Search

Theodor (Ted) Otto Diener (* 28 February 1921 in Zürich, Switzerland; † 28 March 2023 in Beltsville, MD, USA) pioneered research on viroids while working at the Plant Virology Laboratory, Agricultural Research Service, USDA, in Beltsville. He coined the name viroid and defined viroids important features like the infectivity of naked single-stranded RNA without protein-coding capacity. During scientific meetings in the 1970s and 1980s, viroids were often discussed at conferences together with other subviral pathogens. This term includes what are now called satellite RNAs and prions. Satellite RNAs depend on a helper virus and have linear or, in the case of virusoids, circular RNA genomes. Prions, proteinaceous infectious particles, are the agents of scrapie, kuru and some other diseases. Many satellite RNAs, like viroids, are non-coding and exert their function by thermodynamically or kinetically controlled folding, while prions are solely host-encoded proteins that cause disease by misfolding, aggregation and transmission of their conformations into infectious prion isoforms. In this memorial, we will recall the work of Ted Diener on subviral pathogens.

Prion diseases, particularly sporadic cases, pose a challenge due to their complex nature and heterogeneity. The underlying mechanism of the spontaneous conversion from PrPC to PrPSc, the hallmark of prion diseases, remains elusive. To shed light on this process and the involvement of cofactors, we have developed an in vitro system that faithfully mimics spontaneous prion misfolding using minimal components. By employing this PMSA methodology and introducing an isoleucine residue at position 108 in mouse PrP, we successfully generated recombinant murine prion strains with distinct biochemical and biological properties. Our study aimed to explore the influence of a polyanionic cofactor in modulating strain selection and infectivity in de novo-generated synthetic prions. These results not only validate PMSA as a robust method for generating diverse bona fide recombinant prions but also emphasize the significance of cofactors in shaping specific prion conformers capable of crossing species barriers. Interestingly, once these conformers are established, our findings suggest that cofactors are not necessary for their infectivity. This research provides valuable insights into the propagation and maintenance of the pathobiological features of cross-species transmissible recombinant murine prion and highlights the intricate interplay between cofactors and prion strain characteristics. Author summary: Prion diseases are rare and complex neurodegenerative disorders that can occur spontaneously, through a poorly understood conformational or structural change of normal, physiological prion protein. This abnormally structured form, known as prion, acquires the capacity to induce the same transformation to surrounding prion proteins, leading to disease. In our study, we take advantage of a recently developed methodology that closely mimics this process in a test tube using extremely simple components. Applying this system and modifying a specific part of the mouse prion protein, we were able to generate different prion strains with unique characteristics spontaneously. This process is greatly enhanced using an additional molecule called cofactor, that has been proposed to affect the variability and infectivity (capacity to cause disease in an animal model) of these prions. Our findings show that while cofactors facilitate the spontaneous formation of prions and may influence their final characteristics, they are not necessary for their infectivity nor for their spontaneous formation. This research gives new insights into the role cofactors play in the spontaneous generation of prions and their behavior in animal models. [ABSTRACT FROM AUTHOR]

Creutzfeldt-Jakob disease (CJD) is a rare, fatal, rapidly progressive neurodegenerative disease resulting from an accumulation of misfolded prion proteins (PrP). CJD affects 1–2 new individuals per million each year, and the sporadic type accounts for 90% of those cases. Though the median age at onset and disease duration vary depending on the subtype of sporadic CJD (sCJD), the disease typically affects middle-aged to elderly individuals with a median survival of 4–6 months. sCJD in younger individuals is extremely rare. Here, we present a 21-year-old female who died with a sporadic prion disease. She presented with psychiatric symptoms followed by a rapidly progressive neurocognitive and motor decline. EEG was negative for periodic sharp wave complexes; however, brain MRI was suggestive of prion disease. The cerebrospinal fluid (CSF) real-time quaking-induced conversion (RT-QuIC) assay was indeterminate. Neuropathologic examination at autopsy revealed severe neuronal loss and gliosis with secondary white matter degeneration but minimal spongiform changes and PrP deposits in the cerebellum and neocortex by immunohistochemistry. Absence of pathogenic mutations and methionine/valine heterozygosity at codon 129 of the prion protein gene (PRNP), atypical type 1 protease-resistant PrP that lacks or shows underrepresentation of the diglycosylated PrP isoform by western blot analysis, and no acquired prion disease risk factors resulted in a final diagnosis of atypical sCJD. Very young onset sCJD often has atypical clinical presentations and disease progression, neuropathological examination results, and/or laboratory test results that may confound diagnosis. It is critical to perform thorough, comprehensive evaluations to make an accurate diagnosis, which includes autopsy confirmation with histology, prion protein typing and prion gene sequencing. [ABSTRACT FROM AUTHOR]

Misfolding of the cellular PrP (PrPc) protein causes prion disease, leading to neurodegenerative disorders in numerous mammalian species, including goats. A lack of PrPc induces complete resistance to prion disease. The aim of this work was to engineer Alpine goats carrying knockout (KO) alleles of PRNP, the PrPc-encoding gene, using CRISPR/Cas9-ribonucleoproteins and single-stranded donor oligonucleotides. The targeted region preceded the PRNPTer mutation previously described in Norwegian goats. Genome editors were injected under the zona pellucida prior to the electroporation of 565 Alpine goat embryos/oocytes. A total of 122 two-cell-stage embryos were transferred to 46 hormonally synchronized recipient goats. Six of the goats remained pregnant and naturally gave birth to 10 offspring. Among the 10 newborns, eight founder animals carrying PRNP genome-edited alleles were obtained. Eight different mutated alleles were observed, including five inducing KO mutations. Three founders carried only genome-edited alleles and were phenotypically indistinguishable from their wild-type counterparts. Among them, one male carrying a one base pair insertion leading to a KO allele is currently used to rapidly extend a PRNP-KO line of Alpine goats for future characterization. In addition to KO alleles, a PRNPdel6 genetic variant has been identified in one-third of founder animals. This new variant will be tested for its potential properties with respect to prion disease. Future studies will also evaluate the effects of genetic background on other characters associated with PRNP KO, as previously described in the Norwegian breed or other species. [ABSTRACT FROM AUTHOR]

AbstractInherited prion diseases (IPD) secondary to mutations of the prion protein gene, PRNP, exhibit diverse clinical phenotypes, capable of mimicking numerous primary neurodegenerative conditions. We describe the clinical phenotype and neuropathological findings in a family from County Limerick in Ireland presenting with Alzheimer’s disease-like cognitive decline and motor symptoms caused by a novel missense mutation of PRNP. This mutation occurs in the PRNP central lysine cluster (CLC; codon 101-110), resulting in substitution of threonine with isoleucine at codon 107 (T107I). This case series highlights that IPD can be hard to distinguish from overlapping clinical syndromes seen in other neurodegenerative diseases. We also discuss similarities and differences of the novel mutation T107I to other pathogenic mutations of the CLC of PRNP. [ABSTRACT FROM AUTHOR]

Obsessive-compulsive disorder (OCD) is a chronic and disabling psychiatric disorder characterized by recurrent intrusive thoughts or repetitive behaviors. We sought to better understand the structure of gut microbiota in first visit registration, treatment-naive children and adolescents with OCD, and the relationship between gut microbiota and fecal metabolites. Thus we studied the gut microbial population using 16 S rRNA sequencing in 49 children (8–17 years of age) with OCD, 42 healthy controls (HCs). We found a significant decrease in α-diversity in the OCD group, and the OCD and HC groups had distinctive intestinal flora. To further investigate the potential interaction effects between OCD and functional pathways of the intestinal flora, the 19 OCD patients and 18 aged-matched HCs were selected to undergo metagenomics analysis. We showed that several functional pathways of gut microbiota in patients with OCD were disrupted, such as glucolipid metabolism, amino acid metabolism, steroid biosynthesis, and the second messenger system. Changes in the clinical characteristics of OCD patients were associated with specific bacteria. Metabolomics analysis was also performed on stool samples from 91 subjects. Intestinal microflora metabolite expression in OCD patients was disturbed, and the related metabolic pathway functions were abnormal. Abnormal metabolites of gut microbiota in OCD patients are mainly involved in folate biosynthesis, the prion disease pathway, and the amino acid metabolic network. This study detailed the intestinal microbiota of children and adolescents with OCD. Our study suggests possible modalities for early OCD intervention by targeting the specific bacteria associated with neurotransmitter metabolism. • First study of gut microbiota in first-episode OCD by multi-omics combined analysis. • The diversity of gut microbiota in OCD was significantly reduced. • OCD and HC groups can be distinguished by specific gut microbiota. • Several metabolic pathways presented abnormal functions in with OCD. [ABSTRACT FROM AUTHOR]

Prions are proteinaceous infectious particles implicated in fatal neurodegenerative disorders known as prion diseases. Herein, we provide an overview of prion biology, emphasizing the structural, functional, and evolutionary aspects of prions, along with their potential applications in protein engineering. Understanding the structure-function relationships of both healthy and disease-associated prion proteins enables a deeper understanding of the mechanisms of prion-induced neurotoxicity. Furthermore, we describe how insights into prion evolution have begun to shed light on their ancient origins and evolutionary resilience, offering deeper insights into the potential roles of prions in primordial chemical processes. [ABSTRACT FROM AUTHOR]

The article discusses the diagnostic accuracy of MRI in identifying Creutzfeldt‐Jakob Disease (CJD), a rare prion infection. MRI has been found to be more effective than CSF testing in diagnosing CJD, with a high negative predictive value. The study suggests that patients without suggestive MRI findings are unlikely to have CJD confirmed through lumbar puncture, highlighting the potential of MRI as a screening tool to avoid unnecessary invasive procedures. [Extracted from the article]

Chronic complete spinal cord injury (SCI) is difficult to treat because of scar formation and cavitary lesions. While human iPS cell-derived neural stem/progenitor cell (hNS/PC) therapy shows promise, its efficacy is limited without the structural support needed to address cavitary lesions. Our study investigated a combined approach involving surgical scar resection, decellularized extracellular matrix (dECM) hydrogel as a scaffold, and hNS/PC transplantation. To mitigate risks such as prion disease associated with spinal cord-derived dECM, we used kidney-derived dECM hydrogel. This material was chosen for its biocompatibility and angiogenic potential. In vitro studies with dorsal root ganglia (DRG) confirmed its ability to support axonal growth. In a chronic SCI rat model, scar resection enhanced the local microenvironment by increasing neuroprotective microglia and macrophages, while reducing inhibitory factors that prevent axonal regeneration. The combination of scar resection and dECM hydrogel further promoted vascular endothelial cell migration. These changes improved the survival of transplanted hNS/PCs and facilitated host axon regeneration. Overall, the integrated approach of scar resection, dECM hydrogel scaffolding, and hNS/PC transplantation has been proven to be a more effective treatment strategy for chronic SCI. However, despite histological improvements, no functional recovery occurred and further research is needed to enhance functional outcomes. [ABSTRACT FROM AUTHOR]

The accumulation of a disease-specific isoform of prion protein (PrPSc) and histopathological lesions, such as neuronal loss, are unevenly distributed in the brains of humans and animals affected with prion diseases. This distribution varies depending on the diseases and/or the combinations of prion strain and experimental animal. The brain region-dependent distribution of PrPSc and neuropathological lesions suggests a neuronal cell-type-dependent prion propagation and vulnerability to prion infection. However, the underlying mechanism is largely unknown. In this study, we provided evidence that the prion 22L strain propagates more efficiently in excitatory neurons than inhibitory neurons and that excitatory neurons in the thalamus are vulnerable to prion infection. PrPSc accumulation was less intense in the striatum, where GABAergic inhibitory neurons predominate, compared to the cerebral cortex and thalamus, where glutamatergic excitatory neurons are predominant, in mice intracerebrally or intraperitoneally inoculated with the 22L strain. PrPSc stains were observed along the needle track after stereotaxic injection into the striatum, whereas they were also observed away from the needle track in the thalamus. Consistent with inefficient prion propagation in the striatum, the 22L prion propagated more efficiently in glutamatergic neurons than GABAergic neurons in primary neuronal cultures. RNAscope in situ hybridization revealed a decrease in Vglut1 - and Vglut2 -expressing neurons in the ventral posterolateral nuclei of the thalamus in 22L strain-infected mice, whereas no decrease in Vgat -expressing neurons was observed in the adjacent reticular nucleus, mainly composed of Vgat -expressing interneurons. The excitatory neuron-prone prion propagation and excitatory neuronal loss in 22L strain-infected mice shed light on the neuropathological mechanism of prion diseases. [ABSTRACT FROM AUTHOR]

Background: Fatal familial insomnia (FFI) is a rare autosomal dominant inherited disease and a type of prion diseases. We report a case of fatal familial insomnia (FFI) in a 52-year-old man who was initially misdiagnosed as Alzheimer's disease. Case presentation: The patient presented with persistent insomnia as the initial symptom, accompanied by cognitive impairment, autonomic dysfunction, and disorders of voluntary movement. Cerebrospinal fluid analysis revealed a decrease in Aβ1−40 levels and an increase in total tau protein. Cranial imaging demonstrated bilateral hippocampal atrophy, while long-term video electroencephalography indicated focal abnormalities. The patient's prion protein gene was D178N/129MM type, confirmed the diagnosis of FFI. Conclusions: The key characteristics of FFI include insomnia and rapidly progressive dementia, its differential diagnosis with AD has been extensively discussed in clinical practice. This is the first report of FFI concerning Aβ and tau protein, raises the awareness that the ratio of p-tau/t-tau in cerebrospinal fluid can provide valuable diagnostic clues for FFI. [ABSTRACT FROM AUTHOR]

Misfolding of normal prion protein (PrPC) to pathological isoforms (prions) causes prion diseases (PrDs) with clinical manifestations including cognitive decline and mood-related behavioral changes. Cognition and mood are linked to the neurophysiology of the limbic system. Little is known about how the disease affects the synaptic activity in brain parts associated with this system. We hypothesize that the dysfunction of synaptic transmission in the limbic regions correlates with the onset of reduced cognition and behavioral deficits. Here, we studied how prion infection in mice disrupts the synaptic function in three limbic regions, the hippocampus, hypothalamus, and amygdala, at a pre-clinical stage (mid-incubation period) and early clinical onset. PrD caused calcium flux dysregulation associated with lesser spontaneous synchronous neuronal firing and slowing neural oscillation at the pre-clinical stage in the hippocampal CA1, ventral medial hypothalamus, and basolateral amygdala (BLA). At clinical onset, synaptic transmission and synaptic plasticity became significantly disrupted. This correlated with a substantial depletion of the soluble prion protein, loss of total synapses, abnormal neurotransmitter levels and synaptic release, decline in synaptic vesicle recycling, and cytoskeletal damage. Further, the amygdala exhibited distinct disease-related changes in synaptic morphology and physiology compared with the other regions, but generally to a lesser degree, demonstrating how different rates of damage in the limbic system influence the evolution of clinical disease. Overall, PrD causes synaptic damage in three essential limbic regions starting at a preclinical stage and resulting in synaptic plasticity dysfunction correlated with early disease signs. Therapeutic drugs that alleviate these early neuronal dysfunctions may significantly delay clinical onset. [ABSTRACT FROM AUTHOR]

Background: Scrapie is an infectious prion disease in sheep. Selective breeding for resistant genotypes of the prion protein gene (PRNP) is an effective way to prevent scrapie outbreaks. Genotyping all selection candidates in a population is expensive but existing pedigree records can help infer the probabilities of genotypes in relatives of genotyped animals. Results: We used linear models to predict allele content for the various PRNP alleles found in Icelandic sheep and compiled the available estimates of relative scrapie susceptibility (RSS) associated with PRNP genotypes from the literature. Using the predicted allele content and the genotypic RSS we calculated estimated breeding values (EBV) for RSS. We tested the predictions on simulated data under different scenarios that varied in the proportion of genotyped sheep, genotyping strategy, pedigree recording accuracy, genotyping error rates and assumed heritability of allele content. Prediction of allele content for rare alleles was less successful than for alleles with moderate frequencies. The accuracy of allele content and RSS EBV predictions was not affected by the assumed heritability, but the dispersion of prediction was affected. In a scenario where 40% of rams were genotyped and no errors in genotyping or recorded pedigree, the accuracy of RSS EBV for ungenotyped selection candidates was 0.49. If only 20% of rams were genotyped, or rams and ewes were genotyped randomly, or there were 10% pedigree errors, or there were 2% genotyping errors, the accuracy decreased by 0.07, 0.08, 0.03 and 0.04, respectively. With empirical data, the accuracy of RSS EBV for ungenotyped sheep was 0.46–0.65. Conclusions: A linear model for predicting allele content for the PRNP gene, combined with estimates of relative susceptibility associated with PRNP genotypes, can provide RSS EBV for scrapie resistance for ungenotyped selection candidates with accuracy up to 0.65. These RSS EBV can complement selection strategies based on PRNP genotypes, especially in populations where resistant genotypes are rare. [ABSTRACT FROM AUTHOR]

Simple Summary: Prion diseases are rare and fatal neurodegenerative disorders associated with the shadow of the prion protein (SPRN) gene. Raccoon dogs, members of the Canidae family, may exhibit resistance to these diseases, yet the specific factors underlying this resistance remain unidentified. In this study, we amplified and analyzed the SPRN gene in raccoon dogs using PCR and DNA sequencing, identifying five novel genetic polymorphisms. In silico analysis assessed the pathogenic potential of these insertion/deletion polymorphisms, indicating that they are non-pathogenic. This research marks the first exploration of the genetic and structural characteristics of the SPRN gene in raccoon dogs. Prion diseases, or transmissible spongiform encephalopathies (TSEs), are a group of invariably fatal neurodegenerative disorders. One of the candidate genes involved in prion diseases is the shadow of the prion protein (SPRN) gene. Raccoon dogs, a canid, are considered to be a prion disease-resistant species. To date, the genetic polymorphisms of the SPRN gene and the predicted protein structure of the shadow of prion protein (Sho) have not been explored in raccoon dogs. SPRN was amplified using polymerase chain reaction (PCR). We also investigated the genetic polymorphisms of SPRN by analyzing the frequencies of genotypes, alleles, and haplotypes, as well as the linkage disequilibrium among the identified genetic variations. In addition, in silico analysis with MutPred-Indel was performed to predict the pathogenicity of insertion/deletion polymorphisms. Predicted 3D structures were analyzed by the Alphafold2. We found a total of two novel synonymous single nucleotide polymorphisms and three insertion/deletion polymorphisms. In addition, the 3D structure of the Sho protein in raccoon dogs was predicted to resemble that of the Sho protein in dogs. This is the first study regarding the genetic and structural characteristics of the raccoon dog SPRN gene. [ABSTRACT FROM AUTHOR]

The article published in PLoS Pathogens discusses therapeutic perspectives for prion diseases in humans and animals. Prion diseases are neurodegenerative disorders caused by misfolded prion proteins. The research focuses on developing anti-prion therapies targeting different aspects of the protein misfolding process, including strategies to reduce the expression of prion proteins and inhibit the conversion of normal prion proteins into disease-associated forms. Various approaches have been explored, but significant challenges remain in developing effective treatments due to the complexity of prion strains and the lack of sensitive detection methods for early diagnosis. [Extracted from the article]

Background: Prion diseases are irreversible infectious neurodegenerative diseases caused by a contagious form of prion protein (PrPSc). Since chronic wasting disease (CWD)-infected white-tailed deer are strong carriers of the prion seed through corpses via scavenger animals, preemptive control based on genetic information for a culling system is necessary. However, the risk of CWD-related genetic variants has not been fully evaluated. In the present study, we carried out a quantitative estimation of the risk of a G96S single nucleotide polymorphism (SNP) of the PRNP gene to CWD infection in white-tailed deer. Methods: We carried out a literature search for genetic data of the G96S (c.286G>A) SNP of the PRNP gene from CWD-infected white-tailed deer and matched controls. We performed a meta-analysis using incorporated eligible studies to evaluate the association of the G96S SNP of the PRNP gene with susceptibility to CWD in white-tailed deer. Results: We identified a strong association between the G96S (c.286G>A) SNP of the PRNP gene and susceptibility to CWD infection in white-tailed deer using meta-analysis. We observed the most significant association in the recessive model (odds ratio = 3.0050, 95% confidence interval: 2.0593; 4.3851, p < 0.0001), followed by the additive model (odds ratio = 2.7222, 95% confidence interval: 1.9028; 3.8945, p < 0.0001) and the heterozygote (AA vs. AG) comparison (odds ratio = 2.7405, 95% confidence interval: 1.9215; 3.9085, p < 0.0001). Conclusion: To the best of our knowledge, this was the first meta-analysis of the association between the G96S (c.286G>A) SNP of the PRNP gene and susceptibility to CWD infection. [ABSTRACT FROM AUTHOR]

In patients with synucleinopathies, the protein α-synuclein misfolds into multiple conformations, each of which determines whether a patient develops multiple system atrophy (MSA) or one of three Lewy body diseases (LBDs). However, patients may also first present with pure autonomic failure, which strictly impacts autonomic nerves in the periphery, which can then phenoconvert into MSA or a LBD. When neuroinvasion happens, it remains unknown if strain properties are retained or if strain adaptation occurs, even though neuroinvasion of some prion protein (PrP) strains is known to result in the emergence of novel PrP strain variants. To investigate this question in synucleinopathies, we inoculated TgM83+/- mice, which express human α-synuclein with the A53T mutation, with a mouse-passaged MSA patient sample either intracranially (i.c.) or into the sciatic nerve (sc.n.), and compared the biochemical and biological properties of α-synuclein prions in the brains of terminal mice. Importantly, while i.c. and sc.n. transmission studies generated pathogenic α-synuclein with similar properties, both the primary and secondary passaged MSA samples had different infectivity profiles in a panel of α-syn140-YFP cells than the starting MSA patient sample, indicating that MSA prions adapt during initial passage in TgM83+/- mice. Similarly, using i.c. inoculation of A53T preformed fibrils to study strain selection, we found both biochemical and biological evidence that mouse passage exerts a selective pressure on α-synuclein prions in which a sub-population of starting conformations emerges in terminal animals. Together, these findings demonstrate that similar conformational selective pressures known to impact PrP prion replication also impact replication of α-synuclein prions. Author summary: The protein α-synuclein can misfold into multiple shapes that self-template (i.e., becomes a prion) to cause a group of neurodegenerative disorders known as synucleinopathies. The misfolded shape that α-synuclein adopts, or prion strain, determines the disorder a patient will develop. While the selective pressures that impact this same phenomenon in classical prion diseases, which are caused by misfolding of the prion protein, have been the focus of research for several decades, little is known about the effect of strain adaptation and/or selection on α-synuclein prion strains. The studies reported here demonstrate that both conformational selective pressures impact α-synuclein prion replication, which has important consequences for diagnostic and therapeutic development. [ABSTRACT FROM AUTHOR]

Microglia are recognized as the main cells in the central nervous system responsible for phagocytosis. The current study demonstrates that in prion disease, microglia effectively phagocytose prions or PrPSc during early preclinical stages. However, a critical shift occurred in microglial activity during the late preclinical stage, transitioning from PrPSc uptake to establishing extensive neuron-microglia body-to-body cell contacts. This change was followed by a rapid accumulation of PrPSc in the brain. Microglia that enveloped neurons exhibited hypertrophic, cathepsin D-positive lysosomal compartments. However, most neurons undergoing envelopment were only partially encircled by microglia. Despite up to 40% of cortical neurons being partially enveloped at clinical stages, only a small percentage of envelopment proceeded to full engulfment. Partially enveloped neurons lacked apoptotic markers, but showed signs of functional decline. Neuronal envelopment was independent of the CD11b pathway, previously associated with phagocytosis of newborn neurons during neurodevelopment. This phenomenon of partial envelopment was consistently observed across multiple prion-affected brain regions, various mouse-adapted strains, and different subtypes of sporadic Creutzfeldt-Jakob disease (sCJD) in humans. The current work describes a phenomenon of partial envelopment of neurons by reactive microglia in the context of an actual neurodegenerative disease, not a disease model. [ABSTRACT FROM AUTHOR]

Objective: Prion disease classically presents with rapidly progressive dementia, leading to death within months of diagnosis. Advances in diagnostic testing have improved recognition of patients with atypical presentations and protracted disease courses, raising key questions surrounding the relationship between patterns of neurodegeneration and survival. We assessed the contribution of fluorodeoxyglucose (FDG‐PET) imaging for this purpose. Methods: FDG‐PET were performed in 40 clinic patients with prion disease. FDG‐PET images were projected onto latent factors generated in an external dataset to yield patient‐specific eigenvalues. Eigenvalues were input into a clustering algorithm to generate data‐driven clusters, which were compared by survival time. Results: Median age at FDG‐PET was 65.3 years (range 23–85). Median time from FDG‐PET to death was 3.7 months (range 0.3–19.0). Four data‐driven clusters were generated, termed "Neocortical" (n = 7), "Transitional" (n = 12), "Temporo‐parietal" (n = 13), and "Deep nuclei" (n = 6). Deep nuclei and transitional clusters had a shorter survival time than the neocortical cluster. Subsequent analyses suggested that this difference was driven by greater hypometabolism of deep nuclei relative to neocortical areas. FDG‐PET‐patterns were not associated with demographic (age and sex) or clinical (CSF total‐tau, 14‐3‐3) variables. Interpretation: Greater hypometabolism within deep nuclei relative to neocortical areas associated with more rapid decline in patients with prion disease and vice versa. FDG‐PET informs large‐scale network physiology and may inform the relationship between spreading pathology and survival in patients with prion disease. Future studies should consider whether FDG‐PET may enrich multimodal prion disease prognostication models. [ABSTRACT FROM AUTHOR]

Simple Summary: Cats are important subjects in the study of feline spongiform encephalopathy (FSE), but the genetic factors contributing to their susceptibility have yet to be identified. Since the prion-like protein gene (PRND) is known to play a significant role in prion disease susceptibility among the prion protein gene family, investigating the genetic characteristics of the PRND gene in cats is essential. In this study, we identified 13 novel genetic variations. Using in silico tools, we found that four non-synonymous single nucleotide polymorphisms (SNPs)—c.76G>A (A26T), c.97A>G (I33V), c.251A>G (Q84R), and c.469C>A (L157I)—have the potential to disrupt protein structure and function. Linkage analysis revealed strong associations between PRND SNPs c.97A>G and c.251A>G and the PRNP InDel c.214_240delCCCCACGCCGGCGGAGGCTGGGGTCAG (p.76_84delPHAGGGWGQ), suggesting a shared genetic influence on disease susceptibility. This is the first study to investigate the genetic characteristics of the PRND gene in cats, and this analysis is expected to provide valuable baseline data for future functional studies. Prion diseases are fatal neurodegenerative disorders caused by the misfolding of the normal cellular prion protein (PrPC) into its infectious isoform (PrPSc). Although prion diseases in humans, sheep, goats, and cattle have been extensively studied, feline spongiform encephalopathy (FSE) remains poorly understood. Genetic factors, particularly polymorphisms in the prion protein gene (PRNP) and prion-like protein gene (PRND), have been linked to prion disease susceptibility in various species. However, no studies have yet investigated the PRND gene in cats with respect to prion diseases. Therefore, we investigated polymorphisms in the feline PRND gene and analyzed their genetic characteristics. We sequenced the coding region of the PRND gene using samples from 210 domestic cats and determined the genotype and allele frequencies of PRND polymorphisms. We identified thirteen novel single nucleotide polymorphisms (SNPs), including six non-synonymous variants and one insertion/deletion (InDel) in the feline PRND gene. Four of the non-synonymous SNPs were predicted to have deleterious effects on the Doppel protein's structure and function. Notably, the SNP c.97A>G (I33V) showed potential structural clashes, and the others formed additional hydrogen bonds. The LD analysis revealed strong genetic associations between the PRND SNPs and the PRNP InDel, suggesting linkage between these loci in cats. This study identifies novel PRND polymorphisms in domestic cats and provides new insights into the genetic factors underlying feline susceptibility to prion diseases. The strong genetic linkage between PRND and PRNP polymorphisms, coupled with predictions of detrimental effects on Doppel protein structure, suggests that PRND gene variants could influence prion disease progression in cats. These findings provide a foundational framework for future studies on the functional implications of PRND polymorphisms in FSE. To the best of our knowledge, this study is the first report on the genetic characteristics of PRND polymorphisms in cats. [ABSTRACT FROM AUTHOR]

Over the past four decades, prion diseases have received considerable research attention owing to their potential to be transmitted within and across species as well as their consequences for human and animal health. The unprecedented nature of prions has led to the discovery of a paradigm of templated protein misfolding that underlies a diverse range of both disease-related and normal biological processes. Indeed, the "prion-like" misfolding and propagation of protein aggregates is now recognized as a common underlying disease mechanism in human neurodegenerative disorders such as Alzheimer's and Parkinson's disease, and the prion principle has led to the development of novel diagnostic and therapeutic strategies for these illnesses. Despite these advances, research into the fundamental biology of prion diseases has declined, likely due to their rarity and the absence of an acute human health crisis. Given the past translational influence, continued research on the etiology, pathogenesis, and transmission of prion disease should remain a priority. In this review, we highlight several important "unsolved mysteries" in the prion disease research field and how solving them may be crucial for the development of effective therapeutics, preventing future outbreaks of prion disease, and understanding the pathobiology of more common human neurodegenerative disorders. [ABSTRACT FROM AUTHOR]

Copyright of Biomédica: Revista del Instituto Nacional de Salud is the property of Instituto Nacional de Salud of Colombia and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

The document published in Acta Neuropathologica discusses the unsuccessful transmissions of atypical genetic Creutzfeldt–Jakob disease (PRNP p.T183A-129M) in transgenic mice. This specific genetic mutation is associated with early onset of the disease and a unique immunoblot profile. The study aimed to evaluate the transmission properties of this genetic prion disease in various animal recipients but found no evidence of transmission in any inoculated mice, highlighting the distinct features of this particular genetic form of the disease. The study suggests that abnormal glycosylation may play a role in the reduced transmission efficiency associated with this genetic variant. [Extracted from the article]

Understanding why certain neurons are more sensitive to dysfunction and death caused by misfolded proteins could provide therapeutically relevant insights into neurodegenerative disorders. Here, we harnessed single-cell transcriptomics to examine live neurons isolated from prion-infected female mice, aiming to identify and characterize prion-vulnerable neuronal subsets. Our analysis revealed distinct transcriptional responses across neuronal subsets, with a consistent pathway-level depletion of synaptic gene expression in damage-vulnerable neurons. By scoring neuronal damage based on the magnitude of depleted synaptic gene expression, we identified a diverse spectrum of prion-vulnerable glutamatergic, GABAergic, and medium spiny neurons. Comparison between prion-vulnerable and resistant neurons highlighted baseline gene expression differences that could influence neuronal vulnerability. For instance, the neuroprotective cold-shock protein Rbm3 exhibited higher baseline gene expression in prion-resistant neurons and was robustly upregulated across diverse neuronal classes upon prion infection. We also identified vulnerability-correlated transcripts that overlapped between prion and Alzheimer's disease. Our findings not only demonstrate the potential of single-cell transcriptomics to identify damage-vulnerable neurons, but also provide molecular insights into neuronal vulnerability and highlight commonalties across neurodegenerative disorders. Neurons may exhibit vulnerability or resistance to neurodegeneration. Here, the authors applied single-cell RNA sequencing to characterize live neurons isolated from prion-infected mice and identified genes that may influence vulnerability. [ABSTRACT FROM AUTHOR]

Variably Protease Sensitive Prionopathy (VPSPr) is a rare human prion disease that, like Creutzfeldt-Jakob disease (CJD), results in the deposition of abnormally folded prion protein aggregates in the brain and is ultimately fatal. Neuropathology and clinical features of VPSPr are heterogeneous. However, the key discriminating feature is the relative sensitivity of the pathological prion protein to proteinase digestion compared to that typically seen in other human prion cases. Three major fragments of 23, 17 and 7 kDa are characteristic of the disease following digestion with proteinase K. We recently reported the utility of the highly adaptive and reproducible ProteinSimple™ capillary electrophoresis (CE) system to perform protein separation of PK digested prion protein in CJD. Consequently, we explored capillary-based electrophoresis (CE) technology as a sensitive method to detect and characterize VPSPr in a cohort of 29 cases. The unique 7 kDa fragment has high intensity, particularly in cases with the codon 129 VV genotype, but can be missed by regular Western blotting due to the small size. However, this fragment is readily detected by CE in all cases. In addition, the flexibility of CE produced highly reproducible, semi-quantitative data for determining relative proteinase K sensitivity and epitope mapping of representative cases from each codon 129 genotype (VV, MV and MM). [ABSTRACT FROM AUTHOR]

Mammalian prions are neurotropic pathogens formed from PrPSc assemblies, a misfolded variant of the host‐encoded prion protein PrPC. Multiple PrPSc conformations or strains self‐propagate in host populations or mouse models of prion diseases, exhibiting distinct biological and biochemical phenotypes. Constrained interactions between PrPSc and PrPC conformations confer species specificity and regulate cross‐species transmission. The pathogenicity of fibrillar assemblies derived from bacterially expressed recombinant PrP (rPrP) has been instrumental in demonstrating the protein‐only nature of prions. Yet, their ability to encode different strains and transmit between species remains poorly studied, hampering their use in exploring structure‐to‐strain relationships. Fibrillar assemblies from rPrP with hamster, mouse, human, and bovine primary structures were generated and tested for transmission and adaptation in tg7 transgenic mice expressing hamster PrPC. All assemblies, except the bovine ones, were fully pathogenic on the primary passage, causing clinical disease, PrPSc brain deposition, and spongiform degeneration. They exhibited divergent adaptation processes and strain properties upon subsequent passage. Assemblies of hamster origin propagated without apparent need for adaptation, those of mouse origin adapted abruptly, and those of human origin required serial passages for optimal fitness. Molecular analyses revealed the presence of endogenously truncated PrPSc species in the resulting synthetic strains that lack the 90–140 amino acid region considered crucial for infectivity. In conclusion, rPrP assemblies provide a facile means of generating novel prion strains with adaptative/evolutive properties mimicking genuine prions. The PrP amino acid backbone is sufficient to encode different strains with specific adaptative properties, offering insights into prion transmission and strain diversity. [ABSTRACT FROM AUTHOR]

Prion diseases are transmissible, fatal neurologic diseases of mammals caused by the accumulation of mis-folded, disease associated prion protein (PrPd). Creutzfeldt-Jakob Disease (CJD) is the most common human prion disease and can occur by sporadic onset (sCJD) (~85% of CJD cases), genetic mutations in the prion protein gene (10–15%) or iatrogenic transmission (rare). PrPd is difficult to inactivate and many methods to reduce prion infectivity are dangerous, caustic, expensive, or impractical. Identifying viable and safe methods for decontamination of CJD exposed materials is critically important for medical facilities and research institutions. Previous research has shown that concentrated sodium hypochlorite (bleach) was effective at inactivation of CJD prions derived from brains of mice or guinea pigs. Unfortunately, human prions adapted to rodents may mis-fold differently than in humans, and the rodent adapted prions may not have the same resistance or susceptibility to inactivation present in bona fide CJD prions. To confirm that bleach was efficacious against human sourced CJD prions, we exposed different subtypes of sCJD-infected human brain homogenates to different concentrations of bleach for increasing exposure times. Initial and residual prion seeding activity following inactivation were measured using Real-Time Quaking Induced Conversion. In addition, we tested how passage of human sCJD into either transgenic mice that expressed human prion protein, or transmission of CJD to human cerebral organoids (CO), two common laboratory practices, may affect CJD prions' susceptibility to bleach inactivation. Our results show that bleach is effective against human sourced sCJD prions, and both treatment time and concentration of bleach were important factors for CJD inactivation. CJD derived from human brains, transgenic mouse brains or CO were all susceptible to inactivation with as low as a 10 percent bleach solution with a 30-minute exposure time or a 50 percent bleach solution with as little as a 1-minute exposure time. [ABSTRACT FROM AUTHOR]

Gerstmann–Sträussler–Scheinker (GSS) disease is an inherited prion disease characterized by dementia, cerebellar ataxia, and painful sensory disturbances. GSS is pathologically defined by the presence of amyloid plaques comprised of prion protein predominantly localized in the cerebral cortex, cerebellar cortex, and basal ganglia, resulting from mutations in the prion protein gene. This study investigated five cases of GSS P102L [GSS caused by a leucine (L) substitution of proline (P) at position 102 of the prion protein gene] with L-dopa-resistant extrapyramidal symptoms and reduced dopamine transporter single-photon emission computed tomography (DAT-SPECT) uptake. Clinical findings revealed diverse manifestations, with all cases exhibiting parkinsonism, and four patients had a vertical gaze palsy. Notably, all patients showed reduced striatal DAT-SPECT uptake, indicating neurodegeneration of the nigrostriatal system. Autopsy findings in one case confirmed prion protein plaques and dopaminergic neuron loss in the substantia nigra of a patient with GSS P102L. Additionally, reduced DAT immunostaining was observed in the putamen compared with a control. While previous studies have identified reduced DAT-SPECT and positron emission tomography uptake in Creutzfeldt-Jakob disease and fatal familial insomnia owing to nigrostriatal neurodegeneration induced by abnormal prion protein deposition, similar phenomena in GSS P102L have not been reported. This study provides support for a correlation between abnormal prion protein deposition and nigrostriatal system degeneration in GSS P102L. Our results reveal the importance of considering GSS P102L in cases of atypical Parkinsonism and abnormal DAT-SPECT results, which would serve as a valuable indicator for subsequent prion genetic testing. [ABSTRACT FROM AUTHOR]

Peptides possess a number of pharmacologically desirable properties, including greater chemical diversity than other biomolecule classes and the ability to selectively bind to specific targets with high potency, as well as biocompatibility, biodegradability, and ease and low cost of production. Consequently, there has been considerable interest in developing peptide-based therapeutics, including amyloid inhibitors. However, a major hindrance to the successful therapeutic application of peptides is their poor delivery to target tissues, cells or subcellular organelles. To overcome these issues, recent efforts have focused on engineering cell-penetrating peptide (CPP) antagonists of amyloidogenesis, which combine the attractive intrinsic properties of peptides with potent therapeutic effects (i.e., inhibition of amyloid formation and the associated cytotoxicity) and highly efficient delivery (to target tissue, cells, and organelles). This review highlights some promising CPP constructs designed to target amyloid aggregation associated with a diverse range of disorders, including Alzheimer's disease, transmissible spongiform encephalopathies (or prion diseases), Parkinson's disease, and cancer. [ABSTRACT FROM AUTHOR]

(1) Background: Creutzfeldt–Jakob disease (CJD) is a rare and fatal neurodegenerative disorder caused by the accumulation of an altered prion protein, which usually leads to death within one year after clinical onset. CJD patients usually present with rapid cognitive impairment associated with declines in cerebellar, motor, visual, behavioral, and swallowing functions. Moreover, CJD patients lose their ability to eat and take medications orally very early on in treatment; nevertheless, there are no specific nutritional guidelines for this disease shared worldwide. (2) Methods: This review aims to describe the nutritional outcomes of CJD patients in Western countries to compare them with those described in East Asian countries and then aims to explore the most recent trends in the nutritional management of CJD patients, including some dietary compounds that present neuroprotective effects. (3) Results: In Japan's, Taiwan's, and China's healthcare systems, CJD patients receive intensive life-sustaining treatment that prolongs their survival (i.e., artificial feeding); conversely, in Western countries, intensive life-sustaining treatments like tube feeding are not commonly provided to CJD patients. (4) Conclusions: It is difficult to pinpoint the reasons for these discrepancies around CJD palliative care supply, but it is clear that specific nutritional guidelines may directly improve the nutritional management of CJD patients and thus allow their families and caregivers to ensure the best end-of-life care for these patients. [ABSTRACT FROM AUTHOR]

The document discusses neurobiology research on neurodegenerative disorders, focusing on Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis (ALS), and Skogholt's disease. Various studies explore potential therapeutic strategies, including the use of Apelin-13 and probiotics in AD, the role of GABAAR benzodiazepine binding sites in PD, and the involvement of SOCS3 in ALS progression. Additionally, the document addresses the importance of early diagnosis, immune mechanisms, hormonal regulation, and bioinformatics tools in understanding and treating neurodegenerative diseases. The research presented aims to contribute to the development of more effective treatments for these complex disorders. [Extracted from the article]

Background/Objectives: Sporadic Creutzfeldt–Jakob disease (sCJD) is a fatal neurodegenerative disorder traditionally diagnosed based on the World Health Organization (WHO) criteria in 1998. Recently, Hermann et al. proposed updated diagnostic criteria incorporating advanced biomarkers to enhance early detection of sCJD. This study aimed to evaluate the sensitivity and specificity of Hermann's criteria compared with those of the WHO criteria in a large cohort of patients suspected of prion disease in Japan. Methods: In this retrospective cohort study, we examined the new criteria using data of 2004 patients with suspected prion disease registered with the Japanese Prion Disease Surveillance (JPDS) between January 2009 and May 2023. Patients with genetic or acquired prion diseases or incomplete data necessary for the diagnostic criteria were excluded, resulting in 786 eligible cases. The sensitivity and specificity of the WHO and Hermann's criteria were calculated by comparing diagnoses with those made by the JPDS Committee. Results: Of the 786 included cases, Hermann's criteria helped identify 572 probable cases compared with 448 by the WHO criteria. The sensitivity and specificity of the WHO criteria were 96.4% and 96.6%, respectively. Hermann's criteria demonstrated a sensitivity of 99.3% and a specificity of 95.2%, indicating higher sensitivity but slightly lower specificity. Fifty-five cases were classified as "definite" by both criteria. Conclusions: The findings suggest that Hermann's criteria could offer improved sensitivity for detecting sCJD, potentially reducing diagnostic oversight. However, caution is advised in clinical practice to avoid misdiagnosis, particularly in treatable neurological diseases, by ensuring thorough exclusion of other potential conditions. [ABSTRACT FROM AUTHOR]

To analyze the relationship between Chemokine IP10 and its receptor CXCR3 during prion infection. We investigated the increases in IP10 signals, primarily localized in neurons within the brains of scrapie-infected mice, using western blotting, ELISA, co-immunoprecipitation, immunohistochemistry, immunofluorescence assays, and RT-PCR. Both CXCR3 levels and activation were significantly higher in the brains of scrapie-infected mice and prion-infected SMB-S15 cells. Enhanced CXCR3 expression was predominantly observed in neurons and activated microglia. Morphological colocalization of PrPC/PrPSc with IP10/CXCR3 was observed in scrapie-infected mouse brains using immunohistochemistry and immunofluorescence. immunohistochemistry (IHC) analysis of whole brain sections further revealed increased accumulation of IP10/CXCR3 specifically in brain regions with higher levels of PrPSc deposits. Co-immunoprecipitation and biomolecular interaction assays revealed the molecular interactions between PrP and IP10/CXCR3. Notably, a significantly larger amount of IP10 accumulated within prion-infected SMB-S15 cells than in the normal partner cell line, SMB-PS. Importantly, resveratrol treatment effectively suppressed prion replication in SMB-S15 cells, thereby restoring the accumulation and secretion pattern of cellular IP10 similar to that observed in SMB-PS cells. Our data demonstrate that the activation of IP10/CXCR3 signaling in prion-infected brain tissues coincides with PrPSc deposition. Modulation of IP10/CXCR3 signaling in the brain represents a potential therapeutic target for mitigating the progression of prion diseases. [ABSTRACT FROM AUTHOR]

Introduction: According to the neuroinflammatory hypothesis, a cytokine-mediated host innate immune response may be involved in the mechanisms that contribute to the process of neurodegeneration. Specifically, regarding prion diseases, some experimental murine models have evidenced an altered profile of inflammatory intermediaries. However, the local inflammatory response has rarely been assessed, and never in tissues from different natural models throughout the progression of neurodegeneration. Methods: The aim of this study was to use immunohistochemistry (IHC) to in situ assess the temporal protein expression of several cytokines in the cerebellum of sheep suffering from various clinical stages of scrapie. Results and discussion: Clear changes in the expression of most of the assessed markers were observed in the affected sheep compared to the healthy control sheep, and from different stages. In summary, this preliminary IHC study focusing in the Purkinje cell layer changes demonstrate that all cytokines or respective receptors studied (IL-1, IL-1R, IL-2R, IL-6, IL-10R, and TNFαR) except for IFNγR are disease-associated signaling proteins showing an increase or decrease in relation to the progression of clinical disease. In the future, this study will be extended to other inflammatory mediators and brain regions, focusing in particular on the release of these inflammatory mediators by astroglial and microglial populations. [ABSTRACT FROM AUTHOR]

The findings of brain perfusion single-photon emission computed tomography (SPECT), which detects abnormalities often before changes manifest in morphological imaging, mainly reflect neurodegeneration and contribute to dementia evaluation. A major shift is about to occur in dementia practice to the approach of diagnosing based on biomarkers and treating with disease-modifying drugs. Accordingly, brain perfusion SPECT will be required to serve as a biomarker of neurodegeneration. Hypoperfusion in Alzheimer's disease (AD) is typically seen in the posterior cingulate cortex and precuneus early in the disease, followed by the temporoparietal cortices. On the other hand, atypical presentations of AD such as the posterior variant, logopenic variant, frontal variant, and corticobasal syndrome exhibit hypoperfusion in areas related to symptoms. Additionally, hypoperfusion especially in the precuneus and parietal association cortex can serve as a predictor of progression from mild cognitive impairment to AD. In dementia with Lewy bodies (DLB), the differentiating feature is the presence of hypoperfusion in the occipital lobes in addition to that observed in AD. Hypoperfusion of the occipital lobe is not a remarkable finding, as it is assumed to reflect functional loss due to impairment of the cholinergic and dopaminergic systems rather than degeneration per se. Moreover, the cingulate island sign reflects the degree of AD pathology comorbid in DLB. Frontotemporal dementia is characterized by regional hypoperfusion according to the three clinical types, and the background pathology is diverse. Idiopathic normal pressure hydrocephalus shows apparent hypoperfusion around the Sylvian fissure and corpus callosum and apparent hyperperfusion in high-convexity areas. The cortex or striatum with diffusion restriction on magnetic resonance imaging in prion diseases reflects spongiform degeneration and brain perfusion SPECT reveals hypoperfusion in the same areas. Brain perfusion SPECT findings in dementia should be carefully interpreted considering background pathology. [ABSTRACT FROM AUTHOR]

Chronic wasting disease (CWD) is a prion disease afflicting wild and farmed elk. CWD prions (PrPSc) are infectious protein conformations that replicate by inducing a natively expressed prion protein (PrPC) to refold into the prion conformation. Mass spectrometry was used to study the prions resulting from a previously described experimental inoculation of MM132, ML132, and LL132 elk with a common CWD inoculum. Chymotryptic digestion times and instrument parameters were optimized to yield a set of six peptides, TNMK, MLGSAMSRPL, LLGSAMSRPL, ENMYR, MMER, and VVEQMCITQYQR. These peptides were used to quantify the amount, the M132 and L132 polymorphic composition, and the extent of methionine oxidation of elk PrPSc. The amount (ng/g brain tissue) of PrPSc present in each sample was determined to be: MM132 (5.4 × 102 ± 7 × 101), ML132 (3.3 × 102 ± 6 × 101 and 3.6 × 102 ± 3 × 101) and LL132 (0.7 × 102 ± 1 × 101, 0.2 × 102 ± 0.2 × 101, and 0.2 × 102 ± 0.5 × 101). The proportion of L132 polymorphism in ML132 (heterozygous) PrPSc from CWD-infected elk was determined to be 43% ± 2% or 36% ± 3%. Methionine oxidation was detected and quantified for the M132 and L132 polymorphisms in the samples. In this way, mass spectrometry can be used to characterize prion strains at a molecular level. [ABSTRACT FROM AUTHOR]

Although the development of aggregation assays has noticeably improved the accuracy of the clinical diagnosis of prion diseases, research on biomarkers remains vital. The major challenges to overcome are non-invasive sampling and the exploration of new biomarkers that may predict the onset or reflect disease progression. This will become extremely important in the near future, when new therapeutics are clinically evaluated and eventually become available for treatment. This article aims to provide an overview of the achievements of biomarker research in human prion diseases, addresses unmet needs in the field, and points out future perspectives.

Creutzfeldt-Jakob disease is a rare neurodegenerative disease caused by prions. We present the case of a woman in the seventh decade of life with rapidly progressive dementia and myoclonus. Her brain magnetic resonance imaging revealed lesions in the basal nuclei, and the electroencephalogram showed periodic bilateral epileptiform discharges. In the cerebrospinal fluid, the prion protein was detected using the real-time quaking-induced conversion test (RT-QuIC), and elevated levels of tau and 14-3-3 proteins. We emphasize the significance of determining the prion protein in the definitive diagnosis of this disease.

Creutzfeldt-Jakob disease (CJD) is a rare spongiform encephalopathy characterized by a rapid neurodegenerative progress, caused by a misfolded variant of the cellular prion protein (PrP) known as PrPSc. The clinical presentation of sCJD includes a wide range of neurological signs of cortical, subcortical, or cerebellar origin, either isolated or in various combinations. Due to this protean clinical presentation form, sCJD must be distinguished from other dementias. In this case report, we discuss the Heidenhain variant of Creutzfeldt-Jakob disease (HvCJD), a rare variant characterized by early visual symptoms and typical findings in imaging scans. Our patient presented rapidly progressive dementia and a history of visual hallucinations. As for other prion diseases, only symptomatic treatment is available for HvCJD. Thirty years of clinical investigation of patients with prion disease have resulted in little progress in either defining or evaluating potential treatments.

Chronic wasting disease (CWD) is a widely distributed prion disease of cervids with implications for wildlife conservation and also for human and livestock health. The structures of infectious prions that cause CWD and other natural prion diseases of mammalian hosts have been poorly understood. Here we report a 2.8 Å resolution cryogenic electron microscopy-based structure of CWD prion fibrils from the brain of a naturally infected white-tailed deer expressing the most common wild-type PrP sequence. Like recently solved rodent-adapted scrapie prion fibrils, our atomic model of CWD fibrils contains single stacks of PrP molecules forming parallel in-register intermolecular β-sheets and intervening loops comprising major N- and C-terminal lobes within the fibril cross-section. However, CWD fibrils from a natural cervid host differ markedly from the rodent structures in many other features, including a ~ 180° twist in the relative orientation of the lobes. This CWD structure suggests mechanisms underlying the apparent CWD transmission barrier to humans and should facilitate more rational approaches to the development of CWD vaccines and therapeutics. [ABSTRACT FROM AUTHOR]

Zoonotic transmission of bovine spongiform encephalopathy or mad cow disease, by presumed consumption of infected beef, has increased awareness of the public health risk associated with prion diseases. Chronic wasting disease (CWD) affects moose, elk, and deer, all of which are frequently consumed by humans. Clear evidence of CWD transmission to humans has not been demonstrated, yet, establishing whether CWD prions are present in muscle tissue preferentially consumed by humans is of increasing interest. Conventional assays including immunohistochemistry (IHC) and enzyme-linked immunosorbent assay (ELISA) lack the sensitivity to detect low concentrations of prions presumed to be present outside neural or lymphatic tissues. Here we combined two prion amplification assays, the product of protein misfolding cyclic amplification (PMCA) applied directly into real-time quaking induced conversion (RT-QuIC) [denoted now as PQ] to demonstrate the presence of prion seeding activity (i.e. prions) in ~55% of hamstring muscles harvested from CWD-positive white-tailed deer. This compares to prion detection in only 10% of the same samples employing standard RT-QuIC. To determine the extent of CWD dissemination within muscle tissues commonly consumed we tested 7 additional muscles from a subset of deer by PQ. Tongue demonstrated the highest level of prions with ~92% positive. All negative controls remained negative in all PMCA and RT-QuIC assays. We conclude that the combination of PMCA with RT-QuIC readout permits detection of low prion concentrations present in muscle tissue of CWD-infected deer. These findings further demonstrate the utility of amplification assays as tools to detect very low levels of prion burden and supports their use to fill knowledge gaps in our understanding of CWD pathogenesis and zoonotic potential. [ABSTRACT FROM AUTHOR]

Prion diseases are fatal infectious neurodegenerative diseases caused by the proteinase K-sensitive form of prion protein (PrPSc). The exact origin of prion seeding and the transition factor of PrPSc has not been elucidated. The main hosts of prion diseases are herbivores, so the feces and corpses of Amphibians can seed PrPSc through ecosystems. The frog is an excellent candidate for transmission studies for this reason, but genetic analyses of the prion protein gene (PRNP) in the context of prion-related characteristics of frog species are lacking. We amplified frog PRNP gene sequences in Dybowski's frog and the American bullfrog by polymerase chain reaction (PCR) and amplicon sequencing. In addition, we carried out multiple sequencing alignments and annotated major PrP components including signal peptide, tandem repeat domain, and PrPCPrPSc interaction region of frog PrPs by bioinformatics tools. We predicted secondary and tertiary structures and amyloid propensities of frog PrPs using AlphaFold2 and AMYCO, respectively. We obtained DNA sequences of the PRNP gene in Dybowski's frog and the American bullfrog, as well as a partially conserved palindromic sequence (PrPC-PrPSc interaction region) and absence of tandem repeat region of PrP in seven frog species. We analyzed protein structure of among these frog species and found that the high Himalaya frog has high aggregation propensity and the western clawed frog does not have the Nterminal signal peptide. To the best of our knowledge, this was the first comparative genetic study regarding prion-related features of frog species. [ABSTRACT FROM AUTHOR]

Prion disease is a fatal and infectious neurodegenerative disorder caused by the trans-conformation conversion of PRNP/PrPC to PRNP/PrPSc. Accumulated PRNP/PrPSc-induced ER stress causes chronic unfolded protein response (UPR) activation, which is one of the fundamental steps in prion disease progression. However, the role of various ER-resident proteins in prion-induced ER stress is elusive. This study demonstrated that ARL6IP5 is compensatory upregulated in response to chronically activated UPR in the cellular prion disease model (RML-ScN2a). Furthermore, overexpression of ARL6IP5 overcomes ER stress by lowering the expression of chronically activated UPR pathway proteins. We discovered that ARL6IP5 induces reticulophagy to reduce the PRNP/PrPSc burden by releasing ER stress. Conversely, the knockdown of ARL6IP5 leads to inefficient macroautophagic/autophagic flux and elevated PRNP/PrPSc burden. Our study also uncovered that ARL6IP5-induced reticulophagy depends on Ca2+-mediated AMPK activation and can induce 3 MA-inhibited autophagic flux. The detailed mechanistic study revealed that ARL6IP5-induced reticulophagy involves interaction with soluble reticulophagy receptor CALCOCO1 and lysosomal marker LAMP1, leading to degradation in lysosomes. Here, we delineate the role of ARL6IP5 as a novel ER stress regulator and reticulophagy inducer that can effectively reduce the misfolded PRNP/PrPSc burden. Our research opens up a new avenue of selective autophagy in prion disease and represents a potential therapeutic target.Abbreviations: ARL6IP5: ADP ribosylation factor-like GTPase 6 interacting protein 5; AMPK: adenosine 5’-monophosphate (AMP)-activated protein kinase; CALCOCO1: calcium binding and coiled-coil domain 1; CQ: chloroquine; DAPI: 4’6-diamino-2-phenylindole; ER: endoplasmic reticulum; ERPHS: reticulophagy/ER-phagy sites; KD: knockdown; KD-CON: knockdown control; LAMP1: lysosomal-associated membrane protein 1; MAP1LC3/LC3, microtubule-associated protein 1 light chain 3; MTOR: mechanistic target of rapamycin kinase; MβCD: methyl beta cyclodextrin; 3 MA: 3-methyladenine; OE: overexpression; OE-CON: empty vector control; PrDs: prion diseases; PRNP/PrPC: cellular prion protein (Kanno blood group); PRNP/PrPSc: infectious scrapie misfolded PRNP; Tm: tunicamycin; UPR: unfolded protein response; UPS: ubiquitin-proteasome system. [ABSTRACT FROM AUTHOR]

Introduction: Gerstmann-Sträussler-Scheinker (GSS) disease is an inherited prion disease characterized by dementia, cerebellar ataxia, and painful sensory disturbances. GSS is pathologically defined by the presence of amyloid plaques comprised of prion protein predominantly localized in the cerebral cortex, cerebellar cortex, and basal ganglia, resulting from mutations in the prion protein gene. Methods: This study investigated five cases of GSS P102L (GSS caused by a leucine (L) substitution of proline (P) at position 102 of the prion protein gene) with L-dopa-resistant extrapyramidal symptoms and reduced dopamine transporter single-photon emission computed tomography (DAT-SPECT) uptake. Clinical findings of the five cases were investigated, and in one autopsy case, hematoxylin and eosin staining, dopamine transporter immunostaining, and 8G8 immunostaining in the putamen and substantia nigra were performed and compared with controls. Results: Clinical findings revealed diverse manifestations, with all cases exhibiting parkinsonism, and four patients had a vertical gaze palsy. Notably, all patients showed reduced striatal DAT-SPECT uptake, indicating neurodegeneration of the nigrostriatal system. Autopsy findings in one case confirmed prion protein plaques and dopaminergic neuron loss in the substantia nigra of a patient with GSS P102L. In addition, DAT immunostaining in the putamen was reduced compared with controls, and prion protein plaques were confirmed by 8G8 immunostaining. Conclusion: This study provides support for a correlation between abnormal prion protein deposition and nigrostriatal system degeneration in GSS P102L. Our results reveal the importance of considering GSS P102L in cases of atypical Parkinsonism and abnormal DAT-SPECT results, which would serve as a valuable indicator for subsequent prion genetic testing. [ABSTRACT FROM AUTHOR]

The management of Neurodegenerative Diseases (NDs) is a substantial concern for healthcare systems at present. Alzheimer's disease, frontotemporal dementia, Parkinson's disease, prion disease, Huntington's disease and Amyotrophic lateral sclerosis are among these conditions. Pathogenic characteristics shared by these conditions include increased oxidative stress, misfolded proteins, dysfunctional mitochondria, excitotoxicity and neuro inflammation; these ultimately result in the deterioration of the structure and function of the nervous system. Despite extensive testing, there is currently no specific medication available to halt or cure the progression of these diseases. Therapy failure in neurodegenerative illnesses is often linked to the limitations posed by P-glycoproteins, the blood-brain barrier and the blood-cerebrospinal fluid barrier. Nevertheless, recent progress in nanotechnology presents an encouraging avenue for overcoming these constraints. By leveraging nanotechnology and developing nanomaterials that facilitate the delivery of active drug candidates, there is potential to overcome these challenges. Various approaches are being explored, including drug distribution through local delivery, physicochemical disruption of the blood-brain barrier, cell-penetrating peptides, receptor-mediated transcytosis and magnetic disruption. These methods aim to surmount the obstacles associated with drug delivery. This review succinctly covers the mechanism of nanoparticles, different types of nanoparticles used in treating NDs and potential future applications of nanotechnology in clinical neuroscience. The ultimate goal is to develop innovative therapeutic strategies for effectively managing and treating neurodegenerative diseases. [ABSTRACT FROM AUTHOR]

Objective: The incidence of Hashimoto's thyroiditis (HT) in patients with metabolically unhealthy obesity (MUO) is generally higher than that in normal-weight individuals. However, the relationship among obesity, HT, and hypothyroidism remains unclear. Subjects and Methods: We searched the National Center for Biotechnology Information database and analyzed the abnormal expression of miRNAs in patients with MUO. The datasets GSE169290 and GSE138198 were selected as the objects of this data analysis. Using the MirPath tool on the DIANA TOOLS website, the KEGG pathway enrichment results were used for further analysis and explored the differential expression of pathways in patients with HT. Results: Four KEGG pathways were identified: "prion diseases (hsa05020)," "ECM-receptor interaction (hsa04512)," "mucin-type O-glycan biosynthesis (hsa00512)," and "cell adhesion molecules (hsa04514)." Sixteen differential genes were obtained, among which GALNT15 ranked the first, GALNT12 ranked the eighth, and GALNT8 ranked the 13th. GALNT15 , GALNT12 , and GALNT8 in the "mucin-type O-glycan biosynthesis" pathway are significantly lower in HT patients, which may be a key factor in the pathogenesis of HT. Conclusions: Decreased expression of O-GalNAc glycosylation in patients with MUO may increase the incidence of HT, which may become an important mechanism of HT in patients with obesity and is worthy of further exploration in future. [ABSTRACT FROM AUTHOR]