protein prodynorphin (PDYN) alleviated the pilocarpine-induced neuronal apoptosis, promoted microglial polarization to the M2 phenotype, and inhibited pilocarpine-induced Toll-like receptor 4 (TLR4)/nuclear factor-kappa B (NF-κB) pathway in the hippocampi of epileptic rats. Dynorphin activation of KOR promoted microglial M2 polarization via inhibiting TLR4/NF-κB pathway in LPS-stimulated BV-2 microglial cells. Moreover, dynorphin/KOR regulated microglial M2 polarization inhibited apoptosis of the primary mouse hippocampal neurons. Conclusion In conclusion, dynorphin activation of KOR promotes microglia polarization toward M2 phenotype via inhibiting TLR4/NF-κB pathway.

Objective: To prove microtubule associated serine/threonine kinase 3 (MAST3) gene is associated with neurodevelopmental diseases (NDD) and the genotype-phenotype correlation.Methods: Trio exome sequencing (trio ES) was performed on four NDD trios. Bioinformatic analysis was conducted based on large-scale genome sequencing data and human brain transcriptomic data. Further in vivo zebrafish studies were performed.Results: In our study, we identified four de novo MAST3 variants (NM_015016.1: c.302C > T:p.Ser101Phe; c.311C > T:p.Ser104Leu; c.1543G > A:p.Gly515Ser; and c.1547T > C:p.Leu516Pro) in four patients with developmental and epileptic encephalopathy (DEE) separately. Clinical heterogeneities were observed in patients carrying variants in domain of unknown function (DUF) and serine-threonine kinase (STK) domain separately. Using the published large-scale exome sequencing data, higher CADD scores of missense variants in DUF domain were found in NDD cohort compared with gnomAD database. In addition, we obtained an excess of missense variants in DUF domain when compared autistic spectrum disorder (ASD) cohort with gnomAD database, similarly an excess of missense variants in STK domain when compared DEE cohort with gnomAD database. Based on Brainspan datasets, we showed that MAST3 expression was significantly upregulated in ASD and DEE-related brain regions and was functionally linked with DEE genes. In zebrafish model, abnormal morphology of central nervous system was observed in mast3a/b crispants.Conclusion: Our results support the possibility that MAST3 is a novel gene associated with NDD which could expand the genetic spectrum for NDD. The genotype-phenotype correlation may contribute to future genetic counseling.

Background:MN1 C-terminal truncation (MCTT) syndrome is caused by variants in the C-terminal region of MN1, which were first described in 2020. The clinical features of MCTT syndrome includes severe neurodevelopmental and brain abnormalities. We reported on a patient who carried the MN1 variant in the C-terminal region with mild developmental delay and normal brain magnetic resonance image (MRI).Methods: Detailed clinical information was collected in the pedigree. Whole-exome sequencing (WES) accompanied with Sanger sequencing validation were performed. A functional study based on HEK239T cells was performed.Results: A de novo heterozygous c.3734delT: p.L1245fs variant was detected. HEK239T cells transinfected with the de novo variant showed decreased proliferation, enhanced apoptotic rate, and MN1 nuclear aggregation.Conclusion: Our study expended the clinical and genetic spectrum of MCTT which contributes to the genetic counseling of the MN1 gene.

Background: The molybdenum cofactor (Moco) deficiency in humans results in the inactivity of molybdenum-dependent enzymes and is caused by pathogenic variants in MOCS1 (Molybdenum cofactor synthesis 1), MOCS2 (Molybdenum cofactor synthesis 2), and GPHN (Gephyrin). These genes along with MOCS3 (Molybdenum cofactor synthesis 3) are involved in Moco biosynthesis and providing cofactors to Moco-dependent enzymes. Until now, there was no study to confirm that MOCS3 is a causative gene of Moco deficiency.Methods: Detailed clinical information was collected in the pedigree. The Whole-exome sequencing (WES) accompanied with Sanger sequencing validation were performed.Results: We described the clinical presentations of an infant, born to a non-consanguineous healthy family, diagnosed as having MOCS3 variants caused Moco deficiency and showing typical features of Moco deficiency including severe neurologic symptoms and cystic encephalomalacia in the brain MRI, resulting in neonatal death. Compound heterozygous variants in the MOCS3 gene were identified by WES. Positive sulfite and decreased levels of uric acid in plasma and urine were detected.Conclusion: To our knowledge, this is the first case of MOCS3 variants causing Moco deficiency. Our study may contribute to genetic diagnosis of Moco deficiency and future genetic counseling.

Knee osteoarthritis (KOA) is a progressive disease, which is mainly manifested by knee joint pain, stiffness, restricted flexion and extension, joint instability, decreased motor control, and low proprioception. KOA significantly impacts an individual's overall health and quality of life. The increasing incidence rate of KOA in China indicates the importance of related rehabilitation research and practice. Traditional Chinese medicine (TCM) rehabilitation places an emphasis on the function and differential diagnosis, which has inherent characteristics and advantages for KOA treatment. Based on previous literature and clinical TCM knowledge of KOA dysfunction, our research team summarized KOA syndromes into five categories:"comorbidity of tendons with bones", "coexistence of arthralgia and flaccidity", "mixture of asthenia with sthenia", "imbalance between dynamic and static statuses", and"disorder between hardness and softness". At different KOA stages, the comorbidity of tendons with bones is the basic pathogenic characteristic of KOA dysfunction, which focuses on disease location and extends throughout the KOA process; coexistence of arthralgia and flaccidity, and mixture of asthenia with sthenia emphasize the basic characteristic of KOA dysfunction; imbalance between dynamic and static statuses is the main factor of KOA relapse and aggravation, which focuses on KOA etiology; disorder between hardness and softness emphasizes both syndrome and etiology, indicating the disorder between bones and tendons. TCM rehabilitation theory for KOA and serves as a reference and clinical guidance for its rehabilitation treatment. The analysis attempts to further improve the TCM rehabilitation theory for KOA and provides a reference for its rehabilitation treatment.

Glycosylphosphatidylinositol (GPI) is a membrane anchor for cell surface proteins. Inherited GPI deficiencies are a new subclass of congenital disorders of glycosylation. Phosphatidylinositol glycan class S (PIGS) is a subunit of the GPI transamidase which plays important roles in many biological processes. In this study, we present a Chinese boy with infantile spasms (ISs), severe global developmental delay, hearing loss, visual impairment (cortical blindness), hypotonia, and intellectual disability and whose whole-exome sequencing (WES) identified compound heterozygous variants in PIGS (MIM:610271):c.148C > T (p.Gln50∗) and c.1141_1164dupGACATGGTGCGAGTGATGGAGGTG (p.Asp381_Val388dup). Flow cytometry analyses demonstrated that the boy with PIGS variants had a decreased expression of GPI-APs. This study stresses the importance of including the screening of PIGS gene in the case of pediatric neurological syndromes and reviews the clinical features of PIGS-associated disorders.

The epilepsy of infancy with migrating focal seizures (EIMFS; previously called Malignant migrating partial seizures of infancy) are early-onset epileptic encephalopathies (EOEE) that associate multifocal ictal discharges and profound psychomotor retardation. EIMFS have a genetic origin and are mostly caused by de novo mutations in the KCNT1 gene, and much more rarely in the KCNT2 gene. KCNT1 and KCNT2 respectively encode the KNa1.1 (Slack) and KNa1.2 (Slick) subunits of the sodium-dependent voltage-gated potassium channel KNa. Functional analyses of the corresponding mutant homomeric channels in vitro suggested gain-of-function effects. Here, we report two novel, de novo truncating mutations of KCNT2: one mutation is frameshift (p.L48Qfs43), is situated in the N-terminal domain, and was found in a patient with EOEE (possibly EIMFS); the other mutation is nonsense (p.K564*), is located in the C-terminal region, and was found in a typical EIMFS patient. Using whole-cell patch-clamp recordings, we have analyzed the functional consequences of those two novel KCNT2 mutations on reconstituted KNa1.2 homomeric and KNa1.1/KNa1.2 heteromeric channels in transfected chinese hamster ovary (CHO) cells. We report that both mutations significantly impacted on KNa function; notably, they decreased the global current density of heteromeric channels by ~25% (p.K564*) and ~55% (p.L48Qfs43). Overall our data emphasize the involvement of KCNT2 in EOEE and provide novel insights into the role of heteromeric KNa channel in the severe KCNT2-related epileptic phenotypes. This may have important implications regarding the elaboration of future treatment.

Abstract Whole-exome sequencing (WES), one of the next-generation sequencing (NGS), has become a powerful tool to identify exonic variants. Investigating causality of the sequence variants in human disease becomes an important part in NGS for the research and clinical applications. Recently, important guidelines on them have been published and will keep on updating. In our study, two Chinese families, with the clinical diagnosis of “Epilepsy”, which presented with seizures, psychomotor retardation, hypotonia and etc. features, were sequenced by Trio-WES (including the proband and the unaffected parents), and a standard interpretation of the identified variants was performed referring to the recently updated guidelines. Finally, we identified three novel mutations (c.71 C > T, p.P24L; c.1387-1389delGAG, p.E463-; c.134 G > A, p.W45*; NM_000026) in ADSL in the two Chinese families, and confirmed them as the causal variants to the disease-Adenylosuccinate Lyase Deficiency. Previous reported specific therapy was also introduced to the patients after our refined molecular diagnosis, however, the effect was very limited success. In summary, our study demonstrated the power and advantages of WES in exploring the etiology of human disease. Using the constantly updated guidelines to conduct the WES study and to interpret the sequence variants are a necessary strategy to make the molecular diagnosis and to guide the individualized treatment of human disease.

The Jiangxi Lengshuikeng ore field, characterized as porphyry deposits and volcanic sedimentary hydrothermal reworking deposits, is one of the major Ag-Pb-Zn ore concentration areas in Wuyi Mountain area. There has been much research carried out on mineralization, the metallogenic model, and ore-controlling structure of the Lengshuikeng deposit. However, it is still unclear about the relationship of different geological bodies with mineralization and magmatism. In this paper, a description of a zircon LA-ICP-MS U-Pb geochronology approach and its implementation on the volcanic rock of Daguding Formation and ore-bearing granite porphyry is given. The crystal tuffs from the top and bottom of Daguding Formation and ore bearing granite porphyry yield U-Pb age of 161.3±1.3 Ma, 160.75±0.96 Ma and 168.09±0.80 Ma, respectively. These results indicate that there were three stages of volcano-magmatic activities in the Lengshuikeng ore field with ages of 164-170 Ma, 157-161 Ma, and 140-146 Ma, respectively. The 157-161 Ma is the main metallogenic epoch of the volcanic sedimentary-hydrothermal reworking type deposit and porphyry type deposit. The discovery of the late Jurassic volcanic rocks in Lengshuikeng provides the important geological evidence for the detailed study of the Mesozoic tectonic regime transition in South China.