Search

Epimedium genus is a traditional Chinese medicine, which has functions of tonifying kidney and yang, strengthening tendons and bones, dispelling wind and emoving dampness. It is mainly used for the treatment of impotence and spermatorrhea, osteoporosis, Parkinson's, Alzheimer's, and cardiovascular diseases. The aim of this review is to provide a systematic summary of the phytochemistry, pharmacology, and clinical applications of the Epimedium Linn. In this paper, the relevant literature on Epimedium Linn. was collected from 1987 to the present day, and more than 274 chemical constituents, including flavonoids, phenylpropanoids, lignans, phenanthrenes, and others, were isolated from this genus. Modern pharmacological studies have shown that Epimedium Linn. has osteoprotective, neuroprotective, cardiovascular protective, and immune enhancing pharmacological effects. In addition, Epimedium Linn. has been commonly used to treat osteoporosis, erectile dysfunction, hypertension and cardiovascular disease. In this paper, the distribution of resources, chemical compositions, pharmacological effects, clinical applications and quality control of Epimedium Linn. are progressed to provide a reference for further research and development of the resources of this genus., (© 2024 Wiley-VHCA AG, Zurich, Switzerland.)

Purpose: The aim of this study was to investigate the causal relationships between circulating cell traits and risk of renal disorders., Methods: We applied a comprehensive two-sample Mendelian randomization (MR) analysis. Single nucleotide polymorphisms (SNPs) from publicly available genome-wide association studies (GWAS) databases were utilized. Genetically predicted instrumental variables of human blood cell traits were extracted from Blood Cell Consortium (BCX) while data on renal diseases was obtained from Finngen consortium. The primary MR analysis was conducted using the inverse variance weighted (IVW) method, with the weighted median (WM) and MR-Egger models used as additional methods. Sensitivity analyses, including MR-PRESSO, radial regression and MR-Egger intercept were conducted to detect outliers and assess horizontal pleiotropy. We further utilized the leave-one-out analysis to assess the robustness of the results. Causal associations were considered significant based on false rate correction (FDR), specifically when the IVW method provided a p FDR  < 0.05., Results: Our results demonstrated that both white blood cell (WBC) count (OR = 1.50, 95% CI = 1.10-2.06, p FDR  = 0.033, p IVW  = 0.011) and lymphocyte count (OR = 1.50, 95% CI = 1.13-1.98, p FDR  = 0.027, p IVW  = 0.005) were causally associated with a higher risk of IgA nephropathy. Furthermore, WBC count was identified as a significant genetic risk factor for renal malignant neoplasms (OR = 1.23, 95% CI = 1.06-1.43, p FDR  = 0.041, p IVW  = 0.007). Additionally, an increased level of genetically predicted eosinophils was found to be causally associated with a higher risk of diabetic nephropathy (OR = 1.21, 95% CI = 1.08-1.36, p FDR  = 0.007, p IVW  = 0.001). No evidence of pleiotropy was determined., Conclusion: Our findings provide evidence of causal associations of circulating WBC count, lymphocyte count and IgA nephropathy, WBC count and renal malignant neoplasms, and eosinophil count and diabetic nephropathy. These results have the potential to contribute to the development of novel diagnostic options and therapeutic strategies for renal disorders., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2024 Shi, Zhang, Li, Zhu, Jin and Fan.)

Objectives: Acute lung injury (ALI) is a highly inflammatory condition with the involvement of M1 alveolar macrophages (AMs) polarization, eventually leading to the development of non-cardiogenic edema in alveolar and interstitial regions, accompanied by persistent hypoxemia. Given the significant mortality rate associated with ALI, it is imperative to investigate the underlying mechanisms of this condition so as to identify potential therapeutic targets. The therapeutic effects of the inhibition of bromodomain containing protein 4 (BRD4), an epigenetic reader, has been proven with high efficacy in ameliorating various inflammatory diseases through mediating immune cell activation. However, little is known about the therapeutic potential of BRD4 degradation in acute lung injury., Methods: This study aimed to assess the protective efficacy of ARV-825, a novel BRD4-targeted proteolysis targeting chimera (PROTAC), against ALI through histopathological examination in lung tissues and biochemical analysis in bronchoalveolar lavage fluid (BALF). Additionally, the underlying mechanism by which BRD4 regulated M1 AMs was elucidated by using CUT & Tag assay., Results: In this study, we found the upregulation of BRD4 in a lipopolysaccharide (LPS)-induced ALI model. Furthermore, we observed that intraperitoneal administration of ARV-825, significantly alleviated LPS-induced pulmonary pathological changes and inflammatory responses. These effects were accompanied by the suppression of M1 AMs. In addition, our findings revealed that the administration of ARV-825 effectively suppressed M1 AMs by inhibiting the expression of IRF7, a crucial transcriptional factor involved in M1 macrophages., Conclusion: Our study suggested that targeting BRD4 using ARV-825 is a potential therapeutic approach for ALI., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024. Published by Elsevier B.V.)

Background: The complex relationship between atrial fibrillation (AF) and type 2 diabetes mellitus (T2DM) suggests a potential role for epicardial adipose tissue (EAT) that requires further investigation. This study employs bioinformatics and experimental approaches to clarify EAT's role in linking T2DM and AF, aiming to unravel the biological mechanisms involved., Method: Bioinformatics analysis initially identified common differentially expressed genes (DEGs) in EAT from T2DM and AF datasets. Pathway enrichment and network analyses were then performed to determine the biological significance and network connections of these DEGs. Hub genes were identified through six CytoHubba algorithms and subsequently validated biologically, with further in-depth analyses confirming their roles and interactions. Experimentally, db/db mice were utilized to establish a T2DM model. AF induction was executed via programmed transesophageal electrical stimulation and burst pacing, focusing on comparing the incidence and duration of AF. Frozen sections and Hematoxylin and Eosin (H&E) staining illuminated the structures of the heart and EAT. Moreover, quantitative PCR (qPCR) measured the expression of hub genes., Results: The study identified 106 DEGs in EAT from T2DM and AF datasets, underscoring significant pathways in energy metabolism and immune regulation. Three hub genes, CEBPZ, PAK1IP1, and BCCIP, emerged as pivotal in this context. In db/db mice, a marked predisposition towards AF induction and extended duration was observed, with HE staining verifying the presence of EAT. Additionally, qPCR validated significant changes in hub genes expression in db/db mice EAT. In-depth analysis identified 299 miRNAs and 33 TFs as potential regulators, notably GRHL1 and MYC. GeneMANIA analysis highlighted the hub genes' critical roles in stress responses and leukocyte differentiation, while immune profile correlations highlighted their impact on mast cells and neutrophils, emphasizing the genes' significant influence on immune regulation within the context of T2DM and AF., Conclusion: This investigation reveals the molecular links between T2DM and AF with a focus on EAT. Targeting these pathways, especially EAT-related ones, may enable personalized treatments and improved outcomes., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier B.V. All rights reserved.)

Pylephlebitis, which is a type of septic thrombophlebitis of the portal vein, is a rare and life-threatening complication that commonly occurs following appendicitis. However, nonspecific abdominal complaints and fever can impede the diagnosis of pylephlebitis. Timely use of appropriate antibiotics and anticoagulants is paramount for treating this condition. We present a case of pylephlebitis and septic shock caused by acute nonperforated appendicitis. A 32-year-old man presented with migratory right lower abdominal pain. Blood cultures showed the presence of Escherichia coli . Blood test results showed increased bilirubin concentrations and coagulation factor abnormalities. A computed tomographic abdominal scan showed that the portal vein had a widened intrinsic diameter. After intensive care treatment with antibiotics, antishock therapy, anticoagulants, and other supportive treatments, the infection was monitored, the abdominal pain disappeared, and the jaundice subsided. Laparoscopic appendectomy was performed. Histopathology showed acute suppurative appendicitis, and no abnormalities were observed during the follow-up period after discharge. A multidisciplinary approach is mandatory for the decision-making process in the presence of pylephlebitis caused by appendicitis to obtain a correct diagnosis and prompt treatment. Similarly, the timing of appendectomy is important for minimizing intra- and postoperative complications., Competing Interests: Declaration of conflicting interestThe authors declare that there is no conflict of interest.

Radiation-induced lung injury (RILI) frequently occurs as a complication following radiotherapy for chest tumors like lung and breast cancers. However, the precise underlying mechanisms of RILI remain unclear. In this study, we generated RILI models in rats treated with a single dose of 20 Gy and examined lung tissues by single-cell RNA sequencing (scRNA-seq) 2 weeks post-radiation. Analysis of lung tissues revealed 18 major cell populations, indicating an increase in cell-cell communication following radiation exposure. Neutrophils, macrophages, and monocytes displayed distinct subpopulations and uncovered potential for pro-inflammatory effects. Additionally, endothelial cells exhibited a highly inflammatory profile and the potential for reactive oxygen species (ROS) production. Furthermore, smooth muscle cells (SMC) showed a high propensity for extracellular matrix (ECM) deposition. Our findings broaden the current understanding of RILI and highlight potential avenues for further investigation and clinical applications.

Four undescribed sesquiterpenoids, lemneolemnanes A-D ( 1 - 4 ), have been isolated from the marine soft coral Lemnalia sp. The absolute configurations of the stereogenic carbons of 1 - 4 were determined by single-crystal X-ray crystallographic analysis. Compounds 1 and 2 are epimers at C-3 and have an unusual skeleton with a formyl group on C-6. Compound 3 possesses an uncommonly rearranged carbon skeleton, while 4 has a 6/5/5 tricyclic system. Compound 1 showed significant anti-Alzheimer's disease (AD) activity in a humanized Caenorhabditis elegans AD pathological model.

Background: Asthma is a heterogeneous disease characterized by airway inflammation and remodeling, whose pathogenetic complexity was associated with abnormal responses of various cell types in the lung. The specific interactions between immune and stromal cells, crucial for asthma pathogenesis, remain unclear. This study aims to determine the key cell types and their pathological mechanisms in asthma through single-cell RNA sequencing (scRNA-seq)., Methods: A 16-week mouse model of house dust mite (HDM) induced asthma (n = 3) and controls (n = 3) were profiled with scRNA-seq. The cellular composition and gene expression profiles were assessed by bioinformatic analyses, including cell enrichment analysis, trajectory analysis, and Gene Set Enrichment Analysis. Cell-cell communication analysis was employed to investigate the ligand-receptor interactions., Results: The asthma model results in airway inflammation coupled with airway remodeling and hyperresponsiveness. Single-cell analysis revealed notable changes in cell compositions and heterogeneities associated with airway inflammation and remodeling. GdT17 cells were identified to be a primary cellular source of IL-17, related to inflammatory exacerbation, while a subpopulation of alveolar macrophages exhibited numerous significantly up-regulated genes involved in multiple pathways related to neutrophil activities in asthma. A distinct fibroblast subpopulation, marked by elevated expression levels of numerous contractile genes and their regulators, was observed in increased airway smooth muscle layer by immunofluorescence analysis. Asthmatic stromal-immune cell communication significantly strengthened, particularly involving GdT17 cells, and macrophages interacting with fibroblasts. CXCL12/CXCR4 signaling was remarkedly up-regulated in asthma, predominantly bridging the interaction between fibroblasts and immune cell populations. Fibroblasts and macrophages could jointly interact with various immune cell subpopulations via the CCL8/CCR2 signaling. In particular, fibroblast-macrophage cell circuits played a crucial role in the development of airway inflammation and remodeling through IL1B paracrine signaling., Conclusions: Our study established a mouse model of asthma that recapitulated key pathological features of asthma. ScRNA-seq analysis revealed the cellular landscape, highlighting key pathological cell populations associated with asthma pathogenesis. Cell-cell communication analysis identified the crucial ligand-receptor interactions contributing to airway inflammation and remodeling. Our findings emphasized the significance of cell-cell communication in bridging the possible causality between airway inflammation and remodeling, providing valuable hints for therapeutic strategies for asthma., (© 2024. The Author(s).)

Background: PCV13 introduction in China has led to a significant reduction of vaccine serotype Streptococcus pneumoniae . However, non-vaccine serotypes with highly resistance and invasiveness were often reported in the post-pneumococcal conjugate vaccine era and there was regional differences., Methods: A total of 669 S. pneumoniae strains were collected from the respiratory tracts of hospitalized children at Shenzhen Children's Hospital in 2021 and 2022. Antimicrobial resistance (AMR) characteristics were assessed through antibiotic susceptibility testing performed with the VITEK 2 compact system. AMR genes and single nucleotide polymorphisms (SNPs) in pbp1a, pbp2b, and pbp2x were identified via analysis of whole genome sequencing data. Statistical examination of the data was conducted employing chi-square and Fisher's exact tests., Results: We found that non-vaccine serotypes strains had accounted for 46.6% of all the pneumococcal isolated strains. The most common non-vaccine serotype is 23A, with a prevalence rate of 8.9%, followed by 15A (6.6%), 6E (5.7%), 34 (3.2%), and 15B (2.9%). The multidrug resistance rates (MDR) of vaccine serotypes were 19F (99.36%), 19A (100%), 23F (98.08%), 6B (100%), and 6C (100%). Meanwhile, the MDR of non-vaccine serotypes were 15B (100.00%), 6E (100%), 15C (100%), 34 (95.24%), and 23A (98.31%). Resistance rates of 6E to more than six antibiotic classes reached 89.47%, which is similar to 19F (83.33%) and 19A (90%). Unique resistance profiles were also identified for non-vaccine serotypes, including significantly higher resistance to chloramphenicol in 6E, 15B, and 15C than in 19F and 19A. Furthermore, through genome sequencing, we revealed strong correlation of cat-TC with chloramphenicol resistance, patA/patB with tetracycline resistance, ermB and pmrA with erythromycin resistance., Conclusion: The introduction of PCV13 into China from 2017 has led to a shift in the dominant composition of pneumococcal strains. There has been a notable rise and spread of multidrug-resistant non-vaccine serotypes among children. Specifically, the non-vaccine serotype 6E, which was not widely reported in China previously, has emerged. To comprehend the resistance mechanisms, it is crucial to further investigate the molecular and genetic characteristics of these non-vaccine serotypes., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. The author(s) declared that they were an editorial board member of Frontiers, at the time of submission. This had no impact on the peer review process and the final decision., (Copyright © 2024 Shi, Patil, Wang, Liu, Zhu, Wang, Chen, Li, Yang, Zheng, Dong and Bao.)

Rigorous risk assessment of chemicals in food and feed is essential to address the growing worldwide concerns about food safety. High-quality toxicological data on food-relevant chemicals are fundamental for risk modeling and assessment in the food safety area. The organization and analysis of substantial toxicity information can positively support decision-making by providing insight into toxicity trends. However, it remains challenging to systematically obtain fragmented toxicity data, and related toxicological resources are required to meet the current demands. In this study, we collected 221,439 experimental toxicity records for 5,657 food-relevant chemicals identified from extensive databases and literature, along with their information on chemical identification, physicochemical properties, environmental fates, and biological targets. Based on the aggregated data, a freely available web-based databank, Food-Relevant Available Chemicals Toxicology Databank (FRAC-TD) is presented, which supports multiple browsing ways and search criterions. Applying FRAC-TD for data-driven analysis, we revealed the underlying toxicity profiles of food-relevant chemicals in humans, mammals, and other species in the food chain. Expectantly, FRAC-TD could positively facilitate toxicological studies, toxicity prediction, and risk assessments in the food industry.

Background: Steatosis and inflammation are the hallmarks of nonalcoholic steatohepatitis (NASH). Rotundic acid (RA) is among the key triterpenes of Ilicis Rotundae Cortex and has exhibited multipronged effects in terms of lowering the lipid content and alleviating inflammation. The study objective is to systematically evaluate the potential mechanisms through which RA affects the development and progression of NASH., Methods: Transcriptomic and proteomic analyses of primary hepatocytes isolated from the control, high-fat diet-induced NASH, and RA treatment groups were performed through Gene Ontology analysis and pathway enrichment. Hub genes were identified through network analysis. Integrative analysis revealed key RA-regulated pathways, which were verified by gene and protein expression studies and cell assays., Results: Hub genes were identified and enriched in the Toll-like receptor 4 (TLR4)/activator protein-1 (AP1) signaling pathway and glycolysis pathway. RA reversed glycolysis and attenuated the TLR4/AP1 pathway, thereby reducing lipid accumulation and inflammation. Additionally, lactate release in L-02 cells increased with NaAsO 2 -treated and significantly decreased with RA treatment, thus revealing that RA had a major impact on glycolysis., Conclusions: RA is effective in lowering the lipid content and reducing inflammation in mice with NASH by ameliorating glycolysis and TLR4/AP1 pathways, which contributes to the existing knowledge and potentially sheds light on the development of therapeutic interventions for patients with NASH., (© 2023. The Author(s).)

A series of arylated huperzine A (HPA) derivatives ( 1 - 24 ) were efficiently synthesized in good yields (45-88% yields) through the late-stage modification of structurally complex natural anti-Alzheimer's disease (AD) drug huperzine A (HPA), using the palladium-catalyzed Suzuki-Miyaura cross-coupling reaction. The acetylcholinesterase (AChE) inhibitory activity of all synthesized compounds was evaluated to screen the potential anti-AD bioactive molecules. The results showed that introducing the aryl groups to C-1 position of HPA resulted in the unsatisfactory AChE inhibitory activity. The present study demonstrably verifies pyridone carbonyl group could be the necessary and unchangeable pharmacophore for maintaining HPA's anti-AChE potency, and provides the helpful information on the further research for developing anti-AD HPA analogues.

Purpose: Glioblastoma is one of the malignant tumors with poor prognosis and no effective treatment is available at present., Methods: To study the effect of cordycepin combined with temozolomide on glioblastoma, we explored the effect of the combination based on network pharmacology and biological verification., Results: It was found that the drug combination significantly inhibited the cell growth, proliferation, migration and invasion of LN-229 cells. Drug combination inhibited epithelial-mesenchymal transition (EMT) by up-regulating the expression of E-cadherin and suppressing the expression of N-cadherin, Zeb1 and Twist1. Through network pharmacology, we further explored the molecular mechanism of drug combination against glioblastoma, and 36 drug-disease common targets were screened. The GO biological process analysis included 44 items (P < 0.01), which mainly involved the regulation of apoptosis, cell proliferation, cell migration, etc. The enrichment analysis of KEGG pathways included 28 pathways (P < 0.05), and the first four pathways were "MicroRNA in cancer, Proteoglycans in cancer, Pathways in cancer and PI3K-AKT signaling pathway". We detected the expression of important genes in the pathways and PPI network, and the results showed that the drug combination down-regulated NFKB1, MYC, MMP-9, MCL1, CTNNB1, and up-regulated PDCD4., Conclusion: Cordycepin combined with temozolomide may down-regulate MYC through "MicroRNA in cancer, Proteoglycans in cancer, Pathways in cancer and PI3K-AKT signaling pathway", which in turn regulate the expression of MCL1, CTNNB1, MMP9, PDCD4, thus regulating cell proliferation, migration and apoptosis in glioblastoma., (© 2023. The Author(s), under exclusive licence to Springer-Verlag GmbH Germany, part of Springer Nature.)

Although the gut microbiota has been reported to influence osteoporosis risk, the individual species involved, and underlying mechanisms, remain largely unknown. We performed integrative analyses in a Chinese cohort of peri-/post-menopausal women with metagenomics/targeted metabolomics/whole-genome sequencing to identify novel microbiome-related biomarkers for bone health. Bacteroides vulgatus was found to be negatively associated with bone mineral density (BMD), which was validated in US white people. Serum valeric acid (VA), a microbiota derived metabolite, was positively associated with BMD and causally downregulated by B. vulgatus. Ovariectomized mice fed B. vulgatus demonstrated increased bone resorption and poorer bone micro-structure, while those fed VA demonstrated reduced bone resorption and better bone micro-structure. VA suppressed RELA protein production (pro-inflammatory), and enhanced IL10 mRNA expression (anti-inflammatory), leading to suppressed maturation of osteoclast-like cells and enhanced maturation of osteoblasts in vitro. The findings suggest that B. vulgatus and VA may represent promising targets for osteoporosis prevention/treatment., (© 2023. The Author(s).)

Chemical investigation of soft coral the Sarcophyton elegans collected from the South China Sea led to the identification of four new cembranes, namely sarcoeleganolides H-K ( 1 - 4 ). Their structures and absolute configurations were established by 1D and 2D NMR spectroscopy, quantum chemical calculations of NMR chemical shifts and electronic circular dichroism (ECD) data analysis. Moreover, compound 2 exhibited moderate anti-thrombotic activity in zebrafish.

Considerable achievements were realized in illuminating underlying pathological mechanisms of patients with idiopathic membranous nephropathy (IMN). Although IMN patients are well diagnosed before they reach renal failure, no currently available drug intervention is effective in halting IMN progression. In this study, we assess Moshen granule (MSG) effect on IMN patients and cationic bovine serum albumin (CBSA)-induced rats. Increasing studies has indicated that activation of aryl hydrocarbon receptor (AHR) was related to oxidative stress and inflammation. We further determine MSG effect on AHR, nuclear factor ƙB (NF-ƙB) and nuclear factor erythroid 2-related factor 2 (Nrf2) in the CBSA-induced rats. MSG markedly reduces proteinuria and improves kidney function in both IMN patients and rats induced by CBSA. MSG markedly inhibits increased mRNA expressions of intrarenal AHR and its four downstream target genes including CYP1A1 , CYP1A2 , CYP1B1 and COX-2 compared with untreated CBSA-induced rats. This is accompanied by markedly downregulated protein expressions of p -IƙBα and NF-ƙB p65 and its downstream gene products including MCP-1, COX-2, 12-LOX, iNOS, p47 phox and p67 phox , while markedly preserves protein expressions of Nrf2 and its downstream gene products including catalase, HO-1, GCLM, GCLC, MnSOD and NQO1 in the kidney tissues. These data suggests MSG blunts podocyte damage through inhibiting activation of NF-ƙB/Nrf2 pathway via AHR signaling. This finding may provide a promising therapy for treatment of IMN through oxidative stress and inflammation., Competing Interests: The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (© 2023 The Authors.)

Plants face constant threats from insect herbivores, which limit plant distribution and abundance in nature and crop productivity in agricultural ecosystems. In recent decades, the whitefly Bemisia tabaci , a group of phloem-feeding insects, has emerged as pests of global significance. In this article, we summarize current knowledge on plant defenses against whitefly and approaches to engineer plant resistance to whitefly. Physically, plants deploy trichome and acylsugar-based strategies to restrain nutrient extraction by whitefly. Chemically, toxic secondary metabolites such as terpenoids confer resistance against whitefly in plants. Moreover, the jasmonate (JA) signaling pathway seems to be the major regulator of whitefly resistance in many plants. We next review advances in interfering with whitefly-plant interface by engineering of plant resistance using conventional and biotechnology-based breeding. These breeding programs have yielded many plant lines with high resistance against whitefly, which hold promises for whitefly control in the field. Finally, we conclude with an outlook on several issues of particular relevance to the nature and engineering of plant resistance against whitefly., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2023 Li, Li, Zhang, Wu, Zhao, Liu and Pan.)

Objective: Acinetobacter baumannii is a hazardous bacterium that causes hospital-acquired nosocomial infections, and the advent of multidrug-resistant A. baumannii (MDR-AB) strains is concerning. Novel antibacterial therapeutic strategies must be developed. The biological effects of glabridin on MDR-AB were investigated in this study., Methods: The minimum inhibitory concentrations (MICs) of glabridin against eight clinical MDR-AB strains were determined using the broth microdilution technique. Crystal violet staining was used to assess biofilm development, which has significant contribution to bacterial resistance. Swarming motility was measured according to surface growth zone of MDR-AB on LB agar medium. qRT-PCR was used to evaluate the expression of quorum sensing genes abaI and abaR . Glabridin and routinely used therapeutic antimicrobial agents were tested for synergistic action using the checkerboard method., Results: According to our findings, glabridin suppressed MDR-AB growth at high doses (512-1024 μg/mL). The 1/4 MIC of glabridin significantly decreased MDR-AB biofilm formation by 19.98% ( P < 0.05), inhibited MDR-AB motility by 44.27% ( P < 0.05), whereas the 1/2 MIC of glabridin dramatically reduced MDR-AB biofilm development by 27.43% ( P < 0.01), suppressed MDR-AB motility by 50.64% ( P < 0.05). Mechanistically, glabridin substantially downregulated the expression of quorum sensing-related genes abaI and abaR by up to 39.12% (P < 0.001) and 25.19% (P < 0.01), respectively. However, no synergistic effect between glabridin and antibacterial drugs was found., Conclusion: Glabridin might be a quorum sensing inhibitor that inhibits MDR-AB biofilm development and swarming motility., Competing Interests: The authors declare that they have no competing interests in this work., (© 2023 Lin et al.)

Background: Hull colour is an important morphological marker for selection in seed production of foxtail millet. However, the molecular mechanisms underlying hull colour variation remain unknown., Results: An F 7 recombinant inbred line (RIL) population containing 215 lines derived from Hongjiugu × Yugu18 was used to analyze inheritance and detect the quantitative trait loci (QTL) for four hull colour traits using major gene plus polygene mixed inheritance analysis and composite interval mapping (CIM) in four environments. Genetic analysis revealed that the hull colour L * value (HCL * ) was controlled by two major genes plus additive polygenes, the hull colour a * value (HCa * ) was controlled by three major genes, the hull colour b * value (HCb*) was controlled by two major genes plus polygenes, and the hull colour C * value (HCC*) was controlled by four major genes. A high-density genetic linkage map covering 1227.383 cM of the foxtail millet genome, with an average interval of 0.879 cM between adjacent bin markers, was constructed using 1420 bin markers. Based on the genetic linkage map and the phenotypic data, a total of 39 QTL were detected for these four hull colour traits across four environments, each explaining 1.50%-49.20% of the phenotypic variation. Of these, six environmentally stable major QTL were co-localized to regions on chromosomes 1 and 9, playing a major role in hull colour. There were 556 annotated genes within the two QTL regions. Based on the functions of homologous genes in Arabidopsis and the Kyoto Encyclopedia of Genes and Genomes (KEGG) and Gene Ontology (GO) gene annotations, five genes were predicted as candidate genes for further studies., Conclusions: This is the first study to use an inheritance model and QTL mapping to determine the genetic mechanisms of hull colour trait in foxtail millet. We identified six major environmentally stable QTL and predicted five potential candidate genes to be associated with hull colour. These results advance the current understanding of the genetic mechanisms underlying hull colour traits in foxtail millet and provide additional resources for application in genomics-assisted breeding and potential isolation and functional characterization of the candidate genes., (© 2023. BioMed Central Ltd., part of Springer Nature.)

Posttranslational modification dramatically enhances protein complexity, but the function and precise mechanism of novel lysine acylation modifications remain unknown. Chemoresistance remains a daunting challenge to successful treatment. We found that lysine butyrylation (Kbu) is specifically upregulated in chemoresistant tumor cells and tissues. By integrating butyrylome profiling and gain/loss-of-function experiments, lysine 754 in HSP90 (HSP90 K754) was identified as a substrate for Kbu. Kbu modification leads to overexpression of HSP90 in esophageal squamous cell carcinoma (ESCC) and its further increase in relapse samples. Upregulation of HSP90 contributes to 5-FU resistance and can predict poor prognosis in cancer patients. Mechanistically, HSP90 K754 is regulated by the cooperation of KAT8 and HDAC11 as the writer and eraser, respectively; SDCBP increases the Kbu level and stability of HSP90 by binding competitively to HDAC11. Furthermore, SDCBP blockade with the lead compound V020-9974 can target HSP90 K754 to overcome 5-FU resistance, constituting a potential therapeutic strategy., (© 2023. The Author(s).)

Drug discovery, which plays a vital role in maintaining human health, is a persistent challenge. Fragment-based drug discovery (FBDD) is one of the strategies for the discovery of novel candidate compounds. Computational tools in FBDD could help to identify potential drug leads in a cost-efficient and time-saving manner. The Auto Core Fragment in silico Screening (ACFIS) server is a well-established and effective online tool for FBDD. However, the accurate prediction of protein-fragment binding mode and affinity is still a major challenge for FBDD due to weak binding affinity. Here, we present an updated version (ACFIS 2.0), that incorporates a dynamic fragment growing strategy to consider protein flexibility. The major improvements of ACFIS 2.0 include (i) increased accuracy of hit compound identification (from 75.4% to 88.5% using the same test set), (ii) improved rationality of the protein-fragment binding mode, (iii) increased structural diversity due to expanded fragment libraries and (iv) inclusion of more comprehensive functionality for predicting molecular properties. Three successful cases of drug lead discovery using ACFIS 2.0 are described, including drugs leads to treat Parkinson's disease, cancer, and major depressive disorder. These cases demonstrate the utility of this web-based server. ACFIS 2.0 is freely available at http://chemyang.ccnu.edu.cn/ccb/server/ACFIS2/., (© The Author(s) 2023. Published by Oxford University Press on behalf of Nucleic Acids Research.)

This study aims to evaluate the effects of temperature and relative humidity on the propagation of COVID-19 for indoor heating, ventilation, and air conditioning design and policy development in different climate zones. We proposed a cumulative lag model with two specific parameters of specific average temperature and specific relative humidity to evaluate the impact of temperature and relative humidity on COVID-19 transmission by calculating the relative risk of cumulative effect and the relative risk of lag effect. We considered the temperature and relative humidity corresponding to the relative risk of cumulative effect or the relative risk of lag effect equal to 1 as the thresholds of outbreak. In this paper, we took the overall relative risk of cumulative effect equal to 1 as the thresholds. Data on daily new confirmed cases of COVID-19 since January 1, 2021, to December 31, 2021, for three sites in each of four climate zones similar to cold, mild, hot summer and cold winter, and hot summer and warm winter were selected for this study. Temperature and relative humidity had a lagged effect on COVID-19 transmission, with peaking the relative risk of lag effect at a lag of 3-7 days for most regions. All regions had different parameters areas with the relative risk of cumulative effect greater than 1. The overall relative risk of cumulative effect was greater than 1 in all regions when specific relative humidity was higher than 0.4, and when specific average temperature was higher than 0.42. In areas similar to hot summer and cold winter, temperature and the overall relative risk of cumulative effect were highly monotonically positively correlated. In areas similar to hot summer and warm winter, there was a monotonically positive correlation between relative humidity and the overall relative risk of cumulative effect. This study provides targeted recommendations for indoor air and heating, ventilation, and air conditioning system control strategies and outbreak prevention strategies to reduce the risk of COVID-19 transmission. In addition, countries should combine vaccination and non-pharmaceutical control measures, and strict containment policies are beneficial to control another pandemic of COVID-19 and similar viruses., (© 2023. The Author(s), under exclusive licence to Springer-Verlag GmbH Germany, part of Springer Nature.)

Protein-protein interactions (PPIs) have important roles in various cellular processes, but are commonly described as 'undruggable' therapeutic targets due to their large, flat, featureless interfaces. Fragment-based drug discovery (FBDD) has achieved great success in modulating PPIs, with more than ten compounds in clinical trials. Here, we highlight the progress of FBDD in modulating PPIs for therapeutic development. Targeting hot spots that have essential roles in both fragment binding and PPIs provides a shortcut for the development of PPI modulators via FBDD. We highlight successful cases of cracking the 'undruggable' problems of PPIs using fragment-based approaches. We also introduce new technologies and future trends. Thus, we hope that this review will provide useful guidance for drug discovery targeting PPIs., Competing Interests: Declaration of interests None declared by authors., (Copyright © 2023 Elsevier Ltd. All rights reserved.)

The direct modification of structurally complex natural product dehydroepiandrosterone (DHEA) through iron-catalyzed direct hydroamination of DHEA with various nitro(hetero)arenes was carried out to afford 5α-arylamino-DHEAs (1-25) in good yields (53-72%). Though as a radical reaction, it features high stereoselectivity, and only the 5α-substituted derivatives were produced. The in vitro antiproliferative activity of these synthesized compounds against the human breast cancer MCF-7 cell was evaluated, showing that most of DHEA analogues possessed the moderate cytotoxic activity. The preliminary structure-activity relationship analysis revealed that the electron-withdrawing groups installed at the para-position of arylamine ring had a great contribution to the improvement of the DHEA's cytotoxic potency. Among them, (4-trifluoromethylaniline)-DHEA (4) displayed the most potent cytotoxicity, with an IC 50 value of 19.3 µM, which was 2.3-fold more active than DHEA.

4-Hydroxyphenylpyruvate dioxygenase (HPPD, EC 1.13.11.27) is one of the most promising herbicide targets for the development of agricultural chemicals owing to its unique mechanism of action in plants. We previously reported on the co-crystal structure of Arabidopsis thaliana ( At ) HPPD complexed with methylbenquitrione ( MBQ ), an inhibitor of HPPD that we previously discovered. Based on this crystal structure, and in an attempt to discover even more effective HPPD-inhibiting herbicides, we designed a family of triketone-quinazoline-2,4-dione derivatives featuring a phenylalkyl group through increasing the interaction between the substituent at the R 1 position and the amino acid residues at the active site entrance of At HPPD. Among the derivatives, 6-(2-hydroxy-6-oxocyclohex-1-ene-1-carbonyl)-1,5-dimethyl-3-(1-phenylethyl)quinazoline-2,4(1H,3H)-dione ( 23 ) was identified as a promising compound. The co-crystal structure of compound 23 with At HPPD revealed that hydrophobic interactions with Phe392 and Met335, and effective blocking of the conformational deflection of Gln293, as compared with that of the lead compound MBQ , afforded a molecular basis for structural modification. 3-(1-(3-Fluorophenyl)ethyl)-6-(2-hydroxy-6-oxocyclohex-1-ene-1-carbonyl)-1,5-dimethylquinazoline-2,4(1H,3H)-dione ( 31 ) was confirmed to be the best subnanomolar-range At HPPD inhibitor (IC 50 = 39 nM), making it approximately seven times more potent than MBQ . In addition, the greenhouse experiment showed favorable herbicidal potency for compound 23 with a broad spectrum and acceptable crop selectivity against cotton at the dosage of 30-120 g ai/ha. Thus, compound 23 possessed a promising prospect as a novel HPPD-inhibiting herbicide candidate for cotton fields.

Chemical investigation of the South China Sea soft coral Sarcophyton elegans has led to the isolation of eight undescribed cembranes, namely sarcoelegans A-H. Their structures and absolute configurations were unambiguously established by extensive analyses of spectroscopic data, X-ray diffraction, QM-NMR, and TDDFT-ECD calculations. Sarcoelegan A is composed of the rare tricyclo [11.2.1.0] hexadecane carbon framework which is the third compound of this scaffold. Sarcoelegan B and sarcoelegan C possess an unusual seven-membered ether ring, and (±)-sarcoelegan D has a seven-membered ring with the rare peroxo bridge. In addition, sarcoelegan A, (±)-sarcoelegan D, sarcoelegan E, (+)-sarcoelegan F, and (+)-sarcoelegan H exhibited anti-inflammatory activity in zebrafish and sarcoelegan C exhibited anti-thrombotic activity in zebrafish., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2022 Elsevier Ltd. All rights reserved.)

Although N4-acetylcytidine (ac4C) modification affects the stability and translation of mRNA, it is unknown whether it exists in noncoding RNAs, and its biological function is unclear. Here, nucleotide-resolution method for profiling CTC-490G23.2 ac4C sites and gain- and loss-of-function experiments revealed that N-acetyltransferase 10 (NAT10) is responsible for ac4C modification of long noncoding RNAs (lncRNAs). NAT10-mediated ac4C modification leads to the stabilization and overexpression of lncRNA CTC-490G23.2 in primary esophageal squamous cell carcinoma (ESCC) and its further upregulation in metastatic tissues. CTC-490G23.2 significantly promotes cancer invasion and metastasis in vitro and in vivo. Mechanistically, CTC-490G23.2 acts as a scaffold to increase the binding of CD44 pre-mRNA to polypyrimidine tract-binding protein 1 (PTBP1), resulting in a oncogenic splicing switch from the standard isoform CD44s to the variant isoform CD44v(8-10). CD44v(8-10), but not CD44s, binds to and increases the protein stability of vimentin. Expression levels of CTC-490G23.2 and CD44v(8-10) can predict poor prognosis in cancer patients. Furthermore, the antisense oligonucleotide (ASO)/SV40-LAH4-L1 peptide self-assembled nanocomplexes targeting CTC490G23.2 exerts a significantly suppressive effect on cancer metastasis. The outcome of this study will provide new mechanistic insight into the ac4C modification of lncRNAs and useful clues for the development of novel systemic therapies and prognostic biomarkers., (© 2023. The Author(s), under exclusive licence to Springer Nature Limited.)

Vigna unguiculata is a vital vegetable crop in Southeast Asia, and Megalurothrips usitatus can cause huge damage to this crop. Enhancing the resistance of V . unguiculata against M . usitatus is a promising way to protect this crop; however, there is limited information regarding the mechanism underlying the resistance of V . unguiculata against M . usitatus . Here, a behavior assay was performed to explore the resistance of V. unguiculata against M. usitatus after insect damage or treatment by jasmonic acid (JA). Furthermore, transcriptome and metabonomics analysis was used to detect the putative mechanism underlying the resistance of V. unguiculata against M. usitatus . The pre-treatment of Vigna unguiculata with JA or infestation with Megalurothrips usitatus alleviated the damage resulting from the pest insect. We further identified differentially expressed genes and different metabolites involved in flavonoid biosynthesis and alpha-linolenic acid metabolism. Genes of chalcone reductase and shikimate O-hydroxycinnamoyltransferase involved in flavonoid biosynthesis, as well as lipoxygenase and acyl-CoA oxidase involved in alpha-linolenic acid metabolism, were upregulated in plants after herbivory or JA supplementation. The upregulation of these genes contributed to the high accumulation of metabolites involved in flavonoid biosynthesis and the alpha-linolenic acid metabolism pathway. These transcriptional and metabolite changes are potentially responsible for plant defense and a putative regulatory model is thus proposed to illustrate the cowpea defense mechanism against insect attack. Our study provides candidate targets for the breeding of varieties with resistance to insect herbivory by molecular technology.

In the present study, fourteen Exidia -like specimens were collected from China, France, and Australia. Based on morphological characteristics and phylogenetic analyses using the internal transcribed spacer regions (ITS) and the large subunit of nuclear ribosomal RNA gene (nLSU), four species in Exidia sensu lato , including Exidia saccharina and Tremellochaete atlantica , and two new species, Exidia subsaccharina and Tremellochaete australiensis , were identified. The four species are described and illustrated in detail. E. saccharina and T. atlantica , two known species from China are reported for the first time. E. subsaccharina and T. australiensis , two new species from France and Australia, respectively are also described. E. subsaccharina is characterized by its reddish brown to vinaceous brown basidiomata, slightly papillate hymenial surface, and narrowly allantoid basidiospores without oil drop measuring 12.5-17.5 × 4.2-5.5 μm. It differs from the similar species, E. saccharina , by distinctly larger basidiospores (12.5-17.5 × 4.2-5.5 vs. 10-14.2 × 3.2-4.5 μm). Tremellochaete australiensis is characterized by its white to grayish blue basidiomata, obviously and densely papillate hymenial surface, and allantoid basidiospores with oil drop measuring 13.8-16.2 × 4.8-6.5 μm. It also can be distinguished from the similar species, T. atlantica and T. japonica , by its distinctly larger basidiospores (13.5-17.8 × 4-5.2 vs. 10-11.8 × 4-4.8 μm in T. atlantica ; 9.4-11.8 × 3.5-4.2 μm in T. japonica )., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2023 Tohtirjap, Hou, Rivoire, Gates, Wu and Dai.)

Flavonoids are rich in tea plants (Camellia sinensis), and responsible for the flavor and healthful benefits of tea beverage. The anthocyanin levels in the purple tender shoots are higher than in the general green leaves of tea plant, which provide special materials to search metabolic mechanisms of flavonoid enrichment in plant. In this work, flavonoid differences between purple and green shoots from tea cultivars "Zijuan" (ZJ) and "Yunkang10" (YK-10) were investigated through metabolomic analysis, and mechanisms for their difference were surveyed by comparative transcriptomic and proteomic analysis. Levels of 34 flavonoids were different between ZJ and YK-10 shoots. Among them, 8 and 6 were marker metabolites in ZJ and YK-10, respectively. The differentially expressed genes (DEGs), differentially expressed proteins (DEPs), and different-level metabolites (DLMs) between ZJ and YK-10 were researched, respectively; and interactions including DEG-DLM, DEP-DLM, DEG-DEP, and DEG-DEP-DLM were analyzed; the contents of 18 characteristic flavonoids in tea leaves and expressions of 34 flavonoid metabolic genes were measured to verify the omics results. Integrated above analyses, a proposed model of flavonoids biosynthesis in tea shoots were established. The differential expression of the leucoanthocyanidin reductase (LAR), anthocyanidin synthase (ANS), anthocyanidin reductase (ANR), UDPG-flavonoid glucosyltransferase (UGT) 75L12 and 94P1 at gene level, and the ANS, ANR, and UGT78A15 at protein level, were closely associated with differences in flavonoids between ZJ and YK-10 shoot. Together, this study provides new information on the flavonoid accumulation mechanism in tea plant., Competing Interests: Conflicts of interest The authors declare no conflicts of interest., (© The Author(s) 2022. Published by Oxford University Press on behalf of Genetics Society of America.)

Objective: This study aims to analyze the serotype distribution and drug resistance of Streptococcus pneumoniae isolated from children aged 8 days to 7 years in Urumqi, China, between 2014 to 2021, during which PCV13 was introduced in the private sector's immunization program and COVID-19 control was administrated in the last 2 years., Methods: Serotypes of S. pneumoniae isolates were determined by Quellung reaction, and their susceptibility against 14 antimicrobials were tested. According to the start year of PCV13 administration (2017) and COVID-19 control (2020), the study period was divided into three stages: 2014-2015, 2018-2019, and 2020-2021., Results: A total of 317 isolates were involved in this study. The most common serotypes were type 19F (34.4%), followed by 19A (15.8%), 23F (11.7%), 6B (11.4%), and 6A(5.0%). The coverage rate of both PCV13 and PCV15 was 83.0%. The coverage of PCV20 was a little higher at 85.2%. The resistance rate against penicillin was 28.6% according to the breakpoints of oral penicillin, which would reach up to 91.8% based on the breakpoints of parenteral penicillin for meningitis. The resistance rates to erythromycin, clindamycin, tetracycline, and sulfamethoxazole-trimethoprim were 95.9%, 90.2%, 88.9%, and 78.8%, respectively. The PCV13 isolate was more resistant to penicillin than the non-PCV13 ones. There was not any significant change found in the serotype distribution since the PCV13 introduction and the COVID-19 control. The resistance rate against oral penicillin slightly elevated to 34.5% in 2018-2019 from 30.7% in 2014-2015 and then decreased significantly to 18.1% in 2020-2021 ( χ 2 = 7.716, P < 0.05), while the resistance rate to ceftriaxone (non-meningitis) continuously declined from 16.0% in 2014-2015 to 1.4% in 2018-2019 and 0% in 2020-2021 (Fisher = 24.463, P < 0.01)., Conclusion: The common serotypes of S. pneumoniae isolated from children in Urumqi were types 19F, 19A, 23F, 6B, and 6A, which we found to have no marked change since the PCV13 introduction and the COVID-19 control However, the resistance rate to oral penicillin and ceftriaxone significantly declined in the COVID-19 control stage., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2023 Guo, Shi, Gao, Tian, Yuan, Yang, Wumaier, Cao, Abulimiti, Zhang and Yao.)

PM 2.5 -bound polycyclic aromatic hydrocarbons (PAHs) have been proved to be hazardous to health. Previous studies have focused on the distribution and sources of PAHs, whereas there is little knowledge of the damage to organs. Here we sought to investigate the pollution level and seasonal variation characteristics of PAHs in PM 2.5 in Xi'an and assess the health risk, to establish a PAHs exposure model, and investigate the toxicological effects of PAHs on the respiratory and immune functions. A sub-chronic exposure model of PAHs was established by inhalation. The pathological changes of lung tissues were observed with a light microscope. Inflammatory reactions in alveolar lavage fluid were determined using the corresponding kit. The levels of interleukin-6 (IL-6) and interleukin-8 (IL-8) were detected with enzyme linked immunosorbent assay (ELISA) kit; the proliferation of lymphocytes in spleen was detected with methyl tetrazolium (MTT); DNA immune damage was determined with DNA gel electrophoresis. The results showed that (1) the total concentration of 16 PAHs ranged from 41.1 to 387 ng/m 3 , with a mean value of 170 ng/m 3 , and the concentration of PAHs in PM 2.5 was higher in winter than in other seasons. (2) The sources of PAHs in the atmosphere of Xi'an urban area were mainly coal combustion, and the equivalent carcinogenic concentration of PAHs in PM 2.5 was 3.9 ng/m 3 . (3) Foreign body granuloma formation and inflammatory cell damage were observed in the lungs of rats infected with toxin; the levels of reactive oxygen species (ROS) and mobile device assistant (MDA) increased while nitric oxide synthase (NOS) decreased with the increase of dose; the expression levels of IL-6 and IL-8 elevated with the increase of toxin dose, showing an obvious dose-effect relationship; the level of PAHs damage to cells showed a dose-effect relationship. Sub-chronic exposure to PAHs could cause sustained inflammatory injury to the organism. Measures should be taken to counter the problems of PAHs in PM 2.5 in Xi'an and relevant health promotion strategies should be developed.

Five new furanobutenolide-derived C 19 -norcembranoid diterpenes, sinudenoids A-E ( 1-5 , respectively), were isolated from the soft coral Sinularia densa . Sinudenoid A ( 1 ) possesses an uncommon 5/5/11-fused tricyclic ring system. Sinudenoids B-D ( 2-4 , respectively) share the same tetracyclic 5/5/6/6 ring system but represent two kinds of new skeletons. Sinudenoid E ( 5 ) is the second compound with the rare 8/8 bicyclic carbon core. A plausible biosynthesis pathway for compounds 1-6 is proposed. Compound 5 exhibits strong anti-inflammatory activity in the zebrafish model.

Background: Immune cells, including neutrophils, natural killer (NK) cells, T cells, NKT cells and macrophages, participate in the progression of acute liver injury and hepatic recovery. To date, there has been no systematic study on the quantitative changes in these different immune cells from initial injury to subsequent recovery., Aim: To investigate the infiltration changes of various immune cells in acute liver injury models over time, and to study the relationship between the changes in leukocyte cell-derived chemotaxin 2 (LECT2) and the infiltration of several immune cells., Methods: Carbon tetrachloride- and concanavalin A-induced acute liver injury models were employed to mimic toxin-induced and autoimmune-mediated liver injury respectively. The quantitative changes in various immune cells were monitored at different time points. Serum samples were collected, and liver tissues were harvested. Ly6G, CD161, CD4, CD8 and F4/80 staining were used to indicate neutrophils, NK/NKT cells, CD4 + T cells, CD8 + T cells and macrophages, respectively. Lect2-KO mice were used to detect the function of LECT2., Results: During the injury and repair process, different types of immune cells began to increase, reached their peaks and fell into decline at different time points. Furthermore, when the serum alanine transaminase (ALT) and aspartate transaminase (AST) indices reverted to normal levels 7 d after the injury, the infiltration of immune cells still existed even 14 d after the injury, showing an obvious lag effect. We found that the expression of LECT2 was upregulated in acute liver injury mouse models, and the liver injuries of Lect2-KO mice were less severe than those of wild-type mice. Compared with wild-type mice, Lect2-KO mice had different immune cell infiltration., Conclusion: The recovery time of immune cells was far behind that of serum ALT and AST during the process of liver repair. LECT2 could regulate monocyte/macrophage chemotaxis and might be used as a therapeutic target for acute liver injury., Competing Interests: Conflict-of-interest statement: All the authors report no relevant conflicts of interest for this article., (©The Author(s) 2022. Published by Baishideng Publishing Group Inc. All rights reserved.)

Bone marrow skeletal stem cells (SSCs) secrete many cytokines including stromal derived factor-1 or CXCL12, which influences cell proliferation, migration, and differentiation. All CXCL12 splice variants are rapidly truncated on their N-terminus by dipeptidyl peptidase 4 (DPP4). This includes the common variant CXCL12 alpha (1-68) releasing a much less studied metabolite CXCL12(3-68). Here, we found that CXCL12(3-68) significantly inhibited SSC osteogenic differentiation and RAW-264.7 cell osteoclastogenic differentiation and induced a senescent phenotype in SSCs. Importantly, pre-incubation of SSCs with CXCL12(3-68) significantly diminished their ability to migrate toward CXCL12(1-68) in transwell migration assays. Using a high-throughput G-protein-coupled receptor (GPCR) screen (GPCRome) and bioluminescent resonance energy transfer molecular interaction assays, we revealed that CXCL12(3-68) acts via the atypical cytokine receptor 3-mediated β-arrestin recruitment and as a competitive antagonist to CXCR4-mediated signaling. Finally, a reverse phase protein array assay revealed that DPP4-cleaved CXCL12 possesses a different downstream signaling profile from that of intact CXCL12 or controls. The data presented herein provides insights into regulation of CXCL12 signaling. Importantly, it demonstrates that DPP4 proteolysis of CXCL12 generates a metabolite with significantly different and previously overlooked bioactivity that helps explain discrepancies in the literature. This also contributes to an understanding of the molecular mechanisms of osteoporosis and bone fracture repair and could potentially significantly affect the interpretation of experimental outcomes with clinical consequences in other fields where CXCL12 is vital, including cancer biology, immunology, cardiovascular biology, neurobiology, and associated pathologies., Competing Interests: The authors declare the following competing financial interest(s): Brian F. Volkman reports a potential COI based on ownership of the Protein Foundery, LLC, which generated the CXCL12 isoforms used in this study., (© 2022 American Chemical Society.)

Background: Mitophagy protects against cerebral ischemia/reperfusion (CI/R)-induced neuronal apoptosis via mitochondrial clearance. Although taurine-upregulated gene 1 (lncRNA TUG1) has been proposed to be involved in the neuronal apoptosis evoked by CI/R, its specific role in mitophagy during the progression of CI/R injury remains unknown., Methods: The CI/R rat model was established using middle cerebral artery occlusion/reperfusion (MCAO/R). Human neuroblastoma cell line SH-SY5Y was subjected to oxygen-glucose deprivation and reoxygenation (OGD/R). Ubiquitination assay, co-immunoprecipitation assay, RNA pull-down, and RNA immunoprecipitation were used to determine the interplay among TUG1, sirtuin 1 (SIRT1), and F-box and WD repeat domain-containing 7 (FBXW7)., Results: The upregulation of the TUG1 level and downregulation of the mitophagy were observed in both MCAO/R-treated rats and OGD/R-treated cells. The administration of si-TUG1 (a siRNA directed against TUG1) potentiated mitophagy and suppressed neuronal apoptosis in OGD/R-treated cells. However, the neuroprotective effect of si-TUG1 was reversed by mitophagy inhibitor or SIRT1 knockdown in vitro. Functionally, TUG1 enhanced FBXW7-mediated SIRT1 ubiquitination by upregulating FBXW7 expression. The overexpression of FBXW7 abrogated the si-TUG1-reinforced mitophagy by decreasing SIRT1 expression, thus aggravating neuronal apoptosis in the OGD/R+si-TUG1-treated cells. In rats with MCAO/R, the interference of TUG1 clearly decreased neuronal apoptosis, lessened the infarct volume, and relieved the neurological deficits., Conclusion: TUG1 knockdown promotes SIRT1-induced mitophagy by suppressing FBXW7-mediated SIRT1 degradation, thus relieving the neuronal apoptosis induced by CI/R injury. LncRNA TUG1 promotes neuronal apoptosis through inhibition of mitophagy. TUG1 decreased SIRT1 expression by promoting FBXW7-mediated SIRT1 ubiquitination. FBXW7/SIRT1 axis mediated the effect of TUG1 on OGD/R-induced neuronal apoptosis by regulating mitophagy., (© 2022. The Author(s), under exclusive licence to Springer Nature B.V.)

Natural products have various and complicated structures, which is still a challenge for elucidating these compounds, especially for those lacking two-dimensional nuclear magnetic resonance (2D NMR) correlations mainly caused by high C/H ratios or proton-deficient and multiple heteroatoms through the conventional structural analytical methods. We reported a novel module-assembly calculation method named Dooerafa, which included constructing the meta-structures by a grafting method based on the crucial and the limited 2D NMR correlations, ring-contraction strategy based on mechanic force field and quantum chemical theory, and self-assemble calculation in Python programming for shaping up the structural candidates along with DFT-GIAO calculation. This new method, verified by a known alkaloid spiroreticulatine with the structure determined by X-ray diffraction, was performed for the structural elucidation of aaptourinamine isolated from marine sponge Aaptos suberitoides , showing us a brand new scaffold of imidazo [4,5,1-ij]pyrrolo [3,2-f]quinolin-7(8H)-one, which has a biosynthetic relationship with the bioactive and structurally unique aaptamine alkaloid.

Objective: This study aims to clinically investigate and compare the therapeutic effects and treatment cycle between traditional direct bonding and OrthGuide computer-aided indirect bonding in orthodontic treatment., Methods: Forty patients treated at the Department of Orthodontics, Beijing Rytime Dental Hospital between July 1, 2016, and December 31, 2019, were included. The patients were divided into a control group ( n = 20, traditional direct bonding) and a test group ( n = 20, OrthGuide computer-aided indirect bonding). The American Board of Orthodontics (ABO) measurement was performed on patients using Uceph cephalometric analysis software to compare intragroup and intergroup differences, and the treatment cycles of all patients were recorded., Results: After treatment, U1-NA (mm), ∠U1-SN (°), LL-EP (mm), and UL-EP (mm) in the control group were significantly lower than before treatment, and there was no significant difference in other ABO measurement indexes, while the test group showed no marked difference in all ABO measurements between pre- and posttreatment. Further, intergroup comparison showed no significant difference in ABO measurements in pre- and posttreatment between the two groups. The test group had a shorter treatment cycle than the control group, with an average treatment cycle of 21.20 ± 7.14 months in the control group and 17.17 ± 4.16 months in the test group., Conclusion: There was no significant difference in the therapeutic effects between the direct and indirect bonding techniques. However, OrthGuide computer-assisted indirect bonding demonstrated a significantly shorter treatment cycle and might be more efficient than traditional direct bonding., Competing Interests: The authors declare that they have no competing interests., (Copyright © 2022 Min Wang et al.)

Five new cembranes, named sarcoeleganolides C-G ( 1 - 5 ), along with three known analogs ( 6 - 8 ) were isolated from soft coral Sarcophyton elegans collected from the Yagong Island, South China Sea. Their structures and absolute configurations were determined by extensive spectroscopic analysis, QM-NMR, and TDDFT-ECD calculations. In addition, compound 3 exhibited better anti-inflammation activity compared to the indomethacin as a positive control in zebrafish at 20 μM.

Background: Uninterrupted use of oral anticoagulants before atrial fibrillation (AF) ablation can reduce the incidence of perioperative thromboembolic events. However, the effect of new oral anticoagulants on activated clotting time (ACT) in response to heparin during AF ablation in Chinese populations remains unknown. The aim of the present retrospective study was to investigate the value of ACTs in response to intraoperative heparin administration in patients using dabigatran or rivaroxaban., Methods: From January 2018 to December 2021, a total of 173 patients undergoing AF ablation were included in the study, in which 101 patients were treated with dabigatran, 72 patients were treated with rivaroxaban. The intraoperative ACT values were examined in both groups. The incidence of periprocedural complications was evaluated., Results: Initial heparin dosage (88 ± 19 U/kg vs. 78 ± 27 U/kg, P < 0.05), total heparin dosage (137 ± 41 U/kg vs. 106 ± 52 U/kg, P < 0.05) during the ablation procedure were higher in the dabigatran group than those in the rivaroxaban group. Mean ACT (280 ± 36 s vs. 265 ± 30 s, P < 0.05), and the percentage of ACTs within the therapeutic range (250-350 s) (74% ± 26% vs. 60% ± 29%, P < 0.05) were significantly lower in the dabigatran group than those in the rivaroxaban group, particularly in male patients. Furthermore, the average time of achieving the target ACT (250-350 s) was also found longer in the dabigatran group ( P < 0.05) as compared with the rivaroxaban group. No significant difference was found in the incidence of periprocedural complications between the two groups., Conclusions: The anticoagulant effect of uninterrupted rivaroxaban therapy appears to be more stable and efficient than dabigatran administration during catheter ablation in patients with AF., (© 2022 JGC All rights reserved; www.jgc301.com.)

Background: With the progress of urbanization, the mobility of people has gradually increased, which has led to the further spread of dengue fever. This study evaluated the transmissibility of dengue fever within districts and between different districts in Zhanjiang City to provide corresponding advice for cross-regional prevention and control. Methods: A mathematical model of transmission dynamics was developed to explore the transmissibility of the disease and to compare that between different regions. Results: A total of 467 DF cases (6.38 per 100,000 people) were reported in Zhanjiang City in 2018. In the model, without any intervention, the number of simulated cases in this epidemic reached about 950. The dengue fever transmissions between districts varied within and between regions. When the spread of dengue fever from Chikan Districts to other districts was cut off, the number of cases in other districts dropped significantly or even to zero. When the density of mosquitoes in Xiashan District was controlled, the dengue fever epidemic in Xiashan District was found to be significantly alleviated. Conclusions: When there is a dengue outbreak, timely measures can effectively control it from developing into an epidemic. Different prevention and control measures in different districts could efficiently reduce the risk of disease transmission.

Conventional methods of drug design require compromise in the form of side effects to achieve sufficient efficacy because targeting drugs to specific organs remains challenging. Thus, new strategies to design organ-specific drugs that induce little toxicity are needed. Based on characteristic tissue niche-mediated drug distribution (TNMDD) and patterns of drug metabolism into specific intermediates, we propose a strategy of distribution- and metabolism-based drug design (DMBDD); through a physicochemical property-driven distribution optimization cooperated with a well-designed metabolism pathway, SH-337, a candidate potassium-competitive acid blocker (P-CAB), was designed. SH-337 showed specific distribution in the stomach in the long term and was rapidly cleared from the systemic compartment. Therefore, SH-337 exerted a comparable pharmacological effect but a 3.3-fold higher no observed adverse effect level (NOAEL) compared with FDA-approved vonoprazan. This study contributes a proof-of-concept demonstration of DMBDD and provides a new perspective for the development of highly efficient, organ-specific drugs with low toxicity., Competing Interests: The authors declare no competing financial interest., (Copyright © 2022 Ming-Shu Wang et al.)

Protein kinases play crucial roles in many cellular signaling processes, making them become important targets for drug discovery. But drug resistance mediated by mutation puts a barrier to the therapeutic effect of kinase inhibitors. Fragment-based drug discovery has been successfully applied to overcome such resistance. However, the complicate kinase-inhibitor fragment interaction and fragment-to-lead process seriously limit the efficiency of kinase inhibitor discovery against resistance caused by mutation. Here, we constructed a comprehensive web platform KinaFrag for the fragment-based kinase inhibitor discovery to overcome resistance. The kinase-inhibitor fragment space was investigated from 7783 crystal kinase-inhibitor fragment complexes, and the structural requirements of kinase subpockets were analyzed. The core fragment-based virtual screening workflow towards specific subpockets was developed to generate new kinase inhibitors. A series of tropomyosin receptor kinase (TRK) inhibitors were designed, and the most potent compound YT9 exhibits up to 70-fold activity improvement than marketed drugs larotrectinib and selitrectinib against G595R, G667C and F589L mutations of TRKA. YT9 shows promising antiproliferative against tumor cells in vitro and effectively inhibits tumor growth in vivo for wild type TRK and TRK mutants. Our results illustrate the great potential of KinaFrag in the kinase inhibitor discovery to combat resistance mediated by mutation. KinaFrag is freely available at http://chemyang.ccnu.edu.cn/ccb/database/KinaFrag/., (© The Author(s) 2022. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.)

LECT2 (leucocyte cell-derived chemotaxin 2) is a 16-kDa protein mainly produced by hepatocytes. It was first isolated in PHA-activated human T-cell leukaemia SKW-3 cells and originally identified as a novel neutrophil chemotactic factor. However, many lines of studies suggested that LECT2 was a pleiotropic protein, it not only functioned as a cytokine to exhibit chemotactic property, but also played multifunctional roles in some physiological conditions and pathological abnormalities, involving liver regeneration, neuronal development, HSC(haematopoietic stem cells) homeostasis, liver injury, liver fibrosis, hepatocellular carcinoma, metabolic disorders, inflammatory arthritides, systemic sepsis and systemic amyloidosis. Among the above studies, it was discovered that LECT2 could be a promising molecular biomarker and therapeutic target. This review summarizes LECT2-related receptors and pathways, basic and clinical researches, primarily in mice and human, for a better comprehension and management of these diseases in the future., (© 2022 The Authors. Journal of Cellular and Molecular Medicine published by Foundation for Cellular and Molecular Medicine and John Wiley & Sons Ltd.)

Backgroud: Zicuiyin (ZCY) decoction created by Xichun Zhang in the Qing dynasty has been used on diabetes mellitus and complications for more than two centuries in China. Huangkui capsule (HKC) is a listed Chinese patent medicine to treat diabetic kidney disease (DKD). To determine whether ZCY is non-inferior to HKC in the treatment of DKD, a multicenter, parallel-control, open-label, randomized clinical trial was conducted., Methods: In this clinical trial, 88 DKD patients were recruited at three centers in Tianjin from January 2018 to December 2019. They were randomized to receive HKC (2.5 g, TID) or ZCY (crude drug amount 75 g, 150 ml, BID) for eight weeks based on routine treatment. The primary outcome was the change of estimated glomerular filtration rate (eGFR). The secondary outcomes included change of serum creatinine (SCr), urinary albumin excretion rate, 24 h urinary protein, urinary albumin-creatinine ratio, glycosylated hemoglobin A1c, symptom scores, and microbiota compositions profiles., Results: The change of eGFR in HKC and ZCY groups were -7.08 ± 24.65 and 2.57 ± 18.49 ml/min/1.73 m 2 , respectively (p < 0.05). The 95% lower confidence limit for the difference between the estimated means was 1.93 ml/min/1.73 m 2 , establishing the superiority of ZCY. Compared to HKC, ZCY could significantly decrease SCr and symptom scores (p < 0.05). There were no significant differences in other outcomes between the two groups (p > 0.05). ZCY ameliorated gut microbiota dysbiosis, including increased Prevotellaceae and Lactobacillaceae and decreased Enterobacteriales, Clostridiaceae and Micrococcaceae. No severe adverse events were reported in any group., Conclusions: ZCY had better efficacy in improving and protecting kidney function. It would be an alternative option to treat DKD, especially those who decline eGFR and gut microbiota dysbiosis., Trial Registration: Chinese Clinical Trial Registry: ChiCTR-OON-17012076. Registered July 21, 2017., (Copyright © 2022 Elsevier GmbH. All rights reserved.)

Background: Metagenomic next-generation sequencing (mNGS) is an important supplement to conventional tests for pathogen detections of pneumonia. However, mNGS pipelines were limited by irregularities, high proportion of host nucleic acids, and lack of RNA virus detection. Thus, a regulated pipeline based on mNGS for DNA and RNA pathogen detection of pneumonia is essential., Methods: We performed a retrospective study of 151 patients with pneumonia. Three conventional tests, culture, loop-mediated isothermal amplification (LAMP) and viral quantitative real-time polymerase chain reaction (qPCR) were conducted according to clinical needs, and all samples were detected using our optimized pipeline based on the mNGS (DNA and RNA) method. The performances of mNGS and three other tests were compared. Human DNA depletion was achieved respectively by MolYsis kit and pre-treatment using saponin and Turbo DNase. Three RNA library preparation methods were used to compare the detection performance of RNA viruses., Results: An optimized mNGS workflow was built, which had only 1-working-day turnaround time. The proportion of host DNA in the pre-treated samples decreased from 99 to 90% and microbiome reads achieved an approximately 20-fold enrichment compared with those without host removal. Meanwhile, saponin and Turbo DNase pre-treatment exhibited an advantage for DNA virus detection compared with MolYsis. Besides, our in-house RNA library preparation procedure showed a more robust RNA virus detection ability. Combining three conventional methods, 76 (76/151, 50.3%) cases had no clear causative pathogen, but 24 probable pathogens were successfully detected in 31 (31/76 = 40.8%) unclear cases using mNGS. The agreement of the mNGS with the culture, LAMP, and viral qPCR was 60%, 82%, and 80%, respectively. Compared with all conventional tests, mNGS had a sensitivity of 70.4%, a specificity of 72.7%, and an overall agreement of 71.5%., Conclusions: A complete and effective mNGS workflow was built to provide timely DNA and RNA pathogen detection for pneumonia, which could effectively remove the host sequence, had a higher microbial detection rate and a broader spectrum of pathogens (especially for viruses and some pathogens that are difficult to culture). Despite the advantages, there are many challenges in the clinical application of mNGS, and the mNGS report should be interpreted with caution., (© 2022. The Author(s).)

Background: The precise etiology of approximately 50% of patients with recurrent spontaneous abortion (RSA) is unclear, known as unexplained recurrent spontaneous abortion (URSA). This study identified the genetic polymorphisms in patients with URSA., Methods: Genomic DNA was extracted from 30 couples with URSA and 9 couples with normal reproductive history for whole exome sequencing. Variations in annotation, filtering, and prediction of harmfulness and pathogenicity were examined. Furthermore, predictions of the effects of changes in protein structure, Sanger validation, and functional enrichment analyses were performed. The missense mutated genes with significant changes in protein function, and genes with mutations of premature stop, splice site, frameshift, and in-frame indel were selected as candidate mutated genes related to URSA., Results: In 30 unrelated couples with URSA, 50%, 20%, and 30% had 2, 3, and more than 4 miscarriages, respectively. Totally, 971 maternal and 954 paternal mutations were found to be pathogenic or possibly pathogenic after preliminary filtering. Total variations were not associated with age nor the number of miscarriages. In 28 patients (involving 23 couples), 22 pathogenic or possibly pathogenic variants of 19 genes were found to be strongly associated with URSA, with an abnormality rate of 76.67%. Among these, 12 missense variants showed obvious changes in protein functions, including ANXA5 (c.949G>C; p.G317R), APP (c.1530G>C; p.K510N), DNMT1 (c.2626G>A; p.G876R), FN1 (c.5621T>C; p.M1874T), MSH2 (c.1168G>A; p.L390F), THBS1 (c.2099A>G; p.N700S), KDR (c.2440G>A; p.D814N), POLR2B (c.406G>T; p.G136C), ITGB1 (c.655T>C; p.Y219H), PLK1 (c.1210G>T; p.A404S), COL4A2 (c.4808 A>C; p.H1603P), and LAMA4 (c.3158A>G; p.D1053G). Six other genes with mutations of premature stop, splice site, frameshift, and in-frame indel were also identified, including BUB1B (c.1648C>T; p.R550*) and MMP2 (c.1462&#95;1464delTTC; p.F488del) from the father, and mutations from mother and/or father including BPTF (c.396&#95;398delGGA; p.E138 del and c.429&#95;431GGA; p.E148del), MECP2 (c.21&#95;23delCGC; p.A7del), LAMA2 (HGVS: NA; Exon: NA; SPLICE&#95;SITE, DONOR), and SOX21 (c.640 &#95;641insT; p. A214fs, c.644dupC; p. A215fs and c.644&#95;645ins ACGCGTCTTCTTCCCGCAGTC; p. A215dup)., Conclusions: These pathogenic or potentially pathogenic mutated genes may be potential biomarkers for URSA and may play an auxiliary role in the treatment of URSA., Competing Interests: Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://atm.amegroups.com/article/view/10.21037/atm-22-2179/coif). All authors report that this study was funded by the Science and Technology Research Project of Chongqing Education Commission (No. KJQN202100427) and the Young and Middle-Aged Medical Talents Project of Chongqing Municipal Health Commission/Chongqing Science and Technology Bureau (No. 2022GDRC001). The authors have no other conflicts of interest to declare., (2022 Annals of Translational Medicine. All rights reserved.)

The chemical profile and phytotoxic activity of the essential oil extracted from Artemisia sieversiana was investigated. In total 17 compounds were identified by GC/MS, representing 99.17% of the entire oil, among which α-thujone (64.46%) and eucalyptol (10.15%) were the most abundant constituents. The major components, their mixture as well as the essential oil exhibited significant phytotoxic activity against Amaranthus retroflexus , Medicago sativa , Poa annua and Pennisetum alopecuroides , with their IC 50 values ranged from 1.55 ∼ 6.21 mg/mL (α-thujone), 1.42 ∼ 17.81 mg/mL (eucalyptol), 0.23 ∼ 1.05 mg/mL (the mixture), and 1.89 ∼ 4.69 mg/mL (the essential oil) on the four tested species. The mixture of the major constituents exerted more potent effect compared with each individual compound, indicating the possible involvement of synergistic effect of these two compounds.