Search

A novel method for the purification of poly(ADP-ribose) was established. Calf thymus nuclei were incubated with NAD. After pronase digestion, DNA was isolated as a flocculent form by adding 1 M NaCl and 2 volumes of ethanol. Acid-insoluble poly(ADP-ribose), which was synthesized during incubation, was quantitatively recovered in this DNA fraction. Poly(ADP-ribose) was purified as a single peak from a hydroxylapatite column after the nuclease treatment. Preparation of poly(ADP-ribose) thus obtained revealed the characteristics of pure poly(ADP-ribose), including a ratio of A280 to A260 of 0.24.

Antibody to poly(ADP-ribose) has been covalently coupled to Sepharose and utilized to isolate selectively oligonucleosomes undergoing the poly(ADP-ribosyl)ation reaction from the bulk of chromatin. Approximately 12% of the unfractionated oligonucleosomes were bound to the immunoaffinity column and these represented essentially 100% of the original poly(ADP-ribosyl)ated nucleosomal species in the unfractionated chromatin. Poly(ADP-ribosyl)ated chromatin was not bound by preimmune IgG columns. KSCN eluted the modified nucleosomes in the form of nucleoprotein complexes. The eluted chromatin components were shown to contain poly(ADP-ribosyl)ated histones as well as automodified poly(ADP-ribose) polymerase. By using [3H]lysine- and [3H]arginine-labeled chromatin, it was shown that the poly-(ADP-ribosyl)ated histones, attached to stretches of oligonucleosomes bound to the column, had a 6-fold enrichment of the modification compared to histones of the unfractionated chromatin. This indicated that non-poly(ADP-ribosyl)ated nucleosomes, connected and proximal to the modified regions, were copurified by this procedure. This allowed characterization of the oligonucleosomal DNA around poly(ADP-ribosyl)ated chromatin domains to be compared with the unbound bulk chromatin. The data indicated that immunofractionated poly(ADP-ribosyl)ated oligonucleosomal DNA contained significant amounts of internal single-strand breaks compared with bulk chromatin. The bound nucleo-protein complexes were found to be enzymatically active for poly(ADP-ribose) polymerase after elution from the antibody column. In contrast, the unbound nucleosomes, representing 90% of the unfractionated chromatin, were totally inactive in the poly(ADP-ribosyl)ation reaction.

Poly([14C]adenosine diphosphate ribose) was synthesized from [14C]NAD+ with calf thymus nuclei. The fraction containing poly(adenosine diphosphate ribose) eluted with 0.22--0.40 M phosphate buffer (pH 6.8) from a hydroxylapatite column, was completely hydrolyzed with venom phosphodiesterase, and was separated by DEAE-Sephadex A-25 column chromatography in 7 M urea. A new compound, which constituted 2% of the products from poly(adenosine diphosphate ribose), was found in addition to the expected products--i.e., 5'-AMP, 2'-(1''-ribosyl)adenosine-5',5''-bis(phosphate), and its derivatives. This compound was identified as 2'-[1''-ribosyl 2''-(or 3''-)(1'''-ribosyl)]adenosine-5',5'',5'''-tris(phosphate). The existence of this compound is evidence of a branching structure of poly(adenosine diphosphate ribose), which was previously thought to be a linear molecule. The content of this compound suggests that the frequency of branching is about 1 per 20--30 adenosine diphosphate ribose residues of high molecular weight poly(adenosine diphosphate ribose).

The complete nucleotide sequence of human fibroblast poly(ADP-ribose) polymerase cDNA was determined. The cDNA contains an open reading frame for a 1014 amino acid polypeptide. In the DNA binding domain of poly(ADP-ribose) polymerase, there are predicted α-helix-turn-α-helix structures and two sequences each of about 100 amino acids that are similar to each other containing potential cysteine-zinc DNA binding structures. Within the 3′ untranslated region, there is an AT-rich sequence containing ATTTA, a possible mRNA destabilizer.

Human placental poly(ADP-ribose) polymerase was purified and the NH2-terminal amino acid sequences of 16 KDa and 40 KDa chymotryptic peptides were determined. Screening of a lambda gt11 cDNA library of normal human placenta with a 51-mer oligodeoxyribonucleotide yielded one clone with a 1.8 Kb insert and two clones with 2.1 Kb inserts. The amino acid sequence deduced from the nucleotide sequence of the 1.8 Kb insert exactly matched the determined amino acid sequences. From a Northern blot analysis, a single 3.6 Kb mRNA was detected in HL-60 cells. Furthermore, the RNA expression of the poly(ADP-ribose) polymerase gene was shown to decrease during the granulocytic differentiation of HL-60 cells upon induction by retinoic acid.

Summary Nicotinamide, which occurs naturally, produced sister chromatid exchanges in Chinese hamster lung fibroblasts and human lymphoblastoid cells. The inductions were dose-dependent with concentrations of 1.0–10.0 mM nicotinamide. Elastatinal, a protease inhibitor that has been reported to suppress induction of sister chromatid exchanges by N-methyl-N′-nitro-N-nitrosoguanidine, did not suppress induction of sister chromatid exchanges by nicotinamide in these cell lines.

The effect of teleocidin, a new, naturally occurring tumor promoter on induction of Epstein-Barr virus (EBV), was compared with that of a known tumor promoter, 12-O-tetradecanoyl-phorbol-13-acetate (TPA). Early antigen (EA) and/or capsid antigen (VCA) of EBV was induced in the EBV genome-carrying cell lines C-6 and P3HR-I cells by teleocidin, its effect being maximal at a concentration of 12.5 ng/ml. The production of infectious EBV from P3-HR-I cells was enhanced by teleocidin maximally at a concentration of 0.5 to 2.5 ng/ml. The outgrowth of EBV-transformed cells from peripheral lymphocytes of seropositive healthy donors was also enhanced by teleocidin at a concentration of 0.02 to 0.5 ng/ml. TPA tested simultaneously in all experiments exhibited the same activities as teleocidin, and was effective at similar concentrations. Teleocidin enhanced both EA and VCA synthesis in P3HR-I cells additively with n-butyrate, but not with TPA. This suggests that teleocidin and TPA have a common mechanism of action, although their chemical structures are different.

Evidence for the natural occurrence of poly(adenosine diphosphate ribose) in vivo was obtained using a sensitive radioimmunoassay and poly(adenosine diphosphate ribose) glycohydrolase, which specifically hydrolyzes poly(adenosine diphosphate ribose). Calf thymus, liver, kidney, brain, pancreas and spleen contained poly(adenosine diphosphate ribose). Naturally occurring poly(adenosine diphosphate ribose) in calf thymus is composed of molecules of various chain lengths, like that synthesized by an in vitro system. Calf thymus was estimated to contain about 0.02 microgram/mg DNA of poly(adenosine diphosphate ribose).

Immunoblastic lymphadenopathy (IBL)-like T-cell lymphoma is a distinct peripheral T-cell lymphoma, which closely resembles angioimmunoblastic lymphadenopathy with dysproteinemia (AILD) and/or IBL, but is characterized by focal or sheet-like proliferation of immunoblasts and pale cells of T-cell nature. In this report, 36 patients with IBL-like T-cell lymphoma were analyzed. The disease is clinically characterized by generalized lymph node swelling, hepatosplenomegaly, fever, skin rash, polyclonal hypergammaglobulinemia, marked male predominance, predilection for the elderly, and poor prognosis. There was no association with human T-cell leukemia virus type I or human immunodeficiency virus. IBL-like T-cell lymphoma may be divided into two categories (CD4+ type and CD8+ type) by surface marker analysis. It can also be divided into three categories on the basis of the histologic findings of distribution of morphologically recognizable tumor cells: nine cases of “inconspicuous type,” six cases of “patchy type,” and 21 cases of “diffuse type.” Two cases of “inconspicuous type” converted later to “diffuse type.” DNA hybridization analyses in the ten recent cases revealed that three of four “inconspicuous types” and five of six “diffuse types” showed clonal rearrangement of T-cell receptor-beta chain gene without rearrangement of immunoglobulin heavy chain gene, providing strong evidence for clonal proliferation of T cells.

The effects of various polyanions including synthetic polynucleotides on DNApolymerases-alpha and -beta from blastulae of the sea urchin Hemicentrotus pulcherrimus and HeLa cells were studied. Only DNA polymerase-alpha was inhibited by polyanions, such as polyvinyl sufate, dextran sulfate, heparin, poly(G), poly(I), poly(U) and poly(ADP-Rib). Of the various polynucleotides tested, poly(G) and poly(I) were the strongest inhibitors. Kinetic studies showed that the Ki value for poly(G) was 0.3 microgram/ml and that poly(G) had 20-fold higher affinity than activated DNA for the template-primer site of DNA polymerase-alpha. Poly(U) and poly(ADP-Rib) were also inhibitory, but they were one hundredth as inhibitory as poly(G) or poly(I). Poly(A), poly(C), poly(A).poly(U) AND POLY(I).poly(C) were not inhibitory to DNA polymerase-alpha. In contrast, DNA olymerase-beta was not affected at all by these polyanions under the same conditions.

A 49-year-old man developed adult T-cell leukemia (ATL) and acute myeloblastic leukemia (AML) at the same time. Using Southern blotting analysis, the leukemic cells of the ATL were found to contain the human T-cell leukemia virus type I (HTLV-I) proviral genome, whereas those of the AML did not, indicating the HTLV-I not to be associated with the AML oncogenesis. At the initial presentation, the serum anti-HTLV-I antibody was judged on screening by a routine particle-agglutination (PA) test and an indirect immunofluorescence assay (IF) to be negative. By Western blotting analysis, however, the serum was proved to be positive for anti-HTLV-I antibody. These results indicate that a routine PA-test and an IF may show false negative reactions on very rare occasions of low antibody titer. This is the first report of a coincidence of ATL with another type of leukemia.

We describe five patients with adult T-cell leukemia/lymphoma (ATL) with neither integration of human T-cell leukemia virus type I (HTLV-I) into their leukemia cells nor anti-HTLV-I antibody in their sera. These findings indicate that HTLV-I may not have been involved in leukemogenesis in these patients. The clinicohematological, cytopathological, and immunological features of HTLV-I-negative ATL were exactly the same as those of HTLV-I-associated ATL. Leukemia cells with pleomorphic nuclei, generalized lymphadenopathy, hepatosplenomegaly, skin lesions, hypercalcemia, and elevated lactate dehydrogenase levels, all of which are characteristic features of typical ATL, were also seen in these patients with HTLV-I-negative ATL. Leukemia cells expressed T3, T4, and pan-T-cell antigens in three cases, and T3 and pan-T-cell antigens in two. All five patients had lived in ATL-nonendemic areas. The finding of HTLV-I-negative ATL suggests that factor(s) other than HTLV-I infection may be involved in ATL leukemogenesis.

Carcinogenesis is a multistep process initiated by DNA damage, gene mutation, gene rearrangment and gene translocation, and ending with phenotypic transformation to cancer cells. Seventeen years ago, a unique enzymatic reaction was found. This reaction was catalyzed by a nuclear enzyme which polymerizes ADP-ribose residues of /3-NAD + to make poly(ADP-Rib)* (1 —4). Nicotinamide is released from the j3NAD + molecule during the reaction and is not incorporated into poly(ADP-Rib). /3-NAD + was first found by Harden and Young in 1904 as a cofactor for respiration and its structure was determined in 1936. Enzymatic reactions involving /3-NAD + may be classified into three categories as follows: the reactions of dehydrogenases (e.g., alcohol dehydrogenase, lactic dehydrogenase, malic dehydrogenase and triose phosphate dehydrogenase) in which /3-NAD + acts as a cofactor; in these reactions /3-NAD+ is converted to /3-NADH. The reaction of DNA ligase in Escherichia coli, in which /3NAD acts as a cofactor to form an intermediate; in this reaction /3-NAD+ is hydrolyzed at the pyrophosphate bond to yield NMN and an AMP-DNA intermediate, and AMP is released when the DNA ligase reaction is complete. Third, the reaction of ADP-ribosyl transferase or poly(ADP-Rib) polymerase in which /3-NAD+ serves as substrates; in this reaction ADP-ribose residue is covalently bound to certain acceptor protein(s) or ADP-ribose residues are polymerized with concomitant release of nicotinamide residues.

The cis-acting regulatory sequence of transcription from long terminal repeats (LTRs) of human T-cell leukemia virus type I and type II (HTLV-I and HTLV-II), which is essential for action of the virally encoded trans-acting transcriptional factor(s) designated pX(s), in HTLV-I and -II was identified. Deletion of most of the U3 region of the HTLV-I LTR resulted in loss of trans-acting transcriptional activation. However, when a tandem repeat of a 21-nucleotide sequence (GAAGGCTCTGACGTCTCCCCC) that is present in the U3 region of HTLV-I and -II LTRs was inserted into the deleted U3 region of the HTLV-I LTRs, chloramphenicol acetyltransferase activity was restored. The extent of restoration of activity was proportional to the number of copies of the sequence inserted. To test the possibility that the 21-nucleotide sequence alone is necessary for trans-activation, a sequence (AGGAACTGAAA) homologous to a type-specific viral enhancer sequence and present in the U3 region of HTLV-II LTR, but not in the same region of the HTLV-I LTR, was inserted together with the 21-nucleotide sequence into the deleted U3 region of the HTLV-I LTR. However, no significant differences of the levels of activities of those LTRs compared to the LTRs with only the 21-nucleotide sequence repeats were observed.

Leukemic cells from four out of eight patients with adult T-cell leukemia (ATL) were successfully grown by cocultivation with HSC-I cells, a human skin cancer cell line, in the presence of interleukin-2. Three of these four cultures of growing cells showed rearrangement of the T-cell receptor beta-chain gene like the original leukemic cells in vivo, and also showed conservation of the patterns of HTLV-I integration of the original leukemic cells in vivo. Cell-to-cell contact between HSC-I cells and leukemic cells was not necessary for growth of the leukemic cells. The results indicate that some soluble growth factor secreted by HSC-I cells and interleukin-2 are required for the in vitro growth of leukemic cells from some patients with adult T-cell leukemia.

Recent studies on poly(ADP-ribose) are reviewed. Poly(ADP-ribose) was shown to have α (1″ → 2′) ribose-ribose bonds. High molecular weight poly(ADP-ribose) with a branched structure was demonstrated. The structure of the branch linkage was determined as 2″-[1′-ribosyl-2″ (1‴-ribosyl)]-adenosine 5′,5″,5‴-tris(phosphate). The known sites of ADP-ribosylation of proteins were summarized. The enzymatic synthesis of poly(ADP-ribose) was classified into three steps, initiation, elongation and branching. Degradation of poly(ADP-ribose) may be mainly performed by α (1″ → 2′)-poly(ADP-ribose) ribohydrolase. Specific antibodies against poly(ADP-ribose) and its monomer, 2′-ribosyl adenosine 5′,5″-bis(phosphate), were obtained and used for quantitative measurement of naturally occurring poly(ADP-ribose). High antibody activity was found in the serum of the patients with systemic lupus erythematosus. Poly(A)·poly(U) could also raise specific antibody against poly(ADP-ribose) in rabbits. Nicotinamide, an inhibitor of poly(ADP-ribose) polymerase, increased sister chromatid exchanges. Among the nicotinamide analogues tested, N ′-methylnicotinamide was the best inducer of differentiation of Friend erythroleukemia cells. Purified poly(ADP-ribose) induced differentiation of mouse myelogenous leukemia cells.

The leukemic cells of adult T-cell leukemia (ATL) usually express the helper/inducer associated antigen reactive with anti-CD4 antibodies but not with anti-CD8. We present a 63-yr-old woman with ATL characterized by circulating leukemic cells with CD4+/CD8− phenotype, hepatosplenomegaly with no lymphadenopathy, and the presence of proviral DNA of human T-cell leukemia virus I in the leukemic cells. She was successfully treated with interferon beta and the remission lasted for 12 months. She then relapsed in the lymph nodes with minimal peripheral blood involvement. The neoplastic cells of the lymph node now co-expressed CD4 and CD8 antigens indicating that the change in clinical manifestation was accompanied by a phenotypic change of the leukemic cells.

The S + L − cat kidney cell line CCC was cocultivated with lethally irradiated human lymphoid cell lines that were producing human T-cell leukemia virus type I (HTLV-I). Eight of nine S + L − CCC sublines that had been cocultivated with nine different HTLV-producing T-cell lines gave positive reactions for HTLV antigens by indirect immunofluorescence assay. One subline CCC/2M was cloned. The percentages of fluorescent cells differed markedly in different sublines and clones. Southern blot hybridization with HTLV probes and electrophoresis of immunoprecipitates indicated that defective HTLVs were often transmitted into S + L − cat cells. S + L − CCC cells were permissive for HTLV and the properties of HTLV-infected cat cells were heterogeneous.

An electrophoretic system was established that resolves poly(adenosine diphosphate ribose), enzymatically synthesized polymer from NAD+, by size difference of one residue on polyacrylamide gel. The existence of a polymer of at least 65 residues was demonstrated by band counting in this system. The polymer showed a heterogeneous size distribution on the electrophoregram, and the molecular weight of the largest polymer was deduced to be more than 4.5 X 10(5) daltons. The discrepancy between the size, estimated by electrophoresis, and the chain length, determined by the ratio of total radioactivity to that derived from the terminus, suggests that the polymer has a branched structure.

The nucleic acid sequence of the 3' region of human T-cell leukemia virus type II (HTLV-II) proviral DNA was determined using a HTLV-II proviral clone that could be recovered as infectious, transforming virus. The sequence data indicate a region of unknown function of approximately equal to 1.6 kilobase pairs in the 3' region, analogous to the X region previously identified in human T-cell leukemia virus type I (HTLV-I). Three overlapping open reading frames are present in the X region of HTLV-II. One of these open reading frames, Xc, is most likely to encode a protein product, because it has greater predicted amino acid sequence homology (78%) with the X-IV region of HTLV-I and a greater percentage of its base differences with X-IV at the third nucleotide position of codons than do the other open reading frames. Sequences of the X-region that include the open reading frames are conserved in two deletion mutants of HTLV-II, which are associated with a subline of Mo cells with a decreased dependence on fetal bovine serum.

Summary Benzamide and m -aminobenzamide, the most potent inhibitors of poly-(adenosine diphosphate ribose) polymerase known, enhanced unscheduled DNA synthesis after ultraviolet irradiation in human lymphocytes. A positive correlation was found between the inhibitory activities and enhancing effects on unscheduled DNA synthesis of inhibitors related to benzamide and nicotinamide. Lymphocytes of a patient with xeroderma pigmentosum did not show enhanced unscheduled DNA synthesis with these inhibitors after ultraviolet irradiation, but like normal lymphocytes, showed enhanced unscheduled DNA synthesis after treatment with N-methyl-N′-nitro-N-nitrosoguanidine.

The effect of inhibitors of poly(ADP-ribose)polymerase, benzamide (Bam) and m-aminobenzamide (m-AB), on sister-chromatid exchanges (SCEs) and cell growth, was examined in lymphoblastoid cell lines from a normal adult (KS-64) and from a Bloom syndrome patient (BS1-2). The presence of Bam and m-AB increased the levels of SCEs in KS-64 and BS1-2 lymphoblastoid cells. Though the net increase was similar in the two types of cell, the relative increase was much lower in the BS1-2 cells. Bam and m-AB increased the number of SCEs in BS1-2 cells to levels of 95.4 +/- 3.24 and 98.1 +/- 3.23 per cell, respectively, as compared with the baseline level of 75.5 +/- 2.16. On the other hand, when KS-64 cells were treated with Bam and m-AB, the number of SCEs increased to 27.1 +/- 1.98 and 28.6 +/- 2.71 per cell, respectively, compared with the baseline number of 6.7 +/- 0.41 per cell. These inhibitors of poly(ADP-ribose)polymerase also inhibited cell growth at concentrations which induced SCEs in KS-64 as well as in BS1-2 cells. No significant decrease in the poly(ADP-ribose)polymerase activity or in the amount of poly-(ADP-ribose) was detected in BS1-2 cells as compared with KS-64 cells. The mechanism by which SCEs are increased in BS1-2 cells is discussed.

The nucleotide sequence of the human T-cell leukemia virus type II (HTLV-II) long terminal repeat (LTR) and its surrounding regions were determined. Our results show the following structural features: (i) the LTR is 763 base pairs (bp) in length and consists of 314 +/- 1 bp of region U3, 248 +/- 1 bp of region R, and 201 bp of region U5; (ii) the terminal nucleotides in the LTR form an inverted repeat of T-G.....C-A; (iii) 6-bp direct repeats of cellular sequences flanking the provirus were present; and (iv) the putative functional signals for initiation or termination of viral RNA synthesis were identified. Comparison of the HTLV-II LTR sequence with that previously published for adult T-cell leukemia virus (ATLV; HTLV-I) shows that the LTRs are distinct. Some small regions are conserved between HTLV-II and ATLV, involving sequences important for transcription and a sequence of 21 nucleotides repeated three times in U3. This 21-bp repeat may be important in regulating viral transcription in lymphoid cells.

The entire nucleotide sequence of an infectious clone of human T-cell leukemia virus type II provirus was determined. This provirus consists of 8952 nucleotides. In addition to long terminal repeats and gag, pol, env, and X, a protease gene that is responsible for processing the gag precursor protein was found. The protease gene is encoded in a different frame from gag and pol and was located between the gag and pol open reading frames. The 5' region of the protease gene overlaps the 3' gag region. Coding regions of the provirus show about 60% homology with those of human T-cell leukemia virus type I at the nucleotide level. The evolutionary relationship between human T-cell leukemia virus types I and II is discussed.

Antibodies were raised against oligopeptides deduced from the nucleotide sequence in the conserved region located between env and the 3' long terminal repeat in human T-cell leukemia virus type I (HTLV-I) and type II (HTLV-II) to detect a protein coded from this region in virus-infected cells. Two of these antibodies precipitated a protein of 41 kilo-daltons in HTLV-I-infected cell lines and a protein of 38 kilo-daltons in HTLV-II-infected cells. The protein in HTLV-I-infected cells was precipitated by plasma from patients with adult T-cell leukemia but not by plasma from a normal adult. These results indicate that these proteins were translated from new coding regions (X) present in HTLV-I and HTLV-II.

Specific antibody against 2'-(5"-phosphoribosyl)-5'AMP (PR-AMP), a monomer of poly(adenosine diphosphate ribose) (poly(ADP-Rib)), was produced by immunizing a rabbit with PR-AMP coupled to bovine serum albumin (BSA). Antibody against PR-AMP was purified 53-fold from serum by (NH4) 2SO4 precipitation, and BSA-Sepharose 4B, DEAE-cellulose and (PR-AMP)-BSA-Sepharose 4B column chromatographies. Inhibition experiments show that the adenine ring, 5'-phosphate residue and ribose-ribose bond of PR-AMP were essential for the antigenic determinant of PR-AMP. Anti PR-AMP antibody bound, not only with PR-AMP, but also with poly(ADP-Rib) of various chain lengths, while anti poly(ADP-Rib) antibody bound with poly(ADP-Rib) but not with PR-AMP.

The 13C NMR spectra of poly(adenosine diphosphate ribose), ribosyl adenosine 5', 5''-bis(phosphate) and related compounds were analyzed. The structure of the ribose-ribose linkage was determined as alpha-(1'' leads to 2')ribofuranosyl ribofuranoside, from the 13C chemical shifts of methyl-alpha- and methyl-beta-D-ribofuranosides, and from the downfield displacements of 13C NMR signals by glycosidic bond formation.

Poly(ADP-ribose) metabolism during differentiation of HL-60 human promyelocytic leukemia cells induced by dimethylsulfoxide was studied. Endogenous poly(ADP-ribose) decreased to 15% of the uninduced level at 14 hours after addition of dimethylsulfoxide, when the morphology, phagocytic activity and DNA synthesis of the cells had not yet changed and myeloperoxidase activity had decreased only slightly. Endogenous poly(ADP-ribose) remained at a low level until day 3, but increased sharply to 800% of the uninduced level on day 5 when most of the differentiated phenotypes became obvious. This is the first report of measurement of the endogenous level of poly(ADP-ribose) during cellular differentiation.

Digestion of the poly(ADP-ribose) with snake venom phosphodiesterase yielded phosphoribosyl-AMP and AMP in a ratio of 30 to 1, indicating the "chain length" of 30 if the poly(ADP-ribose) is a linear molecule as previously supposed. Gel filtration and gel electrophoresis, however, revealed a very heterogeneous size distribution, the average size being, much longer than (ADP-ribose)30. Electron microscopy of poly(ADP-ribose) showed an irregularly branched figure. Molecules with more than ten branched portions were observed. These results are in agreement with the recent identification of the chemical structure of the branched portion in poly(ADP-ribose).

Teleocidin, a naturally occurring tumor promoter, enhanced colony formation of human umbilical cord blood lymphocytes in soft agar iduced by the B95-8 strain of Epstein-Barr virus. Colonies were formed most efficiently in the presence of teleocidin at a concentration of 0.1 ng/ml. Possible mechanisms of this enhancement are discussed.

The poly(ADP-ribosylation) of histones, which occurs within a limited and functionally specific domain of chromatin, is a novel post-translational modification. However, in the past it has been difficult to study this process in living cells because the substrate of the reaction (NAD) does not permeate the plasma membrane. In the current study, antibodies specific for histone H1 and poly(ADP-ribose) were used to study the occurrence of poly(ADP-ribose)+ species of H1 in vivo. Perchloric acid-extracted proteins from synchronously growing HeLa cells were fractionated by electrophoresis and transferred to nitrocellulose, and the transferred moieties were allowed to react with the specific antibodies and then with 125I-labeled protein A. The results conclusively demonstrate the natural occurrence of poly(ADP-ribose)-crosslinked complexes of histone H1 (i.e., H1 dimer), at the S/G2 phase transition of the cell cycle.

Hydroxylapatite column chromatography was used for purification of poly (ADP-Rib). With an increasing concentration gradient of phosphate buffer (pH 6.8) RNA, DNA, and poly (ADP-Rib) with a chain of 17–18 ADP-ribose units were eluted successively. RNase and DNase digestion of a crude extract containing RNA, DNA, and poly(ADP-Rib) before chromatography resulted in a better separation of poly (ADP-Rib). Poly (ADP-Rib) with a shorter chain length were eluted with more dilute phosphate buffer and a linear relationship was obtained between the chain length of the material eluted and the phosphate concentration of the elution buffer.

The enzyme catalyzing the synthesis of poly (adenosine diphosphate-ribose) with an average of eight repetitions of ADP-ribose was purified 10-fold from rat liver nuclei in 15% yield. The enzyme required DNA, histone, MgCl2, and dithiothreitol for activity. DNA could not be replaced by polyanions such as poly (U), poly (A), poly (C), RNA, polyvinyl sulfate, methyl dextran sulfate, or heparin. The enzyme was as active on native DNA as on heat-denatured DNA and on poly [d (A-T)], but less active on poly(dG)·poly(dC) and on acid-soluble oligodeoxyribonucleotide. Whole histones of calf thymus or of rat liver, lysine-rich histone of calf thymus, and arginine-rich histone were similarly effective in stimulating the reaction. Casein, bovine serum albumin, cytochrome c, and spermidine did not replace lysine-rich histone. CaCl2 or MnCl2 was as effective for the reaction as MgCl2. Dithiothreitol could be replaced by 2-mercaptoethanol and by glutathione. Polyanions, such as RNA, poly(U), poly(C), poly(A), and polyvinyl sulfate inhibited the enzyme activity. The molecular weight of the enzyme was determined to be 78,000 by sucrose density gradient centrifugation.

Two hybridomas producing monoclonal antibodies to poly(adenosine diphosphate ribose) [poly(ADP-Rib)] were established. One antibody, 10H (IgG3, kappa), bound to most of the poly(ADP-Rib) preparation, which consisted of molecules of various sizes of more than 20 ADP-Rib residues. The binding of this antibody was inhibited by not only poly-(ADP-Rib) but also a monomer unit of poly(ADP-Rib), Ado(P)-Rib-P. The sites protected by antibody 10H were isolated and analyzed by hydrolysis with alkaline phosphomonoesterase and then snake venom phosphodiesterase. The sites contained the same amounts of monomer units and branched portions [Ado(P)-Rib(P)-Rib-P] as the original poly(ADP-Rib) molecules but a lower average number of branched portions per molecule than in the original molecules. The other antibody, 16B (IgM, lambda), reacted with only 50% of the radioactive poly(ADP-Rib), and its binding was not inhibited by a monomer unit. This antibody protected 25% of all the poly(ADP-Rib) molecules from hydrolysis by snake venom phosphodiesterase. The protected sites contained twice as many branched portions per molecule as the original poly(ADP-Rib) molecules. These results show that the two monoclonal antibodies recognize different structures of poly-(ADP-Rib); 10H antibody recognizes the linear structure with ribose-ribose linkages, and 16B antibody may recognize specific structures, including the branched portions of poly-(ADP-Rib).

Human T-cell leukemia virus type II (HTLV-II) isolated from a T-cell variant of hairy cell leukemia contains gag, pol and env genes as well as a fourth gene termed X, which can code three major open reading frames Xa, Xb and Xc. Proteins with molecular masses of 26 kDa (p26xb) and 24 kDa (p24xb) encoded by the Xb open reading frame were identified with antisera directed against synthetic peptides corresponding to the N-terminal and C-terminal amino acid sequences deduced from the structure of the Xb open reading frame. More than half the Xb products were found to be located in the nuclear fraction of HTLV-II-infected cells.

A novel phosphodiesterase was purified from cultured tobacco cells to a state which appeared homogeneous on polyacrylamide gel electrophoresis. The enzyme hydrolyzed various phosphodiester and pyrophosphate bonds, including p-nitrophenyl thymidine 5'-phosphate, p-nitrophenyl thymidine 3'-phosphate, cyclic nucleotides, ATP, NAD+, inorganic pyrophosphate, dinucleotides, and poly(adenosine diphosphate ribose), which is a polymer synthesized from NAD+. However, it did not hydrolyze highly polymerized polynucleotides. The molecular weight of the native enzyme was estimated as 270 000 to 280 000 by gel filtration on Sephadex G-200 and Bio-Gel A-5m. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis indicated that the enzyme was composed of subunits with molecular weights calculated to be 75 000. The enzyme did not require divalent cations for activity being fully active in the presence of ethylenediaminetetraacetic acid. The pH optimum for the enzyme was approximately 6 with p-ni-trophenyl thymidine 5'-phosphate or adenosine cyclic 3',5'monophosphate, and 5.3 with NAD+. Double reciprocal plots of the initial velocity against the concentration of p-nitrophenyl thymidine 5'-phosphate gave two apparent Km values of 0.17 and 1.3 mM, suggesting the presence of at least two active sites.

Poly(ADP-ribose) glycohydrolase, which was first identified in calf thymus and rat liver, was found to be present in all normal rat tissues and tumors. Of the tissues examined, the testis had the highest activity. The major pathway of degradation of poly(ADP-ribose) in all tissues was through poly(ADP-ribose) glycohydrolase. Phosphodiesterase, which was first found in rat liver, was only of minor importance in hydrolysis of poly(ADP-ribose). These findings suggest the importance of poly(ADP-ribose) glycohydrolase both in normal and tumor tissues for the rapid turnover of poly(ADP-ribose).

Poly(ADP-ribose) has been expected to play some regulatory roles in nuclear functions. However, its amount and distribution in vivo have not yet been fully elucidated. An immunohistochemical method should be useful for the study of the natural occurrence of poly(ADP-ribose) at the cellular level. We have developed a highly sensitive immunohistochemical method for detecting poly(ADP-ribose) in conventional histological sections (1, 2).

A portion of the amino acid sequence of human c-Ha-ras protooncogene product p21 is highly homologous with the corresponding region of a family of guanine binding membrane proteins, G-proteins, that are involved in signal transduction (1). Therefore, an analogous function is suggested for ras proteins and G-proteins. Although G-proteins are ADP- ribosylated by cholera toxin (2) or pertussis toxin (3), there has been no data of ADP-ribosylation of c-Ha-ras product by bacterial toxins. On the other hand, both Tsai et al. (4) and our group (5) found ADP-ribosylation of Escherichia coli synthesized c-Ha-ras protein by eukaryotic ADP-ribosyl transferases. Here we identify the amino acid residue which is ADP- ribosylated by a purified hen liver enzyme.

Summary Benzamide and m -aminobenzamide, which are the most potent inhibitors of poly(adenosine diphosphate ribose) polymerase known, induced many sister chromatid exchanges (SCEs) in Chinese hamster ovary cells CHO-K1. Nicotinamide, o -aminobenzamide, p -aminobenzamide and 3-acetylpyridine, which are moderate inhibitors of the enzyme, induced SCEs significantly. 1-Methylnicotinamide + , N′-methylnicotinamide, nicotinic acid and benzoic acid, which are very weak inhibitors of the enzyme, induced no appreciable SCEs. There was a positive correlation between the inhibitory effects of these compounds on the enzyme and their effects in inducing SCEs.

The chromatin-associated enzyme poly(ADP-Rib) polymerase catalyzes the posttranslational modification of histones. Antibody to poly(ADP-Rib) has been coupled to Sepharose, and the resultant immunoadsorbent was used to fractionate, specifically, histone H1 subpopulations undergoing this nuclear protein modification. When this method of separation was used, it was additionally observed that poly-(ADP-ribosylated) H1 species were highly accessible to in vitro phosphorylation by nuclear protein kinase. Phosphorylated H1 molecules were retained by the anti-poly(ADP-Rib)-Sepharose column due to the presence of endogenous poly-(ADP-Rib) components. Degradation of the latter moieties on phosphorylated H1 reversed their adsorption to the column.

Poly(ADP-ribose) is suggested to be involved in various physiological phenomena, such as DNA repair, sister chromatid exchanges, differentiation, proliferation and transformation of eukaryotic cells (1). To find a means of clarifying the biological function of poly(ADP-ribose), we purified poly(ADP-ribose) polymerase from human placenta. We also isolated the cDNA for poly(ADP-ribose) polymerase and determined the nucleotide sequence. Using the cDNA probe we found a decrease in the amount of transcript for the poly(ADP-ribose) polymerase gene during the retinoic acid-induced granulocytic differentiation of HL-60 cells.

The cytotoxic effects of bleomycin on HeLa cells in culture were enhanced by incubation of the cells with benzamide, a potent inhibitor of poly(ADP-ribose) polymerase, at concentrations at which benzamide alone did not show any cytotoxicity. Benzamide plus bleomycin display enhanced therapeutic effects against Ehrlich ascites tumor cells in vivo. On daily treatment with various doses of bleomycin plus benzamide for 10 days, mice with Ehrlich ascites tumors survived longer than mice on treatment with bleomycin alone.

The structure of the integrated provirus in cell lines established from the cerebrospinal fluid (CSF) of patients with human T-cell leukemia virus type-1 (HTLV-1)-associated myelopathy (HAM) was analyzed. The digestion patterns with 3 restriction endonucleases, Sac I, Eco RI and PstI, of the proviruses integrated in T-lymphoid cell lines derived from the CSF of 4 HAM patients were similar to those of HTLV-1 from adult T-cell leukemia (ATL) patients. Integrated proviruses in one of these cell lines derived from the CSF were further analyzed in detail with 2 more restriction enzymes, BamHI and Sma I. The results indicate that the retrovirus found in lymphocytes of the CSF from patients with HAM are very similar, if not identical, to HTLV-1 found in the leukemic lymphocytes of ATL patients.

m-Aminobenzamide and benzamide, which are potent inhibitors of poly (adenosine diphosphate ribose) polymerase and have no antitumor activity themselves, potentiated the antitumor activity of bleomycin against Ehrlich ascites carcinoma in vivo.

Summary The poly(ADP-ribose) polymerase mRNA level in quiescent T lymphocytes was low, but was significantly higher than that in B lymphocytes or monocytes. When T lymphocytes were stimulated with phytohemagglutinin, a prompt increase in the mRNA level was observed from 4 hours after stimulation. The level of poly(ADP-ribose) polymerase mRNA reached a maximum in the late G1 phase about 1–2 days after lectin stimulation, and then decreased gradually returning to the basal level 10 days after lectin stimulation. Cycloheximide abrogated increase in poly(ADP-ribose) polymerase gene expression suggesting that a newly synthesized protein(s) was involved in poly(ADP-ribose) polymerase gene induction in lectin-stimulated T lymphocytes.