Search

Aptamers are oligonucleotide ligands selected, in vitro, to bind a specified target protein. The first aptamer to reach human clinical testing is NX1838, a polyethylene glycol conjugated aptamer that inhibits vascular endothelial growth factor. This paper describes the validation of a high-performance liquid chromatographic anion-exchange method for the determination of NX1838 in plasma. Measurements of intact NX1838 had a coefficient of variation of less than 8% and an accuracy between 107% and 115%. The assay was utilized to determine NX1838 plasma pharmacokinetics in rhesus monkeys following a single 1 mg/kg intravenous or subcutaneous dose. Following intravenous administration, the maximum achieved plasma concentration was 25.5 μg/ml with a terminal half-life of 9.3 h and clearance rate of 6.2 ml/h. After subcutaneous administration, the fraction of the dose absorbed into the plasma compartment was 0.78 with a time to peak concentration (4.9 μg/ml) of 8 to 12 h.

Mesangial cell proliferation and matrix accumulation, driven by platelet-derived growth factor (PDGF), contribute to many progressive renal diseases. In a novel approach to antagonize PDGF, we investigated the effects of a nuclease-resistant high-affinity oligonucleotide aptamer in vitro and in vivo. In cultured mesangial cells, the aptamer markedly suppressed PDGF-BB but not epidermal- or fibroblast-growth-factor-2-induced proliferation. In vivo effects of the aptamer were evaluated in a rat mesangioproliferative glomerulonephritis model. Twice-daily intravenous (i.v.) injections from days 3 to 8 after disease induction of 2.2 mg/kg PDGF-B aptamer, coupled to 40-kd polyethylene glycol (PEG), led to 1) a reduction of glomerular mitoses by 64% on day 6 and by 78% on day 9, 2) a reduction of proliferating mesangial cells by 95% on day 9, 3) markedly reduced glomerular expression of endogenous PDGF B-chain, 4) reduced glomerular monocyte/macrophage influx on day 6 after disease induction, and 5) a marked reduction of glomerular extracellular matrix overproduction (as assessed by analysis of fibronectin and type IV collagen) both on the protein and mRNA level. The administration of equivalent amounts of a PEG-coupled aptamer with a scrambled sequence or PEG alone had no beneficial effect on the natural course of the disease. These data show that specific inhibition of growth factors using custom-designed, high-affinity aptamers is feasible and effective.

In this paper we examine the physical properties and potential for self-association of the Escherichia coli transcription factors, σ 70 and NusA. We show, by a combination of chemical crosslinking, equilibrium and velocity sedimentation, quasi-elastic light scattering, and small-angle X-ray scattering that NusA exists as a monomer at KCl concentrations between 0.01 and 1.5 m , and that σ 70 exists as a monomer at KCl concentrations between 0.1 and 1.5 m . The shape and hydration characteristics of each of these monomeric proteins are also examined. The results serve as background for the companion paper in which a thermodynamic analysis is made of the interactions of these transcription factors with E. coli core RNA polymerase in solution and as a component of the functional transcription complex.

This paper describes the binding interactions of Escherichia coli transcription factors sigma 70 and NusA with core RNA polymerase, both free in solution and as a part of the functional transcription complex. High pressure liquid chromatography gel filtration and fluorescence techniques have been used to monitor the binding of these factors to core polymerase in solution at salt concentrations roughly comparable to the in vivo environment (250 mM-KCl, 50 mM-potassium phosphate (pH 7.5]; under these conditions all the interacting species exist separately as protein monomers. We find that sigma 70 and NusA binds competitively to core polymerase with a 1:1 binding stoichiometry in this milieu, and that NusA does not bind to the polymerase holoenzyme. Association constants of approximately 2 x 10(9) and 1 x 10(7) M-1 have been measured for the sigma 70-core polymerase interaction and for the NusA-core polymerase interaction, respectively. These findings are consistent with the original formulation of the NusA-sigma 70 cycle put forward by Greenblatt & Li, and provide the basis for a further (and preliminary) quantitative examination of these same interactions within the transcription complex. We use a number of molecular biological techniques, together with data from the literature, to estimate these binding constants in various phases of the transcription cycle. In keeping with our results in solution, we find that the effective binding affinity of sigma 70 for core polymerase within the "open" promoter-polymerase complex is at least 500-fold greater than that of NusA. As the transcription complex moves from the initiation to the elongation phase these relative binding affinities are reversed; the average association constant of NusA for the core polymerase in the elongation complex remains practically the same as in free solution (approx. 3 x 10(7) M-1), while the affinity of sigma 70 for core polymerase in this complex drops to less than 5 x 10(5) M-1. These results are used to begin to define the basic conformational states and interaction potentials of core polymerase in the various stages of the transcription cycle.

Background : Vascular permeability factor/vascular endothelial growth factor (VPF/VEGF) is a potent inducer of new blood vessel growth (angiogenesis) that contributes to the pathology of many angiogenesis-associated disease states such as psoriasis, rheumatoid arthritis and cancer. Few molecular entities capable of binding to VPF/VEGF with high affinity and specificity have been described to date. Results : Nuclease-resistant 2′-amino-2′-deoxypyrimidine nucleotide RNA (2′-aminopyrimidine RNA) ligands that bind to VPF/VEGF with high affinity have been identified by iterative rounds of affinity-selection/amplification from two independent random libraries. The sequence information that confers high affinity binding toVPF/VEGF is contained in a contiguous stretch of 24 nucleotides, 5′- CCCUGAUGGUAGACGCCGGGGUG -3′ (2′-aminopyrimidine nucleotides are designated with italic letters). Of the 14 ribopurines in this minimal ligand, 10 can be substituted with the corresponding 2′-O-methylpurine nucleotides without a reduction in binding affinity to VPF/VEGF. In fact, the 2′ O-methyl substitution at permissive positions leads to a ∼17-fold improvement in the binding affinity to VPF/VEGF The higher affinity results from the reduction in the dissociation rate constant of the 2′-O-methyl-substituted RNA ligand from the protein compared to the unsubstituted ligand. The 2′-O-methyl-substituted minimal ligand, which folds into a bulged hairpin motif, is also more thermally stable than the unsubstituted ligand. Nuclease resistance of the ligand is further improved by the 2′-O-methyl substitutions and the addition of short phosphorothioate caps to the 3′- and 5′-ends. Conclusions : We have used the SELEX (systematic evolution of ligands by exponential enrichment) process in conjunction with post-SELEX modifications to define a highly nuclease-resistant oligonucleotide that binds to VPF/VEGF with high affinity and specificity.

Quantitative study of protein-protein and protein-ligand interactions in solution requires accurate determination of protein concentration. Often, for proteins available only in "molecular biological" amounts, it is difficult or impossible to make an accurate experimental measurement of the molar extinction coefficient of the protein. Yet without a reliable value of this parameter, one cannot determine protein concentrations by the usual uv spectroscopic means. Fortunately, knowledge of amino acid residue sequence and promoter molecular weight (and thus also of amino acid composition) is generally available through the DNA sequence, which is usually accurately known for most such proteins. In this paper we present a method for calculating accurate (to +/- 5% in most cases) molar extinction coefficients for proteins at 280 nm, simply from knowledge of the amino acid composition. The method is calibrated against 18 "normal" globular proteins whose molar extinction coefficients are accurately known, and the assumptions underlying the method, as well as its limitations, are discussed.