Search

Deubiquitinase A (DUBA) belongs to the ovarian tumor family of deubiquitinating enzymes and was initially identified as a negative regulator of type I interferons, whose overproduction has been linked to autoimmune diseases. The deubiquitinating activity of DUBA is positively regulated by phosphorylation at a single serine residue, S177, which results in minimal structural changes. We have previously shown that phosphorylation induces a two-state conformational equilibrium observed only in the active form of DUBA, highlighting the functional importance of DUBA dynamics. Here, we report the conformational dynamics of DUBA on the microsecond-to-millisecond time scales characterized by nuclear magnetic resonance relaxation dispersion experiments. We found that motions on these time scales are highly synchronized in the phosphorylated and nonphosphorylated DUBA. Despite the overall similarity of these two forms, different dynamic properties were observed in helix α1 and the neighboring regions, including residue S177, which likely contribute to the activation of DUBA by phosphorylation. Moreover, our data suggest that transient unfolding of helix α6 drives the global conformational process and that mutations can be introduced to modulate this process, which provides a basis for future studies to define the exact functional roles of motions in DUBA activation and substrate specificity.

Recent analysis of transcriptomes has revealed that RNAs perform a myriad of functions beyond encoding proteins. Critical to RNA function is its transport to unique subcellular locations, where it can be spatially regulated to perform its biological function. In this Perspective, we highlight the techniques developed to image and discover RNAs within their subcellular compartments and discuss the utility of these techniques in understanding RNA localization.

It is challenging to assess protein-membrane interactions because of the lack of appropriate tools to detect position changes of single proteins in the ∼4 nm range of biological membranes. We developed an assay recently, termed surface-induced fluorescence attenuation (SIFA). It is able to track both vertical and lateral dynamic motion of singly labeled membrane proteins in supported lipid bilayers. Similar to the FRET (fluorescence resonance energy transfer) principle, SIFA takes advantage of the energy transfer from a fluorophore to a light-absorbing surface to determine the distance at 2-8 nm away from the surface. By labeling a protein with a proper fluorophore and using graphene oxide as a two-dimensional quencher, we showed that SIFA is capable of monitoring three-dimensional movements of the fluorophore-labeled protein not only inside but also above the lipid bilayer atop the graphene oxide. Our data show that SIFA is a well-suited method to study the interplay between proteins and membranes.

Cytochrome P450 (CYP) 3A4 contributes to the metabolism of approximately 50% of commercial drugs by oxidizing a large number of structurally diverse substrates. Like other endoplasmic reticulum-localized P450s, CYP3A4 contains a membrane-anchoring N-terminal helix and a significant number of hydrophobic domains, important for the interaction between CYP3A4 and the membrane. Although the membrane affects specificity of CYP3A4 ligand binding, the structural details of the interaction have not been revealed so far because X-ray crystallography studies are available only for the soluble domain of CYP3A4. Here we report sample preparation and initial magic-angle spinning (MAS) solid-state NMR (SSNMR) of CYP3A4 (Delta3-12) embedded in a nanoscale membrane bilayer, or Nanodisc. The growth protocol yields approximately 2.5 mg of the enzymatically active, uniformly 13C,15N-enriched CYP3A4 from 1 L of growth medium. Polyethylene glycol 3350-precipitated CYP3A4 in Nanodiscs yields spectra of high resolution and sensitivity, consistent with a folded, homogeneous protein. CYP3A4 in Nanodiscs remains enzymatically active throughout the precipitation protocol as monitored by bromocriptine binding. The 13C line widths measured from 13C-13C 2D chemical shift correlation spectra are approximately 0.5 ppm. The secondary structure distribution within several amino acid types determined from 13C chemical shifts is consistent with the ligand-free X-ray structures. These results demonstrate that MAS SSNMR can be performed on Nanodisc-embedded membrane proteins in a folded, active state. The combination of SSNMR and Nanodisc methodologies opens up new possibilities for obtaining structural information on CYP3A4 and other integral membrane proteins with full retention of functionality.

The HMGI(Y) family of "high mobility group" nonhistone proteins are architectural transcription factors whose overexpression is highly correlated with both cancerous transformation and increased malignancy and metastatic potential of tumors in vivo. Here we report on the types of posttranslational modifications found in vivo on the HMG-I and HMG-Y proteins isolated from two human breast epithelial cell lines, MCF-7 and MCF-7/PKC-alpha, that represent different stages of neoplastic progression. The MCF-7 cell line exhibits many characteristics of normal breast epithelial cells and does not form tumors when injected into nude mice, whereas the MCF-7/PKC-alpha cell line, a derivative of MCF-7 that expresses a transgene coding for the enzyme protein kinase C-alpha (PKC-alpha), is both malignant and highly metastatic. Using MALDI mass spectrometry, we show that the HMG-Y protein is more highly modified than the HMG-I protein in both the MCF-7 and the MCF-7/PKC-alpha cells. Significantly, the HMG-Y protein isolated from the highly metastatic MCF-7/PKC-alpha cells possesses a unique constellation of phosphorylations, methylations, and acetylations not found on the HMG-I protein isolated from either the MCF-7 or MCF-7/PKC-alpha cells. We further demonstrate that some of the same amino acid residues phosphorylated on recombinant HMGI(Y) proteins by purified PKC in vitro are also phosphorylated on the HMG-I(Y) proteins isolated from MCF-7/PKC-alpha cells, suggesting that PKC phosphorylates these proteins in vivo. Quantitative substrate binding analyses indicate that the biochemical modifications present on the HMG-I and HMG-Y proteins differentially influence the ability of these proteins to interact with both A.T-rich DNA substrates and nucleosome core particles in vitro, suggesting a similar modulation of such binding affinities in vivo. To our knowledge, this is the first demonstration of differences in the types of in vivo biochemical modifications found on the HMG-I and HMG-Y proteins in cells and also the first experimental evidence suggesting a possible linkage between such posttranslational modifications and the neoplastic potential of cells.

The family of WD-repeat proteins comprises over 30 different proteins that share a highly conserved repeating motif [Neer, E. J., Schmidt, C. J., Nambudripad, R., & Smith, T. F. (1994) Nature 371, 297-300]. Members of this family include the signal-transducing G protein beta subunit, as well as other proteins that regulate signal transduction, transcription, pre-mRNA splicing, cytoskeletal organization, and vesicular fusion. The crystal structure of one WD-repeat protein (G beta) has now been solved (Wall et al., 1995; Sondek et al, 1996) and reveals that the seven repeating units form a circular, propeller-like structure with seven blades each made up of four beta strands. It is very likely that all WD-repeat proteins form a similar structure. If so, it will be possible to use information about important surface regions of one family member to predict properties of another. If WD proteins form structures similar to G beta, their hydrodynamic properties should be those of compact, globular proteins, and they should be resistant to cleavage by trypsin. However, the only studied example of a WD-repeat protein, G beta, synthesized in vitro in a rabbit reticulocyte lysate, is unable to fold into a native structure without its partner protein G gamma. The non-WD-repeat amino terminal alpha helix of G beta does not inhibit folding because G beta does not fold even when this region is removed. It is not known whether all WD-repeat proteins are unable to fold when synthesized in an in vitro system. We synthesized seven members of the family in a rabbit reticulocyte lysate, determined their Stokes radius, sedimentation coefficient, and frictional ratio, and assayed their stability to trypsin. Our working definition of folding was that the proteins from globular, trypsin-resistant structures because, except for G beta gamma, their functions are not known or cannot be assayed in reticulocyte lysates. We chose proteins that include amino and carboxyl extensions as well as proteins that are made up entirely of WD-repeats. We show that unlike G beta, several proteins with WD-repeats are able to fold into globular proteins in a rabbit reticulocyte lysate. One protein, beta Trcp, formed large aggregates like G beta, suggesting that it may also require a partner protein. Despite the presence of many potential tryptic cleavage sites, all of the proteins that did fold gave stable large products on tryptic proteolysis, as predicted on the basis of the structure of G beta. These studies suggest that other WD-repeat proteins are likely to form propeller structures similar to G beta.

Sixteen oligodeoxyribonucleotides, 5'd(GXGAYC)3', X and Y = G, A, C, or T, have been synthesized and studied by UV melting and 1H and 31P NMR methods. By varying X and Y, the sixteen resulting oligonucleotides can theoretically form 10 duplexes with all possible Watson-Crick base pairs flanking the center two G.A base pairs. Two-dimensional 1H NMR data on 5'd(GCGAGC)3' revealed that the center bases G and A pair through G amino hydrogen bonding and that the two consecutive G.A pairs form excellent purine-purine stacks. The concurrent appearance of one or more upfield-shifted imino proton peaks (approximately 10.5 ppm) and both upfield- and downfield- shifted 31P signals (approximately -2 and approximately -5.1 ppm) was a unique characteristic in imino 1H and 31P NMR spectra and was used as a conformational probe for this type of G.A pairs. Using this probe, seven out of 10 duplexes of 5'GXGAYC3' were found to adopt the G.A base pairing with G amino proton bonding and G to G and A to A base stacking. Three were in the group comprising 5'pyrimidine-GA-purine3', and four were in the group comprising 5'purine-GA-purine3'/5'pyrimidine-GA-pyrimidine3'. The G.A pairs in 5'purine-GA-pyrimidine3' adopted a totally different conformation. Thermodynamic analysis indicated that duplexes in the 5'pyrimidine-GA-purine3' group were more stable than the duplexes in the 5'purine-GA-pyrimidine3' group. Overall, G.C base pairs were preferred as neighbors to this type of G.A pairs.

The sequence 5'-d(ATGAGCGAAT) forms a very stable self-complementary duplex with four G.A mismatch base pairs (underlined) out of ten total base pairs [Li et al. (1991) Proc. Natl. Acad. Sci. U.S.A. 88, 26-30]. The conformation is in the general B-family and is stabilized by base-pair hydrogen bonding of an unusual type, by favorable base dipole orientations, and by extensive purine-purine stacking at the mismatched sites. We have synthesized 13 decamers with systematic variations in the sequence above to determine how the flanking sequences, the number of G.A mismatches, and the mismatch sequence order (5'-GA-3' or 5'-AG-3') affect the duplex stability. Changing A.T to G.C base pairs in sequences flanking the mismatches stabilizes the duplexes, but only to the extent observed with B-form DNA. The sequence 5'-pyrimidine-GA-purine-3', however, is considerably more stable than 5'-purine-GA-pyrimidine-3'. The most stable sequences with two pairs of adjacent G.A mismatches have thermodynamic parameters for duplex formation that are comparable to those for fully Watson-Crick base-paired duplexes. Similar sequences with single G.A pairs are much less stable than sequences with adjacent G.A mismatches. Reversing the mismatch order from 5'-GA-3' to 5'-AG-3' results in an oligomer that does not form a duplex. These results agree with predictions from the model derived from NMR and molecular mechanics and indicate that the sequence 5'-pyrimidine-GA-purine-3' forms a stable conformational unit that fits quite well into a B-form double helix.(ABSTRACT TRUNCATED AT 250 WORDS)

The binding of the macrocycle SDM to DNA was investigated by visible spectroscopy, stopped-flow kinetics, and NMR spectroscopy. SDM is composed of two 9-aminoacridines linked via the amino groups by a spermine side chain and via the 4-positions by a N,N'-[(methylthio)ethyl]succinamide side chain [Zimmerman, S. C., Lamberson, C. R., Cory, M., & Fairley, T. A. (1989) J. Am. Chem. Soc. 111, 6805-6809]. The visible spectrum of SDM bound to poly[d(A-T)]2 or poly[d(G-C)]2 is red-shifted relative to the spectrum of SDM alone and displays considerable hypochromicity. Results from titrations of SDM with polymer indicate a binding site size of three base pairs per macrocycle. The dissociation constant for SDM bound to either poly[d(A-T)]2 or poly[d(G-C)]2 is an order of magnitude lower than that for a similar bisacridine linked only by a spermine side chain. In addition, the dependence of the dissociation constant on ionic strength is significantly reduced. NMR studies of SDM complexes with poly[d(A-T)]2 or a tetramer, d(CGCG)2, show that intercalation is the mode of binding. The magnitudes of the chemical shift differences for SDM aromatic protons in the free and bound states support intercalation with the acridine ring systems essentially parallel to the long axis of the base pairs. Cross peaks from NOESY spectra of the SDM complex with d(CGCG)2 further support this mode of binding and provide information on the structure of the complex. The results are analyzed for consistency with each of three binding models: (i) bisintercalation with the two side chains in the same groove; (ii) bisintercalation according to the neighbor-exclusion principle with the two side chains in opposite grooves; and (iii) bisintercalation with two side chains in opposite grooves but with violation of the neighbor-exclusion principle. Model i is found to be unlikely on the basis of all evidence obtained, including preliminary modeling studies. Both models ii and iii can be reconciled with the experimental evidence and from a modeling standpoint are energetically feasible.

The C-terminal domain of ribosomal protein L9 (CTL9) is a 92-residue alpha-beta protein which contains an unusual three-stranded mixed parallel and antiparallel beta-sheet. The protein folds in a two-state fashion, and the folding rate is slow. It is thought that the slow folding may be caused by the necessity of forming this unusual beta-sheet architecture in the transition state for folding. This hypothesis makes CTL9 an interesting target for folding studies. The transition state for the folding of CTL9 was characterized by phi-value analysis. The folding of a set of hydrophobic core mutants was analyzed together with a set of truncation mutants. The results revealed a few positions with high phi-values (or = 0.5), notably, V131, L133, H134, V137, and L141. All of these residues were found in the beta-hairpin region, indicating that the formation of this structure is likely to be the rate-limiting step in the folding of CTL9. One face of the beta-hairpin docks against the N-terminal helix. Analysis of truncation mutants of this helix confirmed its importance in folding. Mutations at other sites in the protein gave small phi-values, despite the fact that some of them had major effects on stability. The analysis indicates that formation of the antiparallel hairpin is critical and its interactions with the first helix are also important. Thus, the slow folding is not a consequence of the need to fully form the unusual three-stranded beta-sheet in the transition state. Analysis of the urea dependence of the folding rates indicates that mutations modulate the unfolded state. The folding of CTL9 is broadly consistent with the nucleation-condensation model of protein folding.

The conventional protein kinase C isoform, PKCII, is a signaling kinase activated during the hyperglycemic state and has been associated with the development of microvascular abnormalities associated with diabetes. PKCII, therefore, has been identified as a therapeutic target where inhibitors of its kinase activity are being pursued for treatment of microvascular-related diabetic complications. In this report, we describe the crystal structure of the catalytic domain of PKCbetaII complexed with an inhibitor at 2.6 A resolution. The kinase domain of PKCbetaII was cleaved and purified from full-length PKCbetaII expressed in baculovirus-infected insect cells. The overall kinase domain structure follows the classical bilobal fold and is in its fully activated conformation with three well-defined phosphorylated residues: Thr-500, Thr-641, and Ser-660. Different from the crystal structures of nonconventional PKC isoforms, the C-terminus of the PKCbetaII catalytic domain is almost fully ordered and features a novel alpha helix in the turn motif. An ATP-competitive inhibitor, 2-methyl-1H-indol-3-yl-BIM-1, was crystallized with the PKCbetaII catalytic domain as a dimer of two enzyme-inhibitor complexes. The bound inhibitor adopts a nonplanar conformation in the ATP-binding site, with the kinase domain taking on an intermediate, open conformation. This PKCbetaII-inhibitor complex represents the first structural description of any conventional PKC kinase domain. Given the pathogenic role of PKCbetaII in the development of diabetic complications, this structure can serve as a template for the rational design of inhibitors as potential therapeutic agents.

Interest in the unfolded state of proteins has grown with the realization that this state can have considerable structure in the absence of denaturants. Natively unfolded proteins, mutations that unfold proteins under native conditions, and changes in pH that induce unfolding are attractive models for the unfolded state in the absence of denaturant. The unfolded state of the N-terminal domain of ribosomal protein L9 (NTL9) was previously shown to contain significant non-native electrostatic interactions [Cho, J. H., Sato, S., and Raleigh, D. P. (2004) J. Mol. Biol. 338, 827-837]. NTL9 has a mixed alpha-beta structure and folds via a two-state mechanism. We have generated a model of the unfolded state of NTL9 in the absence of denaturant by substitution of an alanine for phenylalanine 5 located in the core of this protein. The CD spectrum of the variant, denoted as F5A, exhibits significantly less structure than the wild type; however, the mean residue ellipticity of F5A at 222 nm (-8200 deg cm(2) dmol(-)(1)) is considerably larger than expected for a fully unfolded protein, indicating that residual secondary structure is populated. F5A also has more residual structure than the urea-unfolded wild type. The stability of F5A is estimated to be at least 1 kcal/mol unfavorable, showing that the unfolded state is populated to 84% or more. NMR pulsed-field gradient measurements yield a hydrodynamic radius of 16.1 A for wild-type NTL9 and 20.8 A for the F5A variant in native buffer. The physiologically relevant unfolded state of wild-type NTL9 is likely to be even more compact than F5A since the mutation should reduce the level of hydrophobic clustering in the unfolded state in the absence of denaturant. The hydrodynamic radius of F5A increases to 25.9 A in 8 M urea, and a value of 23.5 A is obtained for the wild type under similar conditions. The results show that the unfolded state of F5A in the absence of denaturant is more compact and contains more structure than the urea-unfolded form.

The conversion of nitriles to amides is generally considered to be a hydrolytic process that does not involve redox chemistry. We demonstrate here that cytochrome P450 (CYP) is responsible for the conversion of the cyano group of pinacidil to the corresponding amide. The reaction in human liver microsomes was NADPH-dependent and was nearly completely inhibited by an anti-CYP3A4 antibody. Incubations of pinacidil with recombinant CYP enzymes confirm that CYP3A4 is the principal catalyst of this reaction. The kinetics of pinacidil amide formation by CYP3A4 yielded an apparent K(m) of 452 +/- 33 microM and k(cat) of 0.108 min(-1) (k(cat)/K(m) = 0.238 mM(-1).min(-1)). Incubation of pinacidil with CYP3A4 in the presence of (18)O(2) or H(2)(18)O showed that the amide carbonyl oxygen derived exclusively from molecular oxygen. The CYP3A4-mediated reaction also was supported by hydrogen peroxide when incubations were carried out in the absence of cytochrome P450 reductase and NADPH. The reaction can be explained by a nucleophilic attack of a deprotonated ferric peroxide intermediate (Fe(3+)-O-O(-)) on the carbon atom of the -C triple bond N triple bond to form an Enz-Fe(III)-O-O-C(=NH)R intermediate, followed by cleavage of the O-O bond to give pinacidil amide. This nucleophilic addition of an Fe(3+)-O-O(-) intermediate to a -C=N pi-bond in a P450 system resembles the analogous reaction catalyzed by the nitric oxide synthases.

Receptor-mediated induction of the human proenkephalin gene has been mapped to an imperfect palindrome located between -104 and -86, upstream of the transcriptional start site. Several lines of evidence suggest that receptor-mediated transcription of proenkephalin involves a reversible conformational change from duplex to a hairpin state of the enhancer [McMurray, C.T., Wilson, W.D., & Douglass, J.O. (1991) Proc. Natl. Acad. Sci. U.S.A. 88, 666]. To determine the structure that would form if such a conformational change took place, we have synthesized two 23-bp oligonucleotides, d(GCTGGCGTAGGGCCTGCGTCAGC) and d(GCTGACGCAGGCCCTACGCCAGC), whose sequences are identical to the top and the bottom strands of the native enhancer. We have found that each oligonucleotide strand exists primarily as a hairpin structure over a wide range of oligonucleotide concentrations and a wide range of temperatures (0-45 degrees C). The assignment of each imino proton was carried out using 1D and 2D nuclear Overhauser effects (NOE) and by comparison with the spectra of hairpins containing single base substitutions. The hairpin structure for each oligonucleotide contains a 3-member loop, a 10-bp stem, and two mismatched pairs. The hairpin that forms from the top strand of the enhancer and contains two GT mispaired bases creates an alternative binding site for the cyclic adenosine monophosphate element binding protein (CREB), a transcription factor that binds to and regulates the human proenkephalin gene. Circular dichroism and 31P NMR indicate that, despite the presence of mismatched pairs, each oligonucleotide hairpin adopts a B-form conformation with no unusual bending or kinking. The structure of the hairpin may explain the effect on expression of point mutations within the enhancer.

GA mismatches in DNA have drawn attention because of their special repair mechanisms, stability, and variety of conformations. A symmetric 10-base oligodeoxyribonucleotide duplex, d(CCATGAATGG)2, containing two GA mismatches has been investigated by one- and two-dimensional multinuclear NMR and molecular refinement procedures to ascertain the conformational details of the 5'-pyrimidine-GA-purine-3' sequence. A molecular model established from the NMR results has a B-type right-handed helix with each of the bases retaining the normal anti-glycosidic torsional angles. Type I mismatched base pairs have GNH2-AN7 and GN3-ANH2 (edge-to-edge) hydrogen bonds, while type II base pairs have GN1H-AN1 and GO6-ANH2 (face-to-face) bonds. The conformation at the GA mismatch site has type I GA base pairs and an unusual cross-strand stacking of the adjacent G5 and A6 bases, which causes significant overwinding of the helix at the mismatch site. Unusual shifts of the 31P resonances suggest that the phosphate linkage between G5 and A6 is no longer in the low-energy BI conformation. One-dimensional imino and phosphorus NMR studies were carried out on a number of DNA sequences containing adjacent 5'-GA-3' mismatched base pairs to investigate the sequence dependence of the conformations and base-pairing types. Type I and type II conformations have very different imino proton and 31P NMR spectral patterns that can be used to classify any sequence with adjacent GA mismatches by base-pairing and conformational type. The NMR results indicate that the conformation selected is dictated completely by the flanking sequence: 5'-pyrimidine-GA-purine-3' sequences adopt the type I conformation, while 5'-purine-GA-pyrimidine-3' sequences have the type II conformation.

Acetyl- and butyrylcholinesterase have 51-54% sequence identity in mammalian species; they exhibit distinct substrate and inhibitor specificities. The crystal structure of acetylcholinesterase enables one to predict folding of related esterases as well as assign residues responsible for differences in substrate specificity. These predictions were tested by expression of esterase chimeras and site-specific mutants using mouse acetylcholinesterase as a template. Chimeras of acetylcholinesterase in which the amino-terminal 174 and the carboxyl-terminal 88 amino acids have been converted to the butyrylcholinesterase sequences still exhibit acetyl-like substrate specificity. Four nonconserved amino acids which are within the central sequence and appear to surround the acyl pocket, F295, R296, F297, and V300, have been mutated alone and in combination to the corresponding residues found in butyrylcholinesterase, L286, S287, I288, and G291. The V300 and R296 mutants slightly enhance butyrylthiocholine hydrolysis while the F295 and F297 mutants, alone and in combination, confer butyrylcholinesterase character by enhancing activity to butyrylthiocholine, and diminishing activity to acetylthiocholine. The F297 mutation eliminates substrate inhibition. F295 and F297 may form a clamp around the acetoxy methyl group. They have distinctive roles in affecting catalysis of the two acylcholines and precisely control acyl ester specificity. Comparison of the susceptibilities of the chimeras and site-specific mutants to cholinesterase-specific inhibitors isoOMPA, ethopropazine, and BW284c51 suggests that inhibitor selectivity for isoOMPA is attributable to residues limiting the size of the acyl pocket, while residues in the amino-terminal domain presumably near the lip of the gorge affect BW284c51 selectivity.(ABSTRACT TRUNCATED AT 250 WORDS)