Search

Human α-thrombin is a trypsin-like serine protease that has the unique ability to convert soluble fibrinogen in insoluble fibrin clot. In addition to the active site, this enzyme owns two electropositive regions, (exosite I and II), located at opposite sides of its globular shape and playing an essential role in the recognition of many cofactors and substrates.1 A special class of thrombin synthetic ligands is represented by aptamers, which are short single stranded DNA or RNA oligonucleotides that bind their targets with very high affinity and specificity by adopting defined and stable three dimensional structural motifs.2 In particular, anti-thrombin aptamers adopt a G-quadruplex structure.3-5 Recently, the researchers interest has moved on a new class of oligonucleotides in which the addition of a duplex-forming sequences to a G-quadruplex module results in an improvement of the antithrombotic action. One of these oligonucleotides is NU172 that possesses an high anticoagulant activity with an IC50 value of 5–10 μg/mL in plasma6 and is currently the only thrombin binding aptamer evaluated in Phase II clinical trials (ClinicalTrials.gov identifier NCT00808964) for anticoagulation in heart disease treatments by ARCA Biopharma, Inc.7 The crystallographic characterization of thrombin-NU172 complex in the presence of either potassium or sodium ions provides together with conformational solution studies on NU172 variants and anticoagulant assays have provided a reasonable interpretation of the peculiar antithrombotic properties of NU172. Details on our results will be discussed at the Meeting. References: 1. Di Cera, E. J Thromb Haemost. 2007, 5 Suppl 1, 196 – 202. 2. Woodruff, R.S.; Sullenger, B.A. Arterioscler Thromb Vasc Biol. 2015, 35, 2083 – 2091. 3. Russo Krauss, I; Pica, A.; Merlino, A.; Mazzarella, L.; Sica, F. Acta Crystallogr D Biol Crystallogr. 2013, 69, 2403 – 2411. 4. Russo Krauss, I.; Spiridonova, V.; Pica, A.; Napolitano, V.; Sica, F. Nucleic Acids Res. 2016, 44, 983 – 991. 5. Russo Krauss, I.; Napolitano, V.; Petraccone, L.; Troisi, R.; Spiridonava, V.; Mattia, C.A.; Sica, F. Int J Biol Macromol. 2018, 107, 1697 – 1705. 6. Keefe, A.D.; Pai, S.; Ellington, A. Nat Rev Drug Discov. 2010, 9, 537 – 550. 7. Zhou, J.; Rossi, J. Nat Rev Drug Discov. 2017, 16, 181 – 202.

Human α-thrombin (thrombin) is a coagulation factor that maintains blood hemostasis by balancing pro- and anti-coagulant actions. Thrombin capability to perform such different functions relies on the ability to recognize a large variety of substrates, inhibitors and cofactors. This ability is finely regulated by two distinct regions on the protein surface, known as exosites I and II, which allosterically modulate the function, thus providing specificity to the proteolytic activity of the protein [1]. Oligonucleotide aptamers, short, single-stranded DNA or RNA sequences that bind to their target with high affinity and specificity through their tridimensional structures, are extensively used to modulate the function of most of the factors involved in the coagulation pathway [2]. Particular attention has been focused on the study of anti-thrombin aptamers which adopt a G-quadruplex structure [3-5]. Nowdays, the researchers interest moves on a new class of oligonucleotides in which the addition of a duplex-forming sequences to a G-quadruplex module results in an improvement of the antithrombotic action. One of these oligonucleotides is NU172 that possesses an high anticoagulant activity with an IC50 value of 5–10 μg/mL in plasma [6] and is currently the only thrombin binding aptamer evaluated in Phase II clinical trials (ClinicalTrials.gov identifier NCT00808964) for anticoagulation in heart disease treatments by ARCA Biopharma, Inc [7]. Here we present the crystallographic structure of the thrombin-NU172 complexes in the presence of either potassium or sodium ions, which provide a reasonable interpretation of the peculiar antithrombotic properties of this oligonucleotide. Moreover, in order to investigate the role of quadruplex loops and the duplex region on the aptamer folding, conformational solution studies on NU172 variants have been performed. Finally, the anticoagulant activities of NU172 and its variants have been evaluated following the conversion of fibrinogen in fibrin promoted by thrombin by means of dynamic light scattering experiments and compared with those of TBA. Details will be discussed at the Meeting. [1] E. Di Cera J Thromb Haemost. 2007, 5 Suppl 1, 196. [2] R.S. Woodruff, B.A. Sullenger Arterioscler Thromb Vasc Biol. 2015, 35, 2083. [3] I. Russo Krauss, A. Pica, A. Merlino, L. Mazzarella, F. Sica Acta Crystallogr D Biol Crystallogr. 2013, 69, 2403. [4] I. Russo Krauss, V. Spiridonova, A. Pica, V. Napolitano, F. Sica Nucleic Acids Res. 2016, 44, 983. [5] I. Russo Krauss, V. Napolitano, L. Petraccone, R. Troisi, V. Spiridonava, C.A. Mattia, F. Sica Int J Biol Macromol. 2018, 107, 1697. [6] A.D. Keefe, S. Pai, A. Ellington Nat Rev Drug Discov. 2010, 9, 537. [7] J. Zhou, J. Rossi Nat Rev Drug Discov. 2017, 16, 181.

Determination of the chemical composition of different parts of the wall paintings (pigments, mortars and binders) allows extracting information about technology of preparation of the artefact. Herein we present a multimethodological characterization of wall paintings from a Roman Archeological sites from Cuma, focusing on differences between indoor (domus) and outdoor (Temple) fabrication. Both pigments, binders and mortars were studied via a combination of destructive/microdestructutive (mass spectrometry, ionic chromatography, ICP-based techniques) and non-destructive (Raman microscopy, X-ray diffraction and SANS) methodologies. Particularly, the systematic presence of dolomite only in temple mortars suggests an intentional use of such limestone for outdoor fabrication. Differences between temple and domus extends also to binder composition: proteinaceous binders in domus (possibly egg [3] and animal glue), whereas in TCP no protein was detected but some fat acids (probably from animal fat). Ultimately, the multimethodological study allowed an overall picture of the components and technology of the paintings from fabrications with different use, proposing distinct engineering choices for indoor and outdoor walls. References [1] Cartechini L., Pucci P., Sgamellotti A., Marino G., Birolo L., “Proteomic strategies for the identification of proteinaceous binders in paintings” Analytical & Bioanalytical Chemistry 395(7), 2009, 2269-2280. [2] Gelzo M., Grimaldi M., Vergara A., Severino V., Chambery A., Dello Russo A., Piccioli C., Corso G,. Arcari P. "Comparison of binder composition in Pompeian wall painting styles from Insula Occidentalis" Chemistry Central J. 8(65), 2014, 1-10. [3] Vinciguerra R, Galano E, Vallone F, Greco G, Vergara A, Bonaduce I, Marino G, Pucci P, Amoresano A, Birolo L, “Deglycosylation Step to Improve the Identification of Egg Proteins in Art Samples” Analytical Chemistry 87 (20), 2015, 10178-10182. Acknowledgements This work was financially supported by Distretto ad Alta Tecnologia dei Beni Culturali (DATABENC scarl), progetto SNECS. “Soprintendenza Speciale per i Beni Archeologici di Napoli e Pompei” – Ufficio Archeologico di Cuma - Dr Paolo Caputo is also acknowledged.

The intriguing crystal organization of the domain-swapped dimer of a human pancreatic ribonuclease variant indicates that the protein can form fibrils in solution. They were observed and characterized by atomic force microscopy. The importance of domain swapping in inducing native-like fibril formation is highlighted.

Locked nucleic acids (LNAs) are formed by bicyclic ribonucleotides where the O2??? and C4??? atoms are linked through a methylene bridge and the sugar is blocked in a 3???-endo conformation (Singh, S.K. et al., Chem Commun, 1998, 455-6). They represent a promising tool for therapeutic and diagnostic applications, characterized by higher thermal stability and nucleases resistance with respect to their natural counterparts (Doessing, H. and Vester, B., Molecules, 2011, 16, 4511-26; Kaur, H. et al., Chemical reviews, 2007, 107, 4672-97). However, structural descriptions of LNA-containing quadruplexes are rather limited, and up to now no crystal structure was reported. Here we present the first crystallographically derived model of an all LNA-substituted quadruplex forming sequence 5???-TGGGT-3???. Structural details derived from this first high resolution crystallographic model of an all-LNA quadruplex add important information to our knowledge of the effect of modified nucleotides in quadruplex structure and stability. In particular, we observe a regular terminal thymine-tetrad, the first to be observed in crystallographic structure of G-quadruplexes and a likely contributor to the high thermal stability of this molecule. Moreover, the unusual stacked arrangement of the two quadruplexes in the asymmetric unit suggests how sequential quadruplexes can arrange in the crowded cell environment, while at the same time the structure provides an opportunity in the design of LNA-based blocks for developing scaffolds within nanotechnology applications.

Locked nucleic acids (LNAs) are formed by bicyclic ribonucleotides where the O2’ and C4’ atoms are linked through a methylene bridge and the sugar is blocked in a 3’-endo conformation [1]. They represent a promising tool for therapeutic and diagnostic applications, characterized by higher thermal stability and nucleases resistance with respect to their natural counterparts [2,3]. However, structural descriptions of LNA-containing quadruplexes are rather limited, and up to now no crystal structure was reported. Here we present the first crystallographically derived model of an all LNA-substituted quadruplex forming sequence 5’-TGGGT-3’. The presence of two closely packed quadruplexes in the asymmetric unit made structural determination particularly changeling, but eventually a very good model at 1.7 Å resolution has been obtained. Structural details derived from this first high resolution crystallographic model of an all-LNA quadruplex add important information to our knowledge of the effect of modified nucleotides in quadruplex structure and stability. Moreover, the unusual stacked arrangement of the two quadruplexes in the asymmetric unit suggests how sequential quadruplexes can arrange in the crowded cell environment, while at the same time the structure provides an opportunity in the design of LNA-based blocks for developing scaffolds within nanotechnology applications. [1] S.K. Singh, P. Nielsen, A.A. Koshkin, J. Wengel Chem Commun, 1998, 455-456. [2] H. Doessing, B. Vester Molecules, 2011,16, 4511-4526. [3] H. Kaur, B.R. Babu, S. Maiti Chemical reviews, 2007,107, 4672-4697.

Human α-thrombin is a multifunctional serine protease that plays a pivotal role in hemostasis. Two binding sites on its surface, the fibrinogen recognition site (exosite I) and the heparin binding site (exosite II), control its catalytic function. Promising thrombin inhibitors are aptamers, short single-stranded oligonucleotides able to bind target proteins with high selectivity and affinity (Bock et al, Nature, 1992, 355, 564-6). Among them a 15-mer aptamer recognizing exosite I (TBA) (Macaya et al, PNAS, 1993, 90, 3745-9) and a 29-mer binding exosite II (HD22) aptamer (Tasset et al, JMB, 1997, 272, 688-98) were selected for their high affinity towards thrombin. Structural data on thrombin-aptamer complexes are essential to understand recognition mechanism(s) of TBA and HD22 and to design novel aptamers with improved pharmaceutical properties. We have performed an X-ray structural characterization of the complexes of thrombin with TBA (Russo Krauss et al, NAR, 2012, 40, 8119-28), TBA variants (Russo Krauss et al, NAR, 2011, 39, 7858-67) and mutants or a shorter variant of HD22 (HD22-27mer). This study has been complemented with a CD analysis of aptamers both free and in complex with thrombin, in the presence of Na+ or K+. All together our results have provided a clear picture of the recognition process between thrombin and its aptamers. Moreover, they allow to define the effect that ions have on structure and flexibility, and therefore on thrombin affinity and inhibition, of the various aptamers. Notably, the thrombin-HD22-27mer complex has provided the first crystallographic model of an aptamer with a mixed duplex-quadruplex fold and reveals unexpected novel structural features.

Aptamers are single-stranded DNA or RNA sequences able to recognize a wide variety of natural and synthetic targets including amino acids, peptides, proteins and even cells with high affinity and specificity [1]. They are considered a sort of nucleic acid version of antibodies with improved properties. Aptamers display a large number of structural arrangements, in particular the interesting G-quadruplex architecture that is adopted by many of them. Several cases have been also reported where aptamers are supposed to adopt a mixed duplex/quadruplex structure [1,2]. Interestingly, in every case, the presence of both structural motifs is needed for strong and specific binding of the target. Also potent second-generation thrombin aptamers adopt a duplex/quadruplex bimodular folding [2]. They have been proved to recognize thrombin exosite II [2], whereas best studied thrombin binding aptamers bind exosite I [3,4], and show very high affinity and specificity towards thrombin [2]. A sound model of these oligonucleotides, either free or in complex with thrombin, is not yet available. Here we present a structural study of one of these aptamers, HD22-27mer. Interestingly, the crystal structure of the aptamer in complex with thrombin displays a novel architecture, in which a double helical stem is enchained to a pseudo-G-quadruplex. Our results also underline the role of residues that join the duplex and the quadruplex motifs and control their recruitment in thrombin binding. Finally, our crystallographic model shed light on the contrasting circular dichroism studies reported in the literature [5], suggesting a major role of ions in determining the aptamer properties. [1] B. Gatto, M. Palumbo, C. Sissi Current Medicinal Chemistry, 2009, 16, 1248-1265; [2] D.M. Tasset, M.F. Kubik, W. Steiner Journal of Molecular Biology, 1997, 272(5), 688-698;. [3] I. Russo Krauss, A. Merlino, C. Giancola, A. Randazzo, L. Mazzarella, F. Sica Nucleic Acids Res., 2011, 39(17), 7858–7867 [4] I. Russo Krauss, A. Merlino, A. Randazzo, E. Novellino, L. Mazzarella, F. Sica Nucleic Acids Res., 2012, 40(16), 8119-28 [5] G. Marson, M. Palumbo, C. Sissi Curr Pharm Des., 2012, 18(14), 2027-2035

The aim of anticoagulant/antithrombotic therapy in cardiovascular disease is to prevent fibrin deposition and platelet aggregation, halting current and future ischemic episodes. The limitations to the effectiveness of the most commonly used agents (heparin, coumadin and aspirin) have led to the development of new anticoagulant compounds. In particular, aptamers represent an attractive approach because of their high specificity and low immunogenicity. The best known example is the Thrombin Binding Aptamer (TBA), namely 5‘GGTTGGTGT-GGTTGG3’[1]. TBA and its derivatives [2] adopt a G-quadruplex structure [2-6] and inhibit thrombin activity by blocking the fibrinogen binding site (exosite I) [3-6]. Biological properties of TBA are strictly dependent on its tertiary structure. Other antithrombotic aptamers have been identified using the SELEX process and partially characterized. Among them HD22, namely 5’GTCCGTGGTAGGGCAGGTTGGGGTGAC3’, is particularly interesting. It presents a 15-nucleotide core sequence that has striking similarity to TBA, and it has been reported to adopt a mixed duplex/quadruplex structure [7]. Remarkably HD22 binds thrombin with much higher affinity than TBA and has been shown to bind exosite II instead of exosite I [7]. No structural data on thrombin-HD22 complex has been reported so far. We have solved the X-ray structure of the thrombin-HD22 complex, with the aim to understand the molecular details of the interaction between the two molecules and to investigate the differences with respect to thrombin-TBA complex, whose structure we have recently determined at high resolution. These results could help the design of a new class of aptamers with an improved capability to modulate thrombin function. [1] L.C. Bock, L.C. Griffin, J.A. Latham, E.H. Vermaas, J.J. Toole, Nature, 355, 1992, 564. [2] L. Martino, A. Virno, A. Randazzo, A. Virgilio, V. Esposito, C. Giancola, M. Bucci, G. Cirino, L. Mayol, NAR, 34, 2006, 6653. [3] R.F. Macaya, P. Schultze, F.W. Smith, J.A. Roe, J. Feigon, PNAS USA, 90, 1993, 3745. [4] K. Padmanabhan, A. Tulinsky, Acta Crystallogr. D, 52, 1996, 272. [5] I. Russo Krauss, A. Merlino, A. Randazzo, L. Mazzarella, F. Sica, Acta Crystallogr F, 66, 2010, 961. [6] I. Russo Krauss, A. Merlino, C. Giancola, A. Randazzo, L. Mazzarella, F. Sica NAR, submitted [7] D.M. Tasset, M.F. Kubik, W. Steiner, JMB, 272(5), 1997, 688.